Modified coronavirus S proteins

Abstract

The present disclosure relates to modified coronavirus S proteins and virus-like particles (VLPs) comprising the modified coronavirus S proteins. The invention also relates to a method of increasing the purity and / or stability of a coronavirus S protein or a VLP comprising a modified coronavirus S protein in a host or host cell.

Description

Technical Field

[0001] The present disclosure relates to modified coronavirus S proteins and virus-like particles (VLPs) comprising modified coronavirus S proteins. The present disclosure also relates to methods for improving the purity, homogeneity and / or stability of coronavirus S proteins produced in a host or host cell. Background Art

[0002] Coronaviruses (CoVs) are the largest group of viruses belonging to the order Nidovirales, which includes the families Coronaviridae, Arteriviridae, Mesoniviridae, and Roniviridae. The Coronaviridae family includes one of the two subfamilies of the Coronaviridae family, the other being the Torovirinae. The Coronaviridae family is further subdivided into four genera, namely, alpha-, beta-, gamma-, and delta-coronaviruses. Members of the alphacoronavirus and betacoronaviruses are found only in mammals. The alphacoronavirus genus includes two human virus species, HCoV-229E and HCoV-NL63. Important animal alphacoronaviruses are transmissible gastroenteritis virus of pigs and feline infectious peritonitis virus.

[0003] Betacoronaviruses of clinical importance to humans are the Embecoviruses OC43 and HKU1 (which cause the common cold), the Sarbecoviruses SARS-CoV and SARS-CoV-2, and the Merbecovirus MERS-CoV. Sarbecovirus SARS-CoV-2, also known as 2019-nCoV and HCoV-19, first emerged in 2019 and causes coronavirus disease 2019 (COVID-19), a respiratory illness with high mortality and morbidity that has a major public health impact. SARS-CoV-2 outbreaks, such as the COVID-19 pandemic that began in 2020, are challenging for healthcare systems due to the virus's asymptomatic incubation period and high transmissibility. Long-term management of SARS-CoV-2 outbreaks will require high vaccination rates with effective vaccines worldwide.

[0004] Since its initial emergence in 2019, SARS-CoV-2 has mutated into numerous other lineages and sublineages through natural substitutions and indel events from ancestral strains. The phylogeny of these SARS-CoV-2 lineages is often represented by the PANGO nomenclature (Rambaut et al., 2020). Lineages of clinical importance are further labeled as variants of interest (VOI) or variant strains (VOC) based on the risk they pose to global public health and may be assigned names by the World Health Organization (WHO), such as the β (corresponding to B.1.351), γ (corresponding to P.1), δ (corresponding to B.1.617.2), and Omicron (corresponding to B.1.1.529) lineages. Mutations vary widely among all reported SARS-CoV-2 lineages, with potential implications for the efficacy and development of vaccines containing the coronavirus spike (S) protein.

[0005] The rod-shaped S protein is the most prominent structural feature of coronaviruses and is also a protrusion from the surface of the virus particle. The coronavirus S protein is a glycoprotein that is necessary for many coronaviruses to recognize host receptors and for the fusion of virus and host cell membranes to allow the virus to enter the cell (Belouzard et al., Viruses 2012 Jun; 4(6): 1011-33). As the main glycoprotein on the surface of the viral envelope, the S protein of the Coronaviridae family is the main target of neutralizing antibodies triggered by natural infection (including SARS-CoV-2 infection) and is also a key antigen used in coronavirus vaccine preparations.

[0006] Like the S proteins of other coronaviruses, the SARS-CoV-2 S protein is initially synthesized as a precursor protein. The single precursor S protein forms a homotrimer, is glycosylated in the Golgi compartment, and is processed to remove the signal peptide. The S protein requires a two-step protease-mediated activation to promote membrane fusion. The SARS-CoV-2 S protein is characterized by a multi-base RRAR furin protease cleavage site at the S1 / S2 junction, which is likely processed in the Golgi compartment to produce two separate polypeptides: S1 and S2 polypeptides (or subunits), which remain non-covalently associated as an S1 / S2 protomer within a homotrimer in the prefusion conformation (Walls et al., Cell 2020 181(2)p281-292; Li et al., eLife 2019;8:e51230). Furin cleavage at the S1 / S2 junction and further cleavage at the S2′ site upstream of the fusion peptide occur during viral entry into the cell surface or endosomes and can be mediated by several proteases. Stabilization of the S protein ectodomain in the prefusion conformation tends to increase recombinant expression, probably by preventing triggering or misfolding due to a preference for a more stable postfusion structure (Hsieh et al., Science 2020, 369p.1501-1505).

[0007] The S1 domain is further composed of an N-terminal domain (NTD) and a receptor binding domain (RBD). Neutralizing antibodies from individuals infected with SARS-CoV-2 have been shown to target the RBD of the S1 subunit of the S protein (Premkumar, L., 2020 Science Immunology 11Jun 2020: Vol. 5, No. 48). Highly protective antibodies specific to NTD and targeting conserved supersites have also been reported (Lok et al., 2021, Cell Host & Microbe 29).

[0008] Vaccination prevents disease by inducing an immune response in a subject to a possible agent prior to infection. Traditionally, this has been achieved by using attenuated live or whole inactivated forms of infectious agents as immunogens. In order to avoid the disadvantages of using whole viruses (such as inactivated or attenuated viruses) to make vaccines, viral proteins or subunits or recombinant versions thereof have been used as vaccines. A major obstacle to using natural or recombinant viral proteins as vaccine agents is ensuring that the conformation of the protein mimics the antigen in its natural environment. Suitable adjuvants, and in the case of peptides, suitable carrier proteins, can be used to enhance the immune response. In addition, viral proteins or subunits as vaccines may primarily elicit humoral responses and therefore fail to evoke lasting immunity. Subunit vaccines may be ineffective for diseases for which whole inactivated viruses can be shown to provide excellent protection.

[0009] Virus-like particles (VLP) can be used in immunogenic compositions to express viral proteins in a preferred conformation that improves antigen presentation to the immune system. VLPs are very similar to mature virions, but they do not contain viral genomic material, and they are non-replicative, which helps to make them safe for use as vaccines. In addition, VLPs can be engineered to express viral glycoproteins on the VLP surface, which is their natural physiological structure. Since VLPs are similar to complete virions and are multivalent particle structures, VLPs may be more effective than soluble envelope protein antigens in inducing glycoprotein neutralizing antibodies.

[0010] VLPs are self-assembled (in vivo assembly) by single or multiple viral structural proteins (such as coronavirus S protein) in an appropriate production host. Therefore, coronavirus VLPs can be produced by expressing recombinant coronavirus S protein in the host. However, the yield, homogeneity and overall quality of the recombinant S protein may be affected by the degradation of the recombinant protein in the expression host or host cell and / or in the subsequent protein purification process. Traditionally, strategies to minimize protein hydrolysis in hosts (such as plants) include organ-specific transgenic expression, organelle-specific protein targeting, transplantation of stable protein domains to unstable proteins, protein secretion in natural fluids, and co-expression of chaperone protease inhibitors. Although rational mutagenesis methods are possible for proteins where precise information on sensitive cleavage sites is available, in most cases, protein degradation occurs too quickly to determine the initial cleavage point.

[0011] To achieve widespread vaccination of the global population, efficient expansion and manufacturing of coronavirus VLPs in quantity requires effective expression of coronavirus S protein with high quality, stability and purity. Summary of the invention

[0012] The yield, homogeneity, and overall quality of recombinant proteins may be affected by degradation of the recombinant protein in the expression host or host cells and / or during subsequent protein purification.

[0013] The present disclosure provides a modified coronavirus spike protein (S protein), which comprises one or more than one amino acid sequence modification compared to the corresponding parent or unmodified amino acid sequence. Compared to the unmodified S protein, the modified S protein has improved properties, such as increased integrity, increased stability, increased resistance to degradation or proteolytic cleavage, increased purity and homogeneity when extracted and / or purified from a host or host cell, or a combination thereof.

[0014] In one aspect, a modified coronavirus S protein is provided, comprising one or more amino acid sequence modifications compared to the corresponding parent amino acid sequence, wherein the one or more modifications stabilize the modified coronavirus S protein, and wherein the one or more modifications include:

[0015] i) substitution of one or more amino acids to introduce an N-glycosylation site at a position corresponding to position 251, 252 or 253 of the reference sequence SEQ ID NO: 1, wherein the N-glycosylation site is asparagine (N) in the consensus sequence NX-(S or T); or

[0016] ii) a deletion of at least four consecutive amino acid residues, wherein the deletion includes at least the residues corresponding to positions 249 and 250 of the reference sequence SEQ ID NO:1.

[0017] The modified coronavirus S protein comprising i) substitution of one or more than one amino acid to introduce an N-glycosylation site may also comprise deletion of one or more than one amino acid.

[0018] The one or more deletions in the modified S protein may include the following deletions:

[0019] i) the amino acid residues corresponding to at least positions 247, 248, 249 and 250 of the reference sequence SEQ ID NO: 1;

[0020] ii) at least the amino acid residues corresponding to positions 248, 249, 250 and 251 of the reference sequence SEQ ID NO: 1;

[0021] iii) amino acid residues corresponding to at least positions 249, 250, 251 and 252 of the reference sequence SEQ ID NO: 1;

[0022] iv) the amino acid residues corresponding to at least positions 246, 247, 248, 249 and 250 of the reference sequence SEQ ID NO: 1;

[0023] v) the amino acid residues corresponding to at least positions 247, 248, 249, 250 and 251 of the reference sequence SEQ ID NO: 1;

[0024] vi) the amino acid residues corresponding to at least positions 248, 249, 250, 251 and 252 of the reference sequence SEQ ID NO: 1;

[0025] vii) amino acid residues corresponding to at least positions 246, 247, 248, 249, 250 and 251 of the reference sequence SEQ ID NO: 1;

[0026] viii) the amino acid residues corresponding to at least positions 247, 248, 249, 250, 251 and 252 of the reference sequence SEQ ID NO: 1; or

[0027] ix) the amino acid residues corresponding to at least positions 246, 247, 248, 249, 250, 251 and 252 of the reference sequence SEQ ID NO:1.

[0028] The modified coronavirus S protein comprising i) substitution of one or more amino acids to introduce an N-glycosylation site may also comprise deletion of one or more amino acids, wherein,

[0029] i) an N-glycosylation site is introduced at the amino acid corresponding to position 251 of the reference sequence SEQ ID NO: 1, and the deletion comprises at least the amino acid residues corresponding to positions 249 and 250 of the reference sequence SEQ ID NO: 1;

[0030] ii) an N-glycosylation site is introduced at the amino acid corresponding to position 252 of the reference sequence SEQ ID NO: 1, and the deletion comprises at least the amino acid residues corresponding to positions 249 and 250 of the reference sequence SEQ ID NO: 1;

[0031] iii) an N-glycosylation site is introduced at the amino acid corresponding to position 253 of the reference sequence SEQ ID NO: 1, and the deletion comprises at least the amino acid residues corresponding to positions 249 and 250 of the reference sequence SEQ ID NO: 1;

[0032] iv) an N-glycosylation site is introduced at the amino acid corresponding to position 253 of the reference sequence SEQ ID NO: 1, and the deletion comprises at least four consecutive amino acid residues, wherein the deletion comprises at least the residues corresponding to positions 249 and 250 of the reference sequence SEQ ID NO: 1;

[0033] v) an N-glycosylation site is introduced at the amino acid corresponding to position 253 of the reference sequence SEQ ID NO: 1, and the deletion comprises at least the amino acid residues corresponding to positions 246, 247, 248, 249, 250, 251 and 252 of the reference sequence SEQ ID NO: 1.

[0034] The modified coronavirus S protein may include a replacement of asparagine (N) at a position corresponding to position 252 or 253 of the reference sequence SEQ ID NO: 1, or the amino acid sequence modification includes a replacement of asparagine (N) at a position corresponding to position 251 of the reference sequence SEQ ID NO: 1 and a replacement of threonine (T) at a position corresponding to position 253.

[0035] In other aspects, the modified S protein may comprise 80% to 100% identity to the sequence of SEQ ID NO: 8, 10, 12, 16, 20, 39, 41, 43, 45, 47, 49, 51, 53, 55 or 57.

[0036] The modified coronavirus S protein can be a chimeric S protein, wherein the chimeric S protein comprises a cytoplasmic tail region derived from influenza virus hemagglutinin. In one aspect, the coronavirus S protein is derived from a beta coronavirus. For example, the coronavirus S protein may be derived from lineage A, B, C or D of a beta coronavirus. In one aspect, the coronavirus S protein may be derived from lineage B of a beta coronavirus. In addition, the modified S protein may comprise a plant-specific N-glycan.

[0037] A genetic construct or nucleic acid is further provided, which comprises a nucleotide sequence encoding the above-mentioned modified coronavirus S protein.

[0038] In another aspect, a virus-like particle (VLP) or a plurality of virus-like particles (VLP) are provided, comprising a modified S protein as described above. Compared to VLPs assembled from S proteins that are not modified as described herein, the VLPs comprise a greater amount of full-length S protein. The VLPs may also include plant lipids.

[0039] In other aspects, a composition is provided, comprising a pharmaceutically acceptable carrier, vehicle or excipient and an effective dose of a modified S protein as described herein or a VLP comprising a modified S protein as described herein.

[0040] In other aspects, a vaccine for inducing an immune response is provided. The vaccine may comprise an effective dose of a modified S protein as described herein, a VLP comprising a modified S protein as described herein, or a composition as described herein. The vaccine may also comprise an adjuvant, such as AS03.

[0041] In yet another aspect, the vaccine may be a multivalent vaccine comprising a mixture of VLPs.

[0042] In other aspects, a method of inducing immunity to coronavirus infection in a subject is provided, the method comprising administering to the subject a composition or vaccine as described above.

[0043] In yet another aspect, a method of inducing an immune response in a subject is provided, the method comprising administering to the subject a composition or vaccine as described above. Also provided is an antibody or antibody fragment prepared using the composition or vaccine.

[0044] In other aspects, the use of the composition or vaccine as described above for inducing immunity to coronavirus infection in a subject is provided. Also provided is the use of the composition or vaccine as described above for inducing an immune response in a subject.

[0045] In another aspect, a host or host cell is also provided, comprising a modified S protein, construct, nucleic acid and / or VLP as described herein. The host or host cell may include a plant, a part of a plant, a plant cell, a fungus, a fungal cell, an insect, an insect cell, an animal or an animal cell.

[0046] In other aspects, a method for producing a modified S protein in a host or a host cell is provided, comprising: a) introducing a nucleic acid comprising a nucleotide sequence encoding the modified coronavirus S protein as described above into the host or the host cell, or providing a host or a host cell comprising a nucleic acid comprising a nucleotide sequence encoding the modified coronavirus S protein as described above, and b) incubating the host or the host cell under conditions allowing expression of the nucleic acid, thereby producing the modified S protein.

[0047] Also provided is a method for producing a modified S protein in a host or a host cell, comprising: a) expressing the modified S protein described herein in the host or the host cell by incubating the host or the host cell under conditions allowing expression of the modified S protein, thereby producing the modified S protein. The modified S protein can be further extracted and purified from the host or the host cell.

[0048] In other aspects, a method for producing virus-like particles (VLPs) in a host or host cell is provided, comprising: a) introducing a nucleic acid comprising a nucleotide sequence encoding a modified coronavirus S protein as described above into a host or host cell, or providing a host or host cell comprising a nucleic acid comprising a nucleotide sequence encoding a modified coronavirus S protein as described above, and b) incubating the host or host cell under conditions that allow nucleic acid expression, thereby producing VLPs. The method may also include a step of harvesting the host or host cell c). VLPs may be further extracted and purified from the host or host cell. VLPs produced by the method are also provided.

[0049] In yet another aspect, a method for increasing the yield of full-length coronavirus S protein in a host or host cell is provided, the method comprising: a) introducing a nucleic acid comprising a nucleotide sequence encoding a modified coronavirus S protein as described above into a host or host cell, or providing a host or host cell comprising a nucleic acid comprising a nucleotide sequence encoding a modified coronavirus S protein as described above, and b) incubating the host or host cell under conditions allowing expression of the nucleic acid, thereby producing a modified S protein, wherein a higher amount or a higher proportion of the modified S protein is a full-length modified S protein compared to an unmodified S protein produced under similar conditions in the host or host cell.

[0050] In other aspects, a method for producing a modified coronavirus S protein with enhanced anti-proteolytic stability in a host or host cell is provided, the method comprising: a) introducing a nucleic acid comprising a nucleotide sequence encoding a modified coronavirus S protein as described above into a host or host cell, or providing a host or host cell comprising a nucleic acid comprising a nucleotide sequence encoding a modified coronavirus S protein as described above, and b) incubating the host or host cell under conditions that allow nucleic acid expression, thereby producing a modified S protein with improved anti-proteolytic stability compared to the anti-proteolytic stability of an unmodified S protein produced under similar conditions in the host or host cell; c) optionally extracting the modified S protein from the host or host cell. The modified S protein can be further purified from the host or host cell. A modified S protein produced by the above method is also provided. Compared to an S protein that has not been modified as described herein, the modified S protein may exhibit improved anti-proteolytic stability. One or more VLPs comprising a modified S protein are also provided.

[0051] In addition, in other aspects, a method for producing a virus-like particle (VLP) with an increased content of a full-length S protein in a host or host cell is provided, the method comprising: a) introducing a nucleic acid comprising a sequence encoding a modified S protein as described above into a host or host cell, or providing a host or host cell comprising a nucleic acid comprising a sequence encoding a modified S protein as described above, b) incubating the host or host cell under conditions that allow expression of the nucleic acid, thereby producing VLPs, wherein the VLPs have an increased content of the full-length S protein compared to VLPs comprising an unmodified S protein produced under similar conditions in the host or host cell; and c) optionally extracting the VLPs from the host or host cell. In addition, the VLPs can be purified from the host or host cell. Virus-like particles produced by this method are also provided.

[0052] In another aspect, a method for improving the anti-proteolytic stability of a coronavirus S protein produced in a host or a host cell is provided, the method comprising: a) modifying a parent coronavirus S protein sequence to produce a modified coronavirus S protein having a modified sequence, wherein the modified coronavirus S protein comprises one or more amino acid sequence modifications compared to the parent coronavirus S protein, the one or more modifications comprising:

[0053] i) substitution of one or more amino acids to introduce an N-glycosylation site at a position corresponding to position 251, 252 or 253 of the reference sequence SEQ ID NO: 1, wherein the N-glycosylation site is asparagine (N) in the consensus sequence NX-(S or T); or

[0054] ii) a deletion of at least four consecutive amino acid residues, wherein the deletion includes at least the residues corresponding to positions 249 and 250 of the reference sequence SEQ ID NO: 1;

[0055] b) expressing the modified coronavirus S protein in a host or a host cell, thereby producing a modified S protein with increased anti-proteolytic stability compared to the anti-proteolytic stability of the parent coronavirus S protein produced under similar conditions in the host or host cell.

[0056] Further provided is a method for modifying a coronavirus S protein to produce a modified coronavirus S protein having one or more amino acid sequence modifications, wherein the one or more amino acid modifications stabilize the modified coronavirus S protein, the method comprising:

[0057] i) introducing one or more amino acid substitutions into the coronavirus S protein to introduce an N-glycosylation site at a position corresponding to position 251, 252 or 253 of the reference sequence SEQ ID NO: 1, wherein the N-glycosylation site is asparagine (N) in the consensus sequence NX-(S or T); or ii) introducing a deletion of at least four consecutive amino acid residues into the coronavirus S protein, wherein the deletion includes at least the residues corresponding to positions 249 and 250 of the reference sequence SEQ ID NO: 1, thereby modifying the coronavirus S protein.

[0058] Also provided are modified coronavirus S proteins and VLPs comprising the modified coronavirus S proteins prepared by the method.

[0059] This summary of the present invention does not necessarily describe all features of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1A A schematic diagram of the recipient vector 8716 used to assemble a vector plasmid encoding a modified coronavirus S protein is shown. Figure 1B A schematic diagram of vector 9125 encoding a modified S protein from the SARS-CoV-2B lineage with the GSAS+2P mutation is shown. Figure 1C A schematic diagram of vector 9801 encoding a modified S protein from the SARS-CoV-2B lineage with the GSAS+2P+del246-252 mutation is shown. Figure 1D A schematic diagram of vector 9802 encoding a modified S protein from the SARS-CoV-2B lineage with the GSAS+2P+D253N mutation is shown. Figure 1E A schematic diagram of vector 9808 encoding a modified S protein from the SARS-CoV-2B lineage with GSAS+2P+del246-252+D253N mutations is shown. Figure 1F A schematic diagram of vector 9513 encoding a modified S protein from the SARS-CoV-2B.1.617.2 lineage with the GSAS+2P mutation is shown. Figure 1G A schematic diagram of vector 10090 encoding a modified S protein from the SARS-CoV-2B.1.1.529 lineage with the GSAS+2P mutation is shown. Figure 1H A schematic diagram of vector 10346 encoding a modified S protein from the SARS-CoV-2B lineage with the GSAS+2P+G252N mutations is shown. Fig. 1I A schematic diagram of vector 10351 encoding a modified S protein from the SARS-CoV-2B lineage with GSAS+2P+P251N+D253T mutations is shown. Figure 1J A schematic diagram of vector 10502 encoding a modified S protein from the SARS-CoV-2B lineage with the GSAS+2P+del247-250 mutation is shown. Figure 1K A schematic diagram of vector 10503 encoding a modified S protein from the SARS-CoV-2B lineage with the GSAS+2P+del248-251 mutation is shown. Figure 1L A schematic diagram of vector 10504 encoding a modified S protein from the SARS-CoV-2B lineage with the GSAS+2P+del249-252 mutation is shown. Figure 1M A schematic diagram of vector 10505 encoding a modified S protein from the SARS-CoV-2B lineage with the GSAS+2P+del246-250 mutation is shown. Figure 1N A schematic diagram of vector 10506 encoding a modified S protein from the SARS-CoV-2B lineage with the GSAS+2P+del247-251 mutation is shown. Fig.1OA schematic diagram of vector 10507 encoding a modified S protein from the SARS-CoV-2B lineage with the GSAS+2P+del248-252 mutation is shown. Figure 1P A schematic diagram of vector 10508 encoding a modified S protein from the SARS-CoV-2B lineage with the GSAS+2P+del246-251 mutation is shown. Figure 1Q A schematic diagram of vector 10509 encoding a modified S protein from the SARS-CoV-2B lineage with the GSAS+2P+del247-252 mutation is shown. Figure 1R A schematic diagram of vector 10011 encoding a modified S protein from the SARS-CoV-2B.1.617.2 lineage with the GSAS+2P+D253N mutations is shown. Figure 1S A schematic diagram of vector 10092 encoding a modified S protein from the SARS-CoV-2 B.1.1.529 lineage with the GSAS+2P+D253N mutations is shown.

[0061] Figure 2A Shown is an electron micrograph of a virus-like particle (VLP) comprising a modified S protein from the SARS-CoV-2B lineage with the GSAS+2P mutation (construct 9125). Figure 2B Shown is an electron micrograph of virus-like particles (VLPs) comprising a modified S protein from the SARS-CoV-2B lineage with the GSAS+2P+del246-252 mutation (GSAS+2P+del246-252; construct 9801). Figure 2C Shown are electron micrographs of virus-like particles (VLPs) containing a modified S protein from the SARS-CoV-2B lineage with the GSAS+2P+D253N mutation (GSAS+2P+D253N; construct 9802). Figure 2D Shown are electron micrographs of virus-like particles (VLPs) containing a modified S protein from the SARS-CoV-2B lineage with the GSAS+2P+del246-252+D253N mutation (GSAS+2P+del246-252+D253N; construct 9808). Figure 2E Shown is an electron micrograph of virus-like particles (VLPs) containing a modified S protein from the SARS-CoV-2 C.37 lineage with the GSAS+2P mutation (construct 9588).

[0062] Figure 3AThe percentage of intact S protein in plants is shown, expressing the following S proteins: parental SARS-CoV-2B lineage S protein with GSAS+2P mutation (Wt; construct 9125), modified S protein with GSAS+2P+del246-252 mutation (GSAS+2P+del246-252; construct 9801), modified S protein with GSAS+2P+D253N mutation (GSAS+2P+D253N; construct 9802), modified S protein with GSAS+2P+del246-252+D253N mutation (GSAS+2P+del246-252+D253N; construct 9808), and S protein from SARS-CoV-2C.37 lineage with GSAS+2P mutation (construct 9588). Figure 3B The percentage of intact S protein in plants is shown, expressing the following S proteins: parental SARS-CoV-2 B lineage S protein with GSAS+2P mutation (construct 9125), modified SARS-CoV-2 B lineage S protein with GSAS+2P+D253N mutation (construct 9802), parental SARS-CoV-2 B.1.617.2 lineage S protein with GSAS+2P mutation (construct 9513), modified SARS-CoV-2 B.1.617.2 lineage S protein with GSAS+2P+D253N mutation (construct 10011), parental SARS-CoV-2 B.1.1.529 lineage S protein with GSAS+2P mutation (construct 10090), and modified SARS-CoV-2 B.1.1.529 lineage S protein with GSAS+2P+D253N mutation (construct 10092).

[0063] Figure 4A The purity of drug substance (DS) obtained from hosts expressing the parental SARS-CoV-2B lineage S protein with GSAS+2P mutations (Construct 9125) or the modified SARS-CoV-2B lineage S protein with GSAS+2P+D253N mutations (Construct 9802) is shown. Figure 4BThe purity of the drug substance (DS) obtained from hosts expressing the following constructs is shown: the parental S protein from the SARS-CoV-2B lineage with the GSAS+2P mutation (Wt; construct 9125), the modified S protein with the GSAS+2P+del246-252 mutation (GSAS+2P+del246-252; construct 9801), the modified S protein with the GSAS+2P+D253N mutation (GSAS+2P+D253N; construct 9802), the modified S protein with the GSAS+2P+del246-252+D253N mutation (GSAS+2P+del246-252+D253N; construct 9808), and the S protein from the SARS-CoV-2C.37 lineage with the GSAS+2P mutation (construct 9588).

[0064] Figure 5 The stability of the purified modified S protein (SARS-CoV-2B lineage with GSAS+2P+D253N mutation: construct 9802) was increased compared to the unmodified (parental) S protein (SARS-CoV-2B lineage with GSAS+2P mutation: construct 9125) after incubation overnight at 24° C. The modified and unmodified S proteins were extracted using enzyme extraction at pH 5.5 (Enz.pH5.5) or pH 6.1 (Enz.pH6.1) or by mechanical extraction (Mech).

[0065] Fig. 6A Western blot analysis of the following S proteins is shown: parental SARS-CoV-2B lineage S protein with GSAS+2P mutations (construct 9125), modified SARS-CoV-2B lineage S protein with GSAS+2P+D253N mutations (construct 9802), modified SARS-CoV-2B lineage S protein with GSAS+2P+G252N mutations (construct 10346), and modified SARS-CoV-2B lineage S protein with GSAS+2P+P251N+D253T mutations (construct 10351). Figure 6BThe percentage of intact S protein in plants is shown, expressing the following S proteins: parental SARS-CoV-2B lineage S protein with GSAS+2P mutation (construct 9125), modified SARS-CoV-2B lineage S protein with GSAS+2P+D253N mutation (construct 9802), modified SARS-CoV-2B lineage S protein with GSAS+2P+G252N mutation (construct 10346), and modified SARS-CoV-2B lineage S protein with GSAS+2P+P251N+D253T mutation (construct 10351). Figure 6C Electron micrographs of virus-like particles (VLPs) are shown, which contain a modified SARS-CoV-2B lineage S protein with GSAS+2P+D253N mutations (construct 9802), a modified SARS-CoV-2B lineage S protein with GSAS+2P+G252N mutations (construct 10346), and a modified SARS-CoV-2B lineage S protein with GSAS+2P+P251N+D253T mutations (construct 10351).

[0066] Figure 7 The percentage of intact S protein in plants is shown, expressing the following S proteins: parental SARS-CoV-2B lineage S protein with GSAS+2P mutation (construct 9125), modified SARS-CoV-2B lineage S protein with GSAS+2P+del246-252; (construct 9801); modified SARS-CoV-2B lineage S protein with GSAS+2P+del247-250; (construct 10502); modified SARS-CoV-2B lineage S protein with GSAS+2P+del248-251; (construct 10503); modified SARS-CoV-2B lineage S protein with GSAS+2P+del249-252; (construct 10504); a modified SARS-CoV-2B lineage S protein with GSAS+2P+del246-250; (Construct 10505); a modified SARS-CoV-2B lineage S protein with GSAS+2P+del247-251; (Construct 10506); a modified SARS-CoV-2B lineage S protein with GSAS+2P+del248-252; (Construct 10507); a modified SARS-CoV-2B lineage S protein with GSAS+2P+del246-251; (Construct 10508); a modified SARS-CoV-2B lineage S protein with GSAS+2P+del247-252; (Construct 10509). DETAILED DESCRIPTION

[0067] Preferred embodiments are described below.

[0068] As used herein, the terms "comprising", "having", "including" and "containing" and their grammatical variations are inclusive or open-ended and do not exclude other uncited elements and / or method steps. When used herein in conjunction with the use or method, the term "consisting essentially of" indicates that there may be additional elements and / or method steps, but these additions will not substantially affect the way in which the method or use functions. When used herein in conjunction with the use or method, the term "consisting of" does not include the presence of additional elements and / or method steps. In certain embodiments, the use or method described herein as including certain elements and / or steps may also consist essentially of those elements and / or steps, and in other embodiments consist of those elements and / or steps, whether or not these embodiments are specifically mentioned. In addition, the use of the singular includes the plural, and unless otherwise stated, "or" means "and / or". As used herein, the term "plurality" means more than one, such as two or more, three or more, four or more, etc. Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art. As used herein, the term "about" refers to a variation of about + / - 10% from a given value. It should be understood that such variation is always included in any given value provided herein, whether or not specifically mentioned. When used in conjunction with the term "comprising", the use of the word "a" or "an" can mean "one", but it is also consistent with the meaning of "one or more", "at least one", "and" one or more than one.

[0069] Described herein are modified coronavirus spike proteins (S proteins), also referred to as "modified coronavirus S proteins" or "modified S proteins," and methods of producing modified S proteins in a host or host cell. The modified S protein can comprise one or more than one modification compared to a parent (unmodified) or wild-type S protein. It has been observed that modifications, such as substitutions or deletions of specific amino acids in a coronavirus S protein, such as an S protein from the B lineage of SARS-CoV-2, result in improved properties of the modified S protein when compared to a parent (unmodified) or wild-type (unmodified) S protein.

[0070] "Modification", "amino acid modification" or "amino acid sequence modification" means a mutation, replacement, substitution or deletion of one or more amino acid residues in a sequence compared to the original parent (unmodified) sequence. The parent sequence may be a wild-type sequence, or the parent sequence may be a sequence that already contains a modification ("parent modification") compared to the wild-type sequence. "Amino acid substitution" or "replacement" means replacing an amino acid in the amino acid sequence of a protein with a different amino acid. The terms amino acid, amino acid residue or residue are used interchangeably in the present disclosure. One or more than one amino acid may be replaced by one or more amino acids different from the original amino acid at that position without changing the overall length of the amino acid sequence of the protein. Replacement or substitution may be experimentally induced by changing the codon sequence in the nucleotide sequence encoding the protein to a codon sequence of an amino acid different from the original amino acid. In addition, one or more than one amino acid may be deleted from the amino acid sequence of the protein. The resulting protein is a modified S protein. The modified S protein does not occur naturally.

[0071] The modified S protein includes a non-naturally occurring S protein having at least one modification compared to the parent S protein and having improved properties compared to the parent S protein from which the amino acid sequence of the modified S protein is derived. The modified S protein has an amino acid sequence that does not exist in nature, which is obtained by replacing one or more amino acid residues of the S protein with one or more different amino acids.

[0072] The parent S protein may also be referred to as an unmodified S protein. If the parent is referred to as "unmodified", it means that the parent sequence does not contain the substitutions and / or deletions described herein. However, compared to the wild-type sequence, the parent S protein may contain other modifications. In some embodiments, the parent or unmodified S protein may be a wild-type HA. In other embodiments, the parent or unmodified S protein may contain other modifications as described below. For example, the parent S protein may contain one or more than one substitutions or replacements to stabilize the coronavirus S protein or the coronavirus S protein trimer in the pre-fusion conformation. In addition, the parent S protein may be a chimeric S protein. For example, the extracellular domain and the transmembrane domain (TM) of the parent S protein or a portion of the TM may be derived from a coronavirus S protein (such as SARS-CoV 2), and the cytoplasmic tail region (CT) or a portion of the CT may be derived from influenza HA.

[0073] "Parent S protein" means an S protein from which a modified S protein can be derived. For example, a parent S protein can be modified to produce a modified S protein having modifications described herein. As further described below, the parent S protein may be from a coronavirus of a first variant or lineage (also referred to as a "recipient" variant or lineage), such as the coronavirus B lineage, and one or more modifications may be derived from or determined from an S protein of a coronavirus from a second variant or lineage (also referred to as a "donor" variant or lineage), such as the coronavirus C lineage.

[0074] Some of the residues identified for modification, mutation or substitution correspond to conserved residues, while others do not. In the case of non-conserved residues, substitution of one or more amino acids is limited to substitutions that produce a modified S protein having an amino acid sequence that does not correspond to an amino acid sequence that exists in nature. In the case of conserved residues, such modification, substitution or replacement should also not result in a naturally occurring S protein sequence.

[0075] Conservative substitution

[0076] As described herein, residues in the S protein can be identified and modified, substituted or mutated to produce modified S proteins. Replacements or mutations at specific positions are not limited to the amino acid replacements described herein or given in the examples. For example, the S protein may contain conservative or conservatively described amino acid replacements.

[0077] As used herein, the term "conservative substitution" or "conservative substitution" and grammatical variants thereof refer to the presence of an amino acid residue in the S protein sequence that is different from the substitution or residue but belongs to the same class of amino acids (i.e., a non-polar residue replaces a non-polar residue, an aromatic residue replaces an aromatic residue, a polar uncharged residue replaces a polar uncharged residue, and a charged residue replaces a charged residue). In addition, conservative substitutions may include residues having the same sign as the residue replacing the wild-type residue and generally having an interface hydrophilicity value of similar magnitude.

[0078] Conservative amino acid substitutions may have an effect on the activity of the resulting modified S protein similar to that of the original substitution or modification. More information about conservative substitutions can be found, for example, in Ben Bassat et al. (J. Bacteriol, 169: 751-757, 1987), O'Regan et al. (Gene, 77: 237-251, 1989), Sahin-Toth et al. (Protein ScL, 3: 240-247, 1994), Hochuli et al. (Bio / Technology, 6: 1321-1325, 1988) and widely used genetics and molecular biology textbooks.

[0079] Blosum matrices are commonly used to determine the relevance of polypeptide sequences. The Blosum matrix is ​​created using a large trusted comparison database (BLOCKS database), in which paired sequence alignments associated with less than a certain threshold percentage identity are counted (Henikoff et al., Proc. Natl. Acad. Sci. USA, 89: 10915-10919, 1992). The highly conservative target frequencies of the BLOSUM90 matrix use a 90% identity threshold. The BLOSUM65 matrix uses a 65% identity threshold. Under the selected percentage identity, scores of zero and above in the Blosum matrix are considered "conservative substitutions".

[0080] Therefore, the present specification relates to a modified coronavirus spike protein (S protein) comprising one or more amino acid sequence modifications compared to the corresponding parent or unmodified amino acid sequence. It has been found that naturally occurring sequence mutations or modifications specific to the S protein of a coronavirus variant or lineage may confer desirable or improved properties to S proteins that do not naturally have these mutations or modifications, such as, for example, S proteins from different lineages or variants. It has been further found that non-naturally occurring sequence mutations or modifications in the N-terminal region of the S protein may also confer desirable or improved properties to the S protein. Therefore, the modified S protein may comprise mutations or modifications of S proteins from different lineages or variants, and / or the modified S protein may comprise non-naturally occurring modifications, i.e., modifications that are not present in different lineages or variants, and the S protein may exhibit better properties compared to the wild-type or unmodified S protein.

[0081] In one aspect, the modified S protein comprises one or more amino acid sequence modifications when compared to the corresponding parent amino acid sequence, wherein the one or more modifications correspond to the amino acid at position 246, 247, 248, 249, 250, 251, 252, 253 or a combination thereof of the reference sequence SEQ ID NO: 1.

[0082] In one aspect, the modifications described herein may include one or more deletions in the N-terminal region of the protein. For example, the modified S protein may include one or more deletions corresponding to amino acids at positions 246, 247, 248, 249, 250, 251, 252, or a combination thereof, of the reference sequence SEQ ID NO: 1.

[0083] In another aspect, the modifications described herein can introduce one or more N-glycosylation sites into the modified S protein. Thus, when compared to the parent (unmodified) S protein, the modified S protein can comprise one or more N-glycosylation sites, wherein the N-glycosylation site is asparagine (N) in the consensus sequence NXT / S (wherein X is any amino acid except proline). The N-glycosylation site can be introduced at a position corresponding to position 251, 252, or 253 of the reference sequence SEQ ID NO: 1.

[0084] Examples of improved properties of the modified S protein include, but are not limited to: increased integrity, increased stability, increased resistance to degradation or proteolysis, increased purity and homogeneity when extracted and / or purified from a host or host cell, or a combination thereof, of the recombinant modified S protein compared to an unmodified S protein when expressed in a host or host cell; improved integrity, stability, or both integrity and stability of the modified S protein when expressed in a host or host cell compared to an unmodified S protein; increased or improved resistance to degradation, proteolysis, cleavage or hydrolysis (also referred to as "chopping") of the modified S protein when expressed in a host or host cell compared to an unmodified S protein; reduced heterogeneity and / or truncation of the modified S protein when expressed in a host or host cell compared to an unmodified S protein; improved processing and / or folding of the modified S protein when expressed in a host or host cell compared to an unmodified S protein.

[0085] The coronavirus S protein (e.g., a parent S protein, a wild-type S protein, or an unmodified S protein) that can be modified as described herein to improve the properties of the S protein, such as having increased stability, integrity, purity, homogeneity, or a combination thereof, includes new coronavirus S proteins that appear over time due to natural modifications of the S protein amino acid sequence (e.g., new S protein variants as described below), or non-natural S proteins that may be produced by altering the S protein (e.g., chimeric S proteins or S proteins that have been altered to achieve desired properties, such as increased expression in a host or stabilization of the S protein in a pre-fusion conformation). Similarly, the modified S protein as described herein can be derived from a wild-type S protein, a novel S protein that appears over time due to natural modifications of the S amino acid sequence, an unmodified S protein, a non-natural S protein (e.g., a chimeric S protein), or an S protein that has been altered to achieve desired properties, such as increased expression of the S protein or increased production of S proteins containing VLPs in a host.

[0086] The modified S protein of the present disclosure may comprise one or more modifications derived from an S protein of a coronavirus from a different variant or lineage than the modified S protein. The modified S protein may be derived from a coronavirus of a first variant or lineage (also referred to as a "recipient" variant or lineage), such as the coronavirus B lineage, and the one or more modifications may be derived from or determined from an S protein of a coronavirus from a second variant or lineage (also referred to as a "donor" variant or lineage), such as the coronavirus C lineage.

[0087] A coronavirus variant (e.g., a SARS-CoV-2 variant) is a mutated sample of a coronavirus (also called a genetic variant of a coronavirus) that contains one or more mutations when compared to other virus variants (e.g., the original or ancestor virus of SARS-CoV-2). Typically, a coronavirus variant has one or more mutations that distinguish it from other variants of the virus. A coronavirus genetic variant is genetically different from other variants, but not different enough to be called a different strain of the virus.

[0088] While there are thousands of variants of coronaviruses, such as SARS-CoV-2, subtypes of the virus can be divided into larger groups such as lineages, subgenera, or evolutionary branches.

[0089] A lineage, subgenus or clade is a group of genetically closely related virus variants derived from a common ancestor. Coronavirus lineages, subgenus or clades may use different nomenclatures, such as the clades identified by the Global Initiative for Sharing Avian Flu Data (GISAID) or "Nextstrain" (Hadfield et al., Nextstrain: real-time tracking of pathogenevolution, Bioinformatics (2018)) or lineages defined by the PANGO nomenclature (see Rambaut et al., 2020, which is incorporated by reference), or lineage naming systems known in the art. In addition, the World Health Organization (WHO) has adopted a nomenclature limited to variants of interest (VOI) and variant strains (VOC), in which variants are named in Greek letters to facilitate discussion and communication with non-scientific audiences. For example, alpha refers to B.1.1.7 (Pango lineage), beta refers to B1.1.351 (Pango lineage), gamma refers to P.1 (Pango lineage), delta refers to B.1.617.2 (Pango lineage), lambda refers to C.37 (Pango lineage) or Omicron refers to B.1.1.529 (Pango lineage) (see https: / / www.who.int / en / activities / tracking-SARS-CoV-2-variants / ).

[0090] The donor or recipient lineage may be a SARS-CoV-2 lineage. The donor or recipient lineage may be defined by PANGO nomenclature (see Rambaut et al., 2020, which is incorporated by reference) or another lineage nomenclature system.

[0091] For example, the donor coronavirus lineage can be selected from the A, B, C, Q, L, D, P, N, S, AE, AF, AZ, AY, BA, W, Y or Z lineages defined by the PANGO nomenclature. For example, the donor coronavirus lineage may be the C lineage. For example, the donor coronavirus lineage may be the C.37 ("λ") lineage.

[0092] For example, the receptor coronavirus pedigree can be selected from A, B, C, Q, L, D, P, N, S, AE, AF, AZ, AY, BA, W, Y or Z pedigrees defined by the PANGO nomenclature. For example, the receptor coronavirus pedigree may be the B pedigree. For example, the receptor coronavirus pedigree may be selected from the B pedigree, B.1.1.7 ("α") pedigree, B.1.351 ("β") pedigree, P.1 ("γ") pedigree, B.1.617.2 ("δ") pedigree, B.1.1.529 ("Omicron") pedigree or another SARS-CoV-2 pedigree. For example, the receptor coronavirus pedigree can be any coronavirus pedigree, as long as the pedigree is different from the donor pedigree. For example, the receptor coronavirus pedigree can be any pedigree, except the C pedigree. In one embodiment, the modification can be derived from the S protein (donor) of the C pedigree, and the modified parent S protein is derived from the B pedigree (receptor).

[0093] In one embodiment, the modified S protein includes modifications introduced from a donor lineage C.37 ("λ") S protein into an acceptor lineage B coronavirus S protein and expressed in a host or host cell (such as a plant or plant cell).

[0094] For example, when compared to the S protein of the ancestral B lineage (PODTC2, SEQ ID NO: 1), the C.37 ("λ") lineage contains the following modifications: G75V, T76I, del246-252, D253N, L452Q, F490S, D614G, and T859N.

[0095] The study found that the introduction of modifications of amino acid residues present in the N-terminal domain of the C.37 lineage S protein into the B lineage S protein (modified S protein) can improve the properties of the B lineage S protein when produced in a host (such as a plant) compared to the unmodified (parent) B lineage S protein. It was further found that the properties of the S protein can also be improved when a subset of modifications further described herein is used. In another aspect, it was further found that the introduction of one or more than one N-glycosylation site in the modified S protein also improved the properties of the S protein.

[0096] Therefore, the modified S protein may comprise one or more modifications, mutations or substitutions located in the N-terminal domain of the S protein.

[0097] In one aspect, the modified S protein may comprise one or more modifications, mutations or substitutions corresponding to positions 246, 247, 248, 249, 250, 251, 252, 253 or a combination thereof.

[0098] Missing

[0099] The modified S protein may comprise one or more deletions corresponding to positions 246, 247, 248, 249, 250, 251 or 252 of the reference sequence SEQ ID NO: 1. For example, the modified S protein may comprise a deletion of at least four consecutive amino acid residues, wherein at least the residues corresponding to positions 249 and 250 of the reference sequence SEQ ID NO: 1 are deleted. For example, the modified S protein may comprise at least a deletion of residues corresponding to positions 247, 248, 249 and 250 of the reference sequence SEQ ID NO: 1. In another example, the modified S protein may comprise at least a deletion of residues corresponding to positions 248, 249, 250 and 251 of the reference sequence SEQ ID NO: 1. In other examples, the modified S protein may comprise at least a deletion of residues corresponding to positions 249, 250, 251 and 252 of the reference sequence SEQ ID NO: 1. In another example, the modified S protein may include at least a deletion of the residues corresponding to positions 246, 247, 248, 249 and 250 of the reference sequence SEQ ID NO: 1. In other examples, the modified S protein may include at least a deletion of the residues corresponding to positions 247, 248, 249, 250 and 251 of the reference sequence SEQ ID NO: 1. In yet another example, the modified S protein may include at least a deletion of the residues corresponding to positions 248, 249, 250, 251 and 252 of the reference sequence SEQ ID NO: 1. In yet another example, the modified S protein may include at least a deletion of the residues corresponding to positions 246, 247, 248, 249, 250 and 251 of the reference sequence SEQ ID NO: 1. In yet another example, the modified S protein may include at least a deletion of the residues corresponding to positions 247, 248, 249, 250, 251 and 252 of the reference sequence SEQ ID NO: 1. In other examples, the modified S protein may include at least a deletion of residues corresponding to positions 246, 247, 248, 249, 250, 251, and 252 of the reference sequence SEQ ID NO: 1. In a non-limiting example, the modified S protein may include the deletions shown in Table 2.

[0100] like Figure 3A As shown, the ratio of full-length coronavirus S protein to cleaved coronavirus S protein ("full S protein (%)") increased from about 80% full-length coronavirus S protein of the parent (B receptor) S protein (Construct 9125) to about 95% full-length coronavirus S protein of the modified S protein, in which the residues corresponding to positions 246-252 of the reference sequence SEQ ID NO:1 have been deleted (Construct 9801).

[0101] like Figure 4B As further shown, clarification and purification of the coronavirus S protein followed by quantification on an SDS gel demonstrated an increase in drug substance (DS) purity (%). When a modified S protein incorporating the del246-252 (Construct 9801) modification from donor lineage C.37 ("λ") S protein was extracted and purified from plants, an increase in DS purity was observed compared to the DS purity obtained from plants expressing the parental (unmodified) S protein (Construct 9125). Notably, the increase in DS purity of the DS obtained from the modified coronavirus S protein incorporating del246-252 (Construct 9801) was also greater than the purity of the DS obtained from the coronavirus S protein of donor lineage C.37 ("λ", Construct 9588) expressed in the same system.

[0102] like Figure 7 As further shown, the ratio of full-length coronavirus S protein to cleaved coronavirus S protein ("complete S protein (%)") was also increased in modified S proteins comprising the following deletions: del 246-252 (Construct 9801), del247-250 (Construct 10502), del248-251 (Construct 10503), del249-252 (Construct 10504), del246-250 (Construct 10505), del247-251 (Construct 10506), del248-252 (Construct 10507), del246-251 (Construct 10508) and del247-252 (Construct 10509) when compared to the parental (unmodified) S protein (Construct 9125). More specifically, the ratio of full-length coronavirus S protein to cleaved coronavirus S protein ("complete S protein (%)") increased to approximately 91% to 96% for the modified S protein comprising the above-mentioned deletion, compared to approximately 87% for the corresponding parent S protein (Construct 9125).

[0103] replace

[0104] In one aspect, the modifications described herein can introduce one or more N-glycosylation sites into the modified S protein. Thus, when compared to the parent (unmodified) S protein, the modified S protein can comprise one or more N-glycosylation sites, wherein the N-glycosylation site is asparagine (N) in the consensus sequence NXT / S (wherein X is any amino acid except proline).

[0105] The modified S protein may comprise one or more substitutions corresponding to position 251, 252, or 253 of the reference sequence SEQ ID NO: 1. One or more substitutions may introduce an N-glycosylation site into the modified S protein. The N-glycosylation site is an asparagine (N) in the consensus sequence NX-(S or T), where X can be any amino acid except proline. For example, the modified S protein may comprise a substitution corresponding to position 252 or position 253 of the reference sequence SEQ ID NO: 1, or the modified S protein may comprise a substitution corresponding to position 251 and 253 of the reference sequence SEQ ID NO: 1. The substitution may introduce an N-glycosylation site at a position corresponding to position 251, 252, or 253 of the reference sequence SEQ ID NO: 1.

[0106] For example, the amino acid residue corresponding to position 253 of the reference sequence SEQ ID NO: 1 can be modified from aspartic acid (D) to asparagine (N) (D253N) to generate an N-glycosylation site at position 253. In addition, the amino acid residue corresponding to position 252 of the reference sequence SEQ ID NO: 1 can be modified from glycine (G) to asparagine (N) (G252N) to generate an N-glycosylation site at position 252. In addition, the residue corresponding to position 251 of the reference sequence SEQ ID NO: 1 can be modified from proline (P) to asparagine (N) (P251N) and the residue corresponding to position 253 of the reference sequence SEQ ID NO: 1 can be modified from aspartic acid (D) to threonine (T) (D253T) to generate an N-glycosylation site at position 251.

[0107] like Figure 3B As shown, when the S protein was derived from the B lineage (construct 9802), the B.1.617.2 lineage (construct 10011), or the B.1.1.529 lineage (construct 10092) and contained the substitution corresponding to position 253 ("modified S protein"), a greater proportion of the modified S protein was observed to be full-length S protein (expressed as "complete S protein (%)") compared to the corresponding unmodified S protein (constructs 9125, 9513, and 10090, respectively).

[0108] More specifically, the ratio of full-length coronavirus S protein to cleaved coronavirus S protein ("complete S protein (%)") increased to approximately 93% to 96% for the modified S protein comprising the D253N substitution, which was derived from the B lineage (Construct 9802), the B.1.617.2 lineage (Construct 10011) or the B.1.1.529 lineage (Construct 10092), compared to approximately 81% to 82% for the corresponding unmodified S proteins (Constructs 9125, 9513 and 10090, respectively).

[0109] In addition, if Figure 4A and 4B As shown, clarification and purification of coronavirus S protein followed by quantification on SDS gels demonstrated an increase in drug substance (DS) purity (%). When a modified S protein incorporating the D253N modification (Construct 9802) from the donor lineage C.37 ("λ") S protein was extracted and purified from plants, an increase in DS purity was observed compared to the DS purity obtained from plants expressing the unmodified S protein (Construct 9125). Notably, the increase in DS purity of the DS obtained from the modified coronavirus S protein D253N (Construct 9802) was also greater than the purity of the DS obtained from the coronavirus S protein of the donor lineage C.37 ("λ", Construct 9588) expressed in the same system ( Figure 4B ).

[0110] like Fig. 6A and 6B As further shown, when a glycosylation site is introduced into the modified S protein at a residue corresponding to position 253, 252 or 251 of the reference sequence SEQ ID NO: 1, the ratio of the full-length S protein to the cut or truncated ("clipped") S protein having a glycosylation site at position 253, 252 or 251 is increased compared to the parent S protein (in Figure 6B The expression of S protein in the samples was significantly increased (expressed as “complete S protein (%)” in the table).

[0111] More specifically, if Figure 6B As shown, when the S protein contained substitutions corresponding to position 253 (construct 9802), position 252 (construct 10346), or positions 251 and 253 (construct 10351), a greater proportion of the modified S protein was extracted and purified from the plant as a full-length S protein (expressed as "complete S protein (%)") compared to the corresponding unmodified S protein (construct 9125).

[0112] like Figure 6CAs further shown, when expressed in N. benthamiana, modified S proteins with additional glycosylation sites corresponding to positions 253, 252, or 251 (constructs: 9802, 10346, and 10351) were observed to be similar to the unmodified SARS-CoV-2 S protein ( Figure 2A , construct 9125) to form VLPs.

[0113] Compared to the unmodified S protein (Construct 9125), the modified S protein with the D253N modification (Construct 9802) extracted by enzymatic extraction at pH 5.5 (Enz.pH5.5) or pH 6.1 (Enz.pH6.1) or mechanical extraction (Mech) showed higher stability after overnight incubation at 24°C (see Figure 5 ).

[0114] Deletion and replacement

[0115] In other aspects, the modified S protein may comprise one or more deletions corresponding to positions 246, 247, 248, 249, 250, 251 or 252, and one or more substitutions corresponding to positions 251, 252 or 253 of the reference sequence SEQ ID NO:1.

[0116] For example, the modified S protein may comprise one or more deletions and one or more substitutions, wherein the one or more deletions comprise at least four consecutive amino acid residues, and wherein at least the residues corresponding to positions 249 and 250 of the reference sequence SEQ ID NO: 1 are deleted, and wherein the one or more substitutions correspond to positions 251, 252, or 253 of the reference sequence SEQ ID NO: 1.

[0117] For example, the modified S protein may include at least a deletion of residues corresponding to positions 247, 248, 249, and 250 of the reference sequence SEQ ID NO: 1 and one or more substitutions corresponding to positions 251, 252, or 253 of the reference sequence SEQ ID NO: 1. In another example, the modified S protein may include at least a deletion of residues corresponding to positions 248, 249, 250, and 251 of the reference sequence SEQ ID NO: 1 and one or more substitutions corresponding to positions 252 or 253 of the reference sequence SEQ ID NO: 1. In other examples, the modified S protein may include at least a deletion of residues corresponding to positions 249, 250, 251, and 252 of the reference sequence SEQ ID NO: 1 and a substitution corresponding to position 253 of the reference sequence SEQ ID NO: 1. In another example, the modified S protein may include at least a deletion of residues corresponding to positions 246, 247, 248, 249, and 250 of the reference sequence SEQ ID NO: 1 and one or more substitutions corresponding to positions 251, 252, or 253 of the reference sequence SEQ ID NO: 1. In other examples, the modified S protein may include at least a deletion of residues corresponding to positions 247, 248, 249, 250, and 251 of the reference sequence SEQ ID NO: 1 and one or more substitutions corresponding to positions 252 or 253 of the reference sequence SEQ ID NO: 1. In yet another example, the modified S protein may include at least a deletion of residues corresponding to positions 248, 249, 250, 251, and 252 of the reference sequence SEQ ID NO: 1 and a substitution corresponding to position 253 of the reference sequence SEQ ID NO: 1. In yet another example, the modified S protein may include at least deletions of residues corresponding to positions 246, 247, 248, 249, 250, and 251 of the reference sequence SEQ ID NO: 1 and one or more substitutions corresponding to positions 252 or 253 of the reference sequence SEQ ID NO: 1. In yet another example, the modified S protein may include at least deletions of residues corresponding to positions 247, 248, 249, 250, 251, and 252 of the reference sequence SEQ ID NO: 1 and a substitution corresponding to position 253 of the reference sequence SEQ ID NO: 1. In other examples, the modified S protein may include at least deletions of residues corresponding to positions 246, 247, 248, 249, 250, 251, and 252 of the reference sequence SEQ ID NO: 1 and a substitution corresponding to position 253 of the reference sequence SEQ ID NO: 1.

[0118] like Figure 3AAs shown, for the modified S protein incorporating the deletion del246-252 and the substitution D253N ('del-246-252+D253N'; construct 9808), the ratio of full-length coronavirus S protein to cleaved coronavirus S protein ("complete S protein (%)") increased significantly. More specifically, the ratio of full-length coronavirus S protein to cleaved coronavirus S protein ("complete S protein (%)") increased from about 82% full-length coronavirus S protein of the B receptor strain S protein (construct 9125) to about 96% full-length coronavirus S protein, wherein the modified S protein combined the deletion and substitution ('del-246-252+D253N'; construct 9808).

[0119] like Figure 4A and Figure 4B As further shown, clarification and purification of the coronavirus S protein followed by quantification on an SDS gel indicated an improvement in drug substance (DS) purity (%). When a modified S protein incorporating the del246-252+D253N (Construct 9808) modification from the donor lineage C.37 ("λ") S protein was extracted and purified from plants, an increase in DS purity was observed compared to the DS purity obtained from plants expressing the unmodified S protein (Construct 9125). Notably, the increase in DS purity of the DS obtained from the modified coronavirus S protein incorporating del246-252+D253N (Construct 9808) was also greater than the DS purity obtained from the coronavirus S protein of the donor lineage C.37 ("λ", Construct 9588) expressed in the same system ( Figure 4B ).

[0120] Reference to “corresponding to an amino acid”, “corresponding to an amino acid”, or “corresponding to a position”, or “corresponding to a position”, etc., means that the amino acid corresponds to the amino acid aligned with the reference sequence of the coronavirus S protein as described below.

[0121] Modifications of the S protein donor pedigree nucleic acid sequence can be introduced into the corresponding nucleic acid positions of the S protein acceptor pedigree nucleic acid sequence. Similarly, amino acid substitutions or deletions in the S protein donor pedigree amino acid sequence can be introduced into the corresponding amino acid positions of the S protein acceptor pedigree sequence. As further described herein, additional modifications not found in the S protein of the donor pedigree can also be introduced into the modified S protein.

[0122] Throughout this disclosure, the number of amino acid residues or residue positions of the coronavirus S protein is consistent with the numbering of the S protein reference sequence. For example, the S protein reference sequence is the sequence of the "ancestor" B lineage SARS-CoV-2 S protein (UniProtKB-P0DTC2, SEQ ID NO: 1). By aligning the sequence of the S protein with the S protein reference sequence, the corresponding amino acid position can be determined. For example, the comparison of amino acid sequences shows that positions 246-253 of SARS-CoV-2B (SEQ ID NO: 1) correspond to positions 256-263 in the SARS-CoV-2B.1.617.2 sequence (SEQ ID NO.14) and positions 255-262 in the SARS-CoV-2B.1.1.529 sequence (SEQ ID NO: 18). The corresponding positions in other sequences can be determined by similar comparisons. Sequence alignment methods for comparison are well known in the art and will be further described below.

[0123] The modified coronavirus S protein may comprise one or more amino acid sequence modifications when compared to the corresponding unmodified (parent) amino acid sequence, wherein the one or more modifications correspond to an amino acid at position 246, 247, 248, 249, 250, 251, 252, 253, or a combination thereof of the reference sequence SEQ ID NO: 1.

[0124] One or more amino acid sequence modifications may include replacement of one or more amino acids or deletion of one or more amino acids. For example, the amino acid sequence modification includes replacement of a non-glycine corresponding to position 252, such as replacement of asparagine (N) corresponding to position 252. In one embodiment, the modification is a G252N replacement, and thus the modified S protein comprises a G252N replacement or modification.

[0125] In another example, the modification comprises a substitution of a non-aspartic acid corresponding to position 253, such as a substitution of asparagine (N) corresponding to position 253. In one embodiment, the modification is a D253N substitution, and thus the modified S protein comprises a D253N substitution or modification.

[0126] The modification may also include two substitutions. For example, the modified S protein may include a non-proline substitution at the amino acid corresponding to position 251, such as a substitution of asparagine (N) corresponding to position 251 and a substitution of threonine (T) corresponding to position 253. In one embodiment, the modified S protein includes a P251N+D253T substitution or modification.

[0127] In addition, the modified S protein may include a deletion of one or more than one amino acid corresponding to positions 246, 247, 248, 249, 250, 251, 252 or a combination thereof. In one embodiment, the amino acids corresponding to positions 246-252 are deleted, so the modified S protein includes 246-252 deletion or modification (del246-252). In another embodiment, the amino acids corresponding to positions 247-250 are deleted, so the modified S protein includes 247-250 deletion or modification (del247-250). In other embodiments, the amino acids corresponding to positions 248-251 are deleted, so the modified S protein includes 248-251 deletion or modification (del248-251). In other embodiments, the amino acids corresponding to positions 249-252 are deleted, so the modified S protein includes 249-252 deletion or modification (del249-252). In another embodiment, the amino acids corresponding to positions 246-250 are deleted, so the modified S protein comprises 246-250 deletion or modification (del246-250). In yet another embodiment, the amino acids corresponding to positions 247-251 are deleted, so the modified S protein comprises 247-251 deletion or modification (del247-251). In another embodiment, the amino acids corresponding to positions 248-252 are deleted, so the modified S protein comprises 248-252 deletion or modification (del248-252). In another embodiment, the amino acids corresponding to positions 246-251 are deleted, so the modified S protein comprises 246-251 deletion or modification (del246-251). In another embodiment, the amino acids corresponding to positions 247-252 are deleted, so the modified S protein comprises 247-252 deletion or modification (del247-252). Non-limiting examples of modified S proteins comprising one or more deletions are provided in Table 2.

[0128] In one embodiment, the modified S protein may comprise at least one substitution and one or more than one amino acid deletion.

[0129] For example, the modified S protein may comprise a non-glycine substitution for the amino acid corresponding to position 252 and a deletion of one or more amino acids corresponding to positions 246, 247, 248, 249, 250, 251, or a combination thereof.

[0130] In one embodiment, the modified S protein comprises a replacement of asparagine (N) corresponding to position 252 and a deletion of amino acids 246-251, so the modified S protein comprises a G252N replacement and a 246-251 deletion ('G252N+del246-251' or 'del246-252+G252N'). In another embodiment, the modified S protein comprises a replacement of asparagine (N) corresponding to position 252 and a deletion of amino acids 247-250, so the modified S protein comprises a G252N replacement and a 247-250 deletion ('G252N+del247-250' or 'del247-250+G252N'). In another embodiment, the modified S protein comprises a replacement of asparagine (N) corresponding to position 252 and a deletion of amino acids 248-251, so that the modified S protein comprises a G252N replacement and a 248-251 deletion ('G252N+del248-251' or 'del248-251+G252N'). In another embodiment, the modified S protein comprises a replacement of asparagine (N) corresponding to position 252 and a deletion of amino acids 249-251, so that the modified S protein comprises a G252N replacement and a 249-251 deletion ('G252N+del249-251' or 'G252N+del249-251'). In other embodiments, the modified S protein comprises a replacement of asparagine (N) corresponding to position 252 and a deletion of amino acids 246-250, so that the modified S protein comprises a G252N replacement and a 246-250 deletion ('G252N+del246-250' or 'G252N+del246-250'). In yet another embodiment, the modified S protein comprises a replacement of asparagine (N) corresponding to position 252 and a deletion of amino acids 247-251, so that the modified S protein comprises a G252N replacement and a 247-251 deletion ('G252N+del247-251' or 'G252N+del247-251'). In another embodiment, the modified S protein comprises a substitution of asparagine (N) corresponding to position 252 and a deletion of amino acids 246-251, thus the modified S protein comprises a G252N substitution and a 246-251 deletion ('G252N+del246-251' or 'G252N+del246-251').

[0131] For example, the modified S protein can comprise a substitution of a non-aspartic acid corresponding to position 253 and a deletion of one or more amino acids corresponding to positions 246, 246, 247, 248, 249, 250, 251, 252, or a combination thereof.

[0132] In one embodiment, the modified S protein comprises a replacement of asparagine (N) corresponding to position 253 and a deletion of amino acids 246-252, so that the modified S protein comprises a D253N replacement and a 246-252 deletion ('D253N+del246-252' or 'del246-252+D253N'). In another embodiment, the modified S protein comprises a replacement of asparagine (N) corresponding to position 253 and a deletion of amino acids 247-250, so that the modified S protein comprises a D253N replacement and a 247-250 deletion ('D253N+del247-250' or 'del247-250+D253N'). In another embodiment, the modified S protein comprises a replacement of asparagine (N) corresponding to position 253 and a deletion of amino acids 248-251, so that the modified S protein comprises a D253N replacement and a 248-251 deletion ('D253N+del248-251' or 'del248-251+D253N'). In another embodiment, the modified S protein comprises a replacement of asparagine (N) corresponding to position 253 and a deletion of amino acids 249-251, so that the modified S protein comprises a D253N replacement and a 249-251 deletion ('D253N+del249-252' or 'del249-252+D253N'). In another embodiment, the modified S protein comprises a replacement of asparagine (N) corresponding to position 253 and a deletion of amino acids 246-250, so that the modified S protein comprises a D253N replacement and a 246-250 deletion ('D253N+del246-250' or 'del246-250+D253N'). In another embodiment, the modified S protein comprises a replacement of asparagine (N) corresponding to position 253 and a deletion of amino acids 247-251, so that the modified S protein comprises a D253N replacement and a 247-251 deletion ('D253N+del247-251' or 'del247-251+D253N'). In another embodiment, the modified S protein comprises a replacement of asparagine (N) corresponding to position 253 and a deletion of amino acids 248-252, so that the modified S protein comprises a D253N replacement and a 248-252 deletion ('D253N+del248-252' or 'del248-252+D253N'). In another embodiment, the modified S protein comprises a replacement of asparagine (N) corresponding to position 253 and a deletion of amino acids 246-251, so that the modified S protein comprises a D253N replacement and a 246-251 deletion ('D253N+del246-251' or 'del246-251+D253N').In another embodiment, the modified S protein comprises a substitution of asparagine (N) corresponding to position 253 and a deletion of amino acids 247-252, thus the modified S protein comprises a D253N substitution and a 247-252 deletion ('D253N+del247-252' or 'del247-252+D253N').

[0133] For example, the modified S protein may comprise a non-proline substitution for the amino acid corresponding to position 251, a non-aspartic acid substitution for the amino acid corresponding to position 253, and a deletion of one or more amino acids corresponding to positions 246, 247, 248, 249, 250, or a combination thereof.

[0134] In one embodiment, the modified S protein comprises a substitution of asparagine (N) corresponding to position 251, a substitution of threonine (T) corresponding to position 253, and a deletion of amino acids 246-250, so that the modified S protein comprises a P251N substitution, a D253T substitution, and a 246-250 deletion ('P251N+D253T+del246-250' or 'del246-250+P251N+D253T').

[0135] In another embodiment, the modified S protein comprises a substitution of asparagine (N) at position 251, a substitution of threonine (T) corresponding to position 253, and a deletion of amino acids 247-250, so that the modified S protein comprises a P251N substitution, a D253T substitution, and a 247-250 deletion ('P251N+D253T+del247-250' or 'del247-250+P251N+D253T').

[0136] In another embodiment, the modified S protein comprises a substitution of asparagine (N) corresponding to position 251, a substitution of threonine (T) corresponding to position 253, and a deletion of amino acids 248-250, so that the modified S protein comprises a P251N substitution, a D253T substitution, and a 248-251 deletion ('P251N+D253T+del248-250' or 'del248-250+P251N+D253T').

[0137] For example, the modified S protein can have an amino acid sequence having about 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any amount therebetween, sequence identity or sequence similarity to the amino acid sequence of SEQ ID NO: 8, 10, 12, 16, 20, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, or 57, wherein the amino acid sequence corresponding to positions 246-252, 247-250, 248-251, 249-252, 246-250, 247-251, 249-252, 246-250, 247-252 The amino acids 251, 248-252, 246-251 or 247-252 are deleted, and / or the amino acid corresponding to position 253 is asparagine (N, Asn), or wherein the amino acids corresponding to positions 247-250, 248-251, 246-250, 247-251 or 246-251 are deleted and / or the amino acid corresponding to position 252 is asparagine (N, Asn), or wherein the amino acids corresponding to positions 247-250 or 246-250 are deleted and / or the amino acid corresponding to position 251 is asparagine (N, Asn) and position 253 is threonine (T, Thr), wherein the numbering of the positions corresponds to the positions in the reference sequence SEQ ID NO: 1 and wherein the modified S protein sequence is not naturally occurring, and wherein VLPs are formed when the S protein is expressed.

[0138] The modified S protein can have an amino acid sequence having about 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any amount therebetween sequence identity or sequence similarity to the amino acid sequence of SEQ ID NO: 8 or 25, and wherein the modified S protein sequence is not naturally occurring, and wherein VLPs are formed when the S protein is expressed.

[0139] The modified S protein can have an amino acid sequence having about 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any amount therebetween, sequence identity or sequence similarity to the amino acid sequence of SEQ ID NO: 10, 16, 20 or 26, wherein the amino acid corresponding to position 253 is asparagine (N, Asn), wherein the modified S protein sequence is not naturally occurring, and wherein VLPs are formed when the S protein is expressed.

[0140] The modified S protein can have an amino acid sequence having about 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any amount therebetween sequence identity or sequence similarity to the amino acid sequence of SEQ ID NO: 12 or 27, wherein the amino acids corresponding to positions 246-252 are deleted and the amino acid corresponding to position 253 is asparagine (N, Asn), wherein the modified S protein sequence is not naturally occurring, and wherein VLPs are formed when the S protein is expressed.

[0141] The modified S protein can have an amino acid sequence having about 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any amount therebetween, sequence identity or sequence similarity to the amino acid sequence of SEQ ID NO: 39 or 28, wherein the amino acid corresponding to position 252 is asparagine (N, Asn), wherein the modified S protein sequence is not naturally occurring, and wherein VLPs are formed when the S protein is expressed.

[0142] The modified S protein can have an amino acid sequence having about 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any amount therebetween sequence identity or sequence similarity to the amino acid sequence of SEQ ID NO: 41 or 29, wherein the amino acid corresponding to position 251 is asparagine (N, Asn) and the amino acid corresponding to position 253 is threonine (T, Thr), wherein the modified S protein sequence is not naturally occurring, and wherein VLPs are formed when the S protein is expressed.

[0143] The modified S protein can have an amino acid sequence having about 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any amount therebetween sequence identity or sequence similarity to the amino acid sequence of SEQ ID NO: 43 or 30, wherein the amino acids corresponding to positions 247-250 are deleted and wherein the modified S protein sequence is not naturally occurring, and wherein VLPs are formed when the S protein is expressed.

[0144] The modified S protein can have an amino acid sequence having about 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any amount therebetween, sequence identity or sequence similarity to the amino acid sequence of SEQ ID NO: 45 or 31, wherein the amino acids corresponding to positions 248-251 are deleted, wherein the modified S protein sequence is not naturally occurring, and wherein VLPs are formed when the S protein is expressed.

[0145] The modified S protein can have an amino acid sequence having about 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any amount therebetween, sequence identity or sequence similarity to the amino acid sequence of SEQ ID NO: 47 or 32, wherein the amino acids corresponding to positions 249-252 are deleted, wherein the modified S protein sequence is not naturally occurring, and wherein VLPs are formed when the S protein is expressed.

[0146] The modified S protein can have an amino acid sequence having about 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any amount therebetween, sequence identity or sequence similarity to the amino acid sequence of SEQ ID NO: 49 or 33, wherein the amino acids corresponding to positions 246-250 are deleted, wherein the modified S protein sequence is not naturally occurring, and wherein VLPs are formed when the S protein is expressed.

[0147] The modified S protein can have an amino acid sequence having about 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any amount therebetween, sequence identity or sequence similarity to the amino acid sequence of SEQ ID NO: 51 or 34, wherein the amino acids corresponding to positions 247-251 are deleted, wherein the modified S protein sequence is not naturally occurring, and wherein VLPs are formed when the S protein is expressed.

[0148] The modified S protein can have an amino acid sequence having about 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any amount therebetween, sequence identity or sequence similarity to the amino acid sequence of SEQ ID NO: 53 or 35, wherein the amino acids corresponding to positions 248-252 are deleted, wherein the modified S protein sequence is not naturally occurring, and wherein VLPs are formed when the S protein is expressed.

[0149] The modified S protein can have an amino acid sequence having about 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any amount therebetween, sequence identity or sequence similarity to the amino acid sequence of SEQ ID NO: 55 or 36, wherein the amino acids corresponding to positions 246-251 are deleted, wherein the modified S protein sequence is not naturally occurring, and wherein VLPs are formed when the S protein is expressed.

[0150] The modified S protein can have an amino acid sequence having about 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any amount therebetween, sequence identity or sequence similarity to the amino acid sequence of SEQ ID NO: 57 or 37, wherein the amino acids corresponding to positions 247-252 are deleted, wherein the modified S protein sequence is not naturally occurring, and wherein VLPs are formed when the S protein is expressed.

[0151] The present specification also provides a nucleic acid comprising a nucleotide sequence encoding an S protein, the S protein having substitutions corresponding to positions 251, 252, 253, deletions corresponding to positions 246-252, 247-250, 248-251, 249-252, 246-250, 247-251, 248-252, 246-251, 247-252, or substitutions corresponding to positions 251, 252, 253 and deletions corresponding to positions 246-252, 247-250, 248-251, 249-252, 246-250, 247-251, 248-252, 246-251, 247-252.

[0152] The isolation of nucleic acid encoding such an S protein is well within the skill of the art, as is the modification of the nucleic acid to introduce changes in the amino acid sequence, for example by site-directed mutagenesis.

[0153] For example, the nucleotide sequence can have about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any amount therebetween, sequence identity to the nucleotide sequence of SEQ ID NO:9, 11, 15, 19, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, wherein the encoding sequence corresponds to positions 246-252, 247-250, 248-251, 249-252, 246-250, 247-251, 248-252, 246-251, or 247-252. The nucleotide codons for amino acids 7-252 are deleted, and / or the amino acid corresponding to position 253 is asparagine (N, Asn), or wherein the amino acids corresponding to positions 247-250, 248-251, 246-250, 247-251 or 246-251 are deleted and / or the amino acid corresponding to position 252 is asparagine (N, Asn), or wherein the amino acids corresponding to positions 247-250 or 246-250 are deleted and / or the amino acid corresponding to position 251 is asparagine (N, Asn) and position 253 is threonine (T, Thr), wherein the numbers of the positions correspond to the positions in the reference sequence SEQ ID NO: 1, and wherein the modified S protein sequence is not naturally occurring, and wherein VLPs are formed when the S protein is expressed.

[0154] The modified coronavirus S protein described herein can be derived from a receptor S protein having an amino acid sequence having about 70%, 75%, 80%, 85%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% or any amount of sequence identity or sequence similarity with the amino acid sequence of SEQ ID NO: 1, 2, 4, 6, 14 or 18.

[0155] As described herein, examples of modified S proteins with enhanced or improved properties include, but are not limited to, the following:

[0156] B CoV S (GSAS-2P+del246-252): construct: 9801, SEQ ID NO: 8;

[0157] B CoV S (GSAS-2P+D253N): construct: 9802, SEQ ID NO: 10;

[0158] B CoV S (GSAS-2P+del246-252+D253N) construct: 9808, SEQ ID NO: 12;

[0159] B.1.617.2 CoV S (GSAS-2P+D253N): Construct: 10011, SEQ ID NO: 16

[0160] B.1.1.529 CoV S (GSAS-2P+D253N): Construct: 10092, SEQ ID NO: 20

[0161] B CoV S (GSAS-2P+D252N) construct: 10346, SEQ ID NO: 39;

[0162] B CoV S (GSAS-2P+P251N+D253T) construct: 10351, SEQ ID NO: 41;

[0163] B CoV S (GSAS-2P+del247-250) construct: 10502, SEQ ID NO: 43;

[0164] B CoV S (GSAS-2P+del248-251) construct: 10503, SEQ ID NO: 45;

[0165] B CoV S (GSAS-2P+del249-252) construct: 10504, SEQ ID NO: 47;

[0166] B CoV S (GSAS-2P+del246-250) construct: 10505, SEQ ID NO: 49;

[0167] B CoV S (GSAS-2P+del247-251) construct: 10506, SEQ ID NO: 51;

[0168] B CoV S (GSAS-2P+del248-252) construct: 10507, SEQ ID NO: 53;

[0169] B CoV S (GSAS-2P+del246-251) construct: 10508, SEQ ID NO: 55;

[0170] B CoV S (GSAS-2P+del247-252) construct: 10509, SEQ ID NO:57.

[0171] In one embodiment, the modified coronavirus S protein can be derived from the receptor B lineage SARS-CoV-2 S protein (SEQ ID NOs: 3 and 4, construct 9125, Figure 1B ) was generated by introducing the del246-252 mutation of the donor C.37 ("λ") lineage (SEQ ID NOs: 7 and 8, construct 9801, Figure 1C In another embodiment, the modified coronavirus S protein is produced from the recipient B lineage SARS-CoV-2 S protein (SEQ ID NOs: 3 and 4) into which the D253N mutation from the donor C.37 ("λ") lineage (SEQ ID NOs: 9 and 10, construct 9802, Figure 1D In another embodiment, the modified coronavirus S protein is produced from the recipient B lineage SARS-CoV-2 S protein (SEQ ID NOs: 3 and 4) into which the del246-252 and D253N mutations from the donor C.37 ("λ") lineage are introduced (SEQ ID NOs: 11 and 12, construct 9808, Figure 1E ). However, as also described herein, modifications not present in the S protein from the donor lineage may also be introduced into the modified S protein to improve the properties of the modified S protein compared to the unmodified (parent) S protein.

[0172] A modified S protein can be produced by introducing changes to the amino acid sequence of the S protein, which results in improved properties of the modified S protein compared to the unmodified S protein, such as increased stability against proteolysis or increased stability against protease degradation, and increased integrity, purity and / or homogeneity of the recombinant modified S protein when expressed in a host or host cell.

[0173] Therefore, a method for improving the properties of a coronavirus S protein is also provided, such as, for example, increasing the stability against proteolysis or increasing the stability against protease degradation, increasing the integrity, purity and / or homogeneity of the S protein. The method comprises a) modifying a parent coronavirus S protein to produce a modified coronavirus S protein, wherein the modified coronavirus S protein comprises one or more than one amino acid sequence modification as described above when compared to the parent coronavirus S protein, the one or more than one modification corresponding to the amino acid at position 246, 247, 248, 249, 250, 251, 252, 253 of the reference sequence SEQ ID NO: 1 or a combination thereof; and b) expressing the modified coronavirus S protein in a host or host cell, thereby producing a modified S protein having improved properties compared to the same properties of the parent coronavirus S protein produced under similar conditions in the host or host cell.

[0174] Also provided is a method for producing a modified coronavirus S protein as described herein in a host or host cell, wherein the modified S protein has improved properties compared to the properties of the unmodified S protein, such as, for example, improved stability against proteolysis or improved stability against protease degradation, improved integrity, purity and / or homogeneity. The method comprises a) introducing a nucleic acid encoding the modified S protein described herein into a host or host cell, or providing a host or host cell comprising a nucleic acid encoding the modified S protein described herein, and b) incubating the host or host cell under conditions that allow expression of the nucleic acid, thereby producing a modified S protein having improved properties compared to the same properties of the unmodified S protein produced under similar conditions in the host or host cell. The modified S protein may optionally be further extracted, purified, or extracted and purified from the host or host cell.

[0175] In addition, the modified S protein can be assembled into virus-like particles (VLPs), wherein the content or amount of the full-length S protein in the VLP is increased compared to the full-length S protein content of the VLP produced by the unmodified S protein. It has been observed that by introducing the modifications described herein into the coronavirus S protein, the resulting modified S protein has a stronger resistance to proteolysis or shearing of the N-terminus, and a higher amount of full-length S protein can be produced. Therefore, in another aspect, the present disclosure provides a VLP comprising a modified S protein as described herein, wherein the VLP comprises an increased content or amount of the full-length modified S protein compared to a VLP comprising an unmodified S protein.

[0176] The increase in full-length (uncleaved) S protein produced in the host (such as a plant) can be measured and expressed as an increase in the purity of the resulting product. Protein purity is usually assessed by using SDS-PAGE gels, and the band intensities of the SDS PAGE gels can be calculated by densitometry analysis. In short, the number of recombinant protein species (i.e., protein bands) with different molecular weights produced in the host is determined by densitometry. The protein loading is related to the peak area of ​​the protein species in the densitometry curve, and the peak maximum intensity is used for the quantification of the protein species. Purity is calculated as the sum of the relative densities of the protein bands of interest, expressed as a percentage (%), i.e., the more protein (s) of interest produced, the higher the calculated purity.

[0177] Therefore, the present disclosure further provides a bulk drug (DS) comprising the modified S protein as described above as the desired product, the bulk drug being substantially free of product-related impurities, wherein the impurities are not immunologically active. The preferred bulk drug is also substantially free of process-related impurities.

[0178] By immunological activity, it is meant a compound, such as a coronavirus S protein or an S protein fragment, which is recognized by an antibody specific for the RBD domain of the coronavirus S protein (anti-RBD antibody, such as 40592-T62 from Sino biological) and / or an antibody specific for the S2 domain of the coronavirus S protein (anti-S2 antibody, such as NB100-56578 from Novus Biological).

[0179] In the context of this application, the term "drug substance" refers to a product or active ingredient suitable for use as i) an active ingredient of a drug or drug, ii) an active pharmaceutical ingredient of a drug or drug, iii) a bulk purified active ingredient of a drug or drug, or iv) a bulk purified active ingredient of a drug or drug. The drug or drug may be a vaccine.

[0180] Thus, there is further provided a drug substance (DS) comprising a VLP comprising a modified S protein as described herein. The DS comprising the modified S protein has a higher purity than the DS obtained from a host expressing an unmodified S protein. Thus, there is also provided a method for increasing the purity of the DS obtained from a host or host cell expressing a modified S protein compared to the purity of the DS obtained from a host expressing an unmodified (parent) S protein.

[0181] The modified coronavirus S protein can self-assemble into virus-like particles (VLPs). Therefore, a DS comprising VLPs is also provided, and the VLPs comprise the modified S protein. Compared with the DS produced by the parent (unmodified) coronavirus S protein, the DS containing the VLPs with the modified S protein shows an improved purity.

[0182] In other aspects, a medicine (also referred to as a pharmaceutical preparation or pharmaceutical composition) is also provided. The medicine can be formulated into a finished dosage form, such as a solution, a capsule or a tablet. The medicine includes a bulk drug. The medicine may also include other ingredients, such as, for example, a pharmaceutically acceptable carrier and / or excipient, such as a buffer system, an adjuvant, a preservative, a tonicity agent (multiple), a chelating agent (multiple), an antiadhesive agent, a solvent, etc. Pharmaceutically acceptable carriers and excipients are well known in the art. Therefore, a medicine, a pharmaceutical preparation or a pharmaceutical composition is also provided, which comprises a pharmaceutically acceptable carrier and / or excipient and a VLP, the VLP comprising a modified S protein or the VLP comprising a viral protein, wherein the viral protein consists of a modified coronavirus S protein.

[0183] Other Modifications

[0184] The modified S protein may be a chimeric modified S protein or a chimeric S protein. With respect to a "chimeric S protein", it is meant a protein or polypeptide comprising an amino acid sequence and / or a protein domain or a portion of a protein domain from two or more sources, which are fused into a single polypeptide. For example, but not limited to, the extracellular domain and the transmembrane domain (TM) of the chimeric S protein or a portion of the TM may be derived from a coronavirus S protein (such as SARS-CoV 2), and the cytoplasmic tail (CT) or a portion of the CT may be derived from influenza HA (as described in International PCT Application PCT / CA2021 / 051201, which is incorporated herein by reference).

[0185] The modified S protein may also include one or more than one replacement or substitution to stabilize the coronavirus S protein or coronavirus S protein trimer in the pre-fusion conformation. For example, the modified S protein may also include changes in the consensus RRAR furin cleavage site, and two consecutive proline replacements at or near the boundary between the HR1 domain and the central helical domain, which stabilize the S extracellular domain trimer in the pre-fusion conformation, as described in, for example, WO 2018 / 081318 and PCT / CA2021 / 051201, which are incorporated herein by reference.

[0186] VLP

[0187] The modified coronavirus S protein as described herein can be further incorporated into virus-like particles (VLPs). The term "virus-like particle (VLP)" or "virus-like particle" or "VLP" refers to a virus-like structure that is generally similar in morphology and antigenicity to the virions produced in the infection, but lacks genetic information sufficient to replicate and is therefore not infectious. VLPs are self-assembled structures comprising one or more structural proteins, such as, for example, modified coronavirus S proteins. Therefore, VLPs can comprise modified coronavirus S proteins. VLPs can also comprise coronavirus proteins, wherein the coronavirus proteins consist of modified coronavirus S proteins.

[0188] like Figure 2B-2D As shown, when expressed in Nicotiana benthamiana, modified B lineage S proteins (constructs: 9801, 9802, and 9808) were observed to form VLPs similar to the unmodified B lineage SARS-CoV-2 S protein ( Figure 2A , construct 9125). Donor C.37 ("λ") lineage ( Figure 2E , construct 9588) forms VLPs similar to the receptor B lineage SARS-CoV-2 S protein.

[0189] like Figure 6CAs further shown, when expressed in Nicotiana benthamiana, modified B lineage S proteins (constructs: 9802, 10346, and 10351) were observed to form VLPs similar to the unmodified B lineage SARS-CoV-2 S protein ( Figure 2A , construct 9125).

[0190] VLP can be produced in suitable host or host cell (including plant and plant cell).After extraction from host or host cell and separation and further purification under suitable conditions, VLP can be recovered as intact structure.

[0191] VLPs can be purified or extracted using any suitable method, such as chemical or biochemical extraction. VLPs are relatively sensitive to drying, heat, pH, surfactants, and detergents. Therefore, methods to relax the cell wall to release the protein or VLP may be useful, using methods that maximize yield, minimize contamination of the VLP fraction with cellular proteins, maintain the integrity of the protein or VLP and, if desired, the integrity of the associated lipid envelope or membrane. Minimize or eliminate detergents or surfactants (such as SDS or Triton TM X-100) may be useful to increase the yield of VLP extraction. Figure 4B ) or by size exclusion chromatography to assess the structure and size of VLPs.

[0192] For enveloped viruses such as coronaviruses, it may be advantageous for the virus to retain a lipid layer or membrane. The composition, quality, and quantity of lipids may vary from system to system (for example, enveloped viruses produced by plants will include plant lipids or phytosterols in the envelope) and may contribute to improved immune responses.

[0193] Thus, the VLPs produced in a host or host cell may comprise lipids from the plasma membrane of the host or host cell. For example, VLPs produced in plants may contain lipids of plant origin ("plant lipids"), VLPs produced in insect cells may comprise lipids from the plasma membrane of insect cells (commonly referred to as "insect lipids"), and VLPs produced in mammalian cells may comprise lipids from the plasma membrane of mammalian cells (commonly referred to as "mammalian lipids").

[0194] Plant lipids or plant derived lipids can be in the form of lipid bilayers, and can also include the envelope around VLP. The lipid of plant origin may include the lipid components of the plant plasma membrane where VLP is produced, including phospholipids, triglycerides, diglycerides and monoglycerides, and fat-soluble sterols or metabolites comprising sterols. Examples include phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol, phosphatidylserine, sphingolipids, phytosterols or their combinations. The example of phytosterols includes campesterol, stigmasterol, ergosterol, brassicasterol, delta-7-stigmasterol, delta-7-avenasterol, carrot sterol, sitosterol, 24-methyl cholesterol, cholesterol or beta-sitosterol. It will be appreciated by those skilled in the art that the lipid composition of the cytoplasmic membrane may change with the cultivation or growth conditions of cells or organisms or the species that obtain cells. Generally, beta-sitosterol is the most abundant phytosterol.

[0195] Without wishing to be bound by theory, plant-made VLPs comprising plant-derived lipids may induce a more potent immune response than VLPs prepared in other manufacturing systems, and the immune response induced by these plant-made VLPs may be more potent than that induced by live or attenuated whole virus vaccines.

[0196] Furthermore, the ability of plant N-glycans to promote the capture of glycoprotein antigens by antigen-presenting cells may be beneficial for the production of VLPs in plants, in addition to the potential adjuvant effects of the presence of plant lipids.

[0197] The VLP produced in the plant may include a modified S protein comprising plant-specific N-glycans. Therefore, the present disclosure also provides a VLP comprising a modified S protein having plant-specific N-glycans. In addition, a VLP is provided comprising a plant lipid and a modified S protein having plant-specific N-glycans.

[0198] method

[0199] Also provided is a method for producing a modified S protein or a virus-like particle (VLP) comprising the modified S protein in a host or a host cell.

[0200] The method comprises introducing a nucleic acid comprising a sequence encoding a modified S protein as described herein into a host or host cell, or providing a host or host cell comprising a nucleic acid encoding a modified S protein as described herein, and incubating the host or host cell under conditions that allow expression of the nucleic acid, thereby producing the modified S protein. The modified S protein can then self-assemble into VLPs comprising the modified S protein (see Figure 2B-2D and 6C).

[0201] In addition, a method for increasing the purity or homogeneity of a coronavirus S protein produced in a host or host cell is provided. The method comprises introducing a nucleic acid comprising a sequence encoding a modified S protein as described herein into a host or host cell, or providing a host or host unit comprising a nucleic acid encoding a modified S protein as described herein, and incubating the host or host cell under conditions that allow expression of the nucleic acid, thereby producing a modified S protein, wherein the produced S protein has an increased purity and / or homogeneity compared to the purity and / or homogeneity of an unmodified S protein produced under similar conditions in the host or host cell.

[0202] Further provided is a modified S protein produced by the method as described herein, wherein the modified S protein has increased purity and / or homogeneity compared to the purity and / or homogeneity of an unmodified S protein prepared under similar conditions in a host or host cell.

[0203] The modified S protein as described herein may have a purity and / or homogeneity of about 80% to 98% or any amount therebetween. For example, the modified S protein may have a purity and / or homogeneity of about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or any amount therebetween.

[0204] It is ideal that a recombinant protein sample is pure and homogeneous, ie, the recombinant protein is present in the same consistent form and size throughout the sample.

[0205] In the present application, "increased purity" or "increased homogeneity" means that the recombinant S protein increases in stable and uniform protein length, such as the full length of the expressed protein. As described above, during expression in a host cell or subsequent purification from a host cell, the recombinant protein may be degraded (also referred to as "clipped", "hydrolyzed" or "truncated") at one or more residues by enzymatic, proteolytic or chemical events that occur after or simultaneously with expression or translation. Without wishing to be bound by theory, most protein degradation can be attributed to host cell-derived proteases.

[0206] As described in the present application, when the S protein is modified, a more stable and homogenous protein sample is obtained. More specifically, it has been found that when the modified S protein is produced in a host or host cell (such as a plant or plant cell), fewer cleaved or truncated versions of the S protein are observed, and the modified S protein exhibits increased stability to proteolysis compared to the unmodified S protein sample.

[0207] By modifying the S protein as described herein, the proportion of cut, truncated or sheared S protein is reduced, and the proportion of full-length S protein is increased. Therefore, when produced in a host or host cell, the modified S protein with the combined modifications as described herein may result in a reduced proportion of cut, truncated or sheared S protein and an increased proportion of full-length S protein compared to the unmodified S protein. For example, the ratio between the full-length modified S protein and the truncated modified S protein is about 1:0.02 to 1:0.25, or any amount of the full-length to truncated modified S protein ratio therebetween, such as a ratio of the full-length to truncated modified S protein of 1:0.05, 1:0.1, 1:0.15, 1:2 or 1:0.25.

[0208] With respect to a coronavirus S protein or a modified coronavirus S protein, a "full-length S protein" (also referred to as a complete S protein) or a "full-length modified S protein" (also referred to as a fully modified S protein) refers to an S protein or a modified S protein having a polypeptide sequence and / or length corresponding to the theoretical polypeptide sequence or length of a construct expressing a recombinant S protein or a recombinant modified S protein. The full-length S protein or the modified S protein may include a signal peptide to direct localization when expressed in a host or host cell. The signal peptide may be a native (relative to the protein) signal or leader sequence, or a heterologous signal sequence.

[0209] Therefore, as described herein, the modified S protein can be produced as a precursor protein comprising a modified S protein and a heterologous amino acid signal peptide sequence. For example, the modified S protein precursor can include a signal peptide from protein disulfide isomerase (PDI SP; nucleotides 32-103 of accession number Z11499).

[0210] Since the signal peptide is cleaved when the mature S protein is produced in a host or host cell, the full-length modified S protein may also refer to a mature modified S protein without a signal peptide. The full-length S protein or modified S protein is in contrast to a truncated S protein, in which a portion of the N-terminus or C-terminus of the mature S protein may have been proteolytically eliminated.

[0211] For example, the full-length S protein may correspond to the full length of the sequence of SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18 or 20, wherein the sequence may include a signal peptide. Alternatively, the full-length S protein may correspond to the full length of the sequence of SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 20, 39, 41, 43, 45, 47, 49, 51, 53, 55 or 57, without a signal peptide. For example, the full-length modified S protein may correspond to the full length of the sequence of SEQ ID NO: 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37.

[0212] With respect to S protein or modified S protein, "cleaved S protein", "truncated S protein", "clipped S protein", "cleaved modified S protein", "truncated modified S protein", or "clipped modified S protein" refers to an expressed polypeptide of a coronavirus S protein that is cleaved or truncated at one or more residues after or simultaneously with expression or translation by an enzyme, proteolytic or chemical event, wherein the cleavage or truncation is the result of unintended proteolytic processing of the protein. "Cleaved S protein", "truncated S protein", "clipped S protein", "cleaved modified S protein", "truncated modified S protein", or "clipped modified S protein" does not include an S protein (or modified S protein) in which the signal peptide has been cleaved to produce a mature S protein or a mature modified S protein.

[0213] The present disclosure also relates to a method for improving the N-terminal homogeneity of a coronavirus S protein (modified S protein), wherein 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the coronavirus S protein has a modification that corrects the N-terminal amino acid sequence.

[0214] The genetic constructs comprising one or more than one modification of the modified S protein of the present invention can be expressed in any suitable host or host cell transformed by the nucleic acid, or nucleotide sequence, or construct or vector disclosed herein. The host or host cell can be from any source, including plants, fungi, bacteria, insects and animals, such as mammals. The host can also be a non-human host. For example, the host or host cell can be selected from plants or plant cells, fungi or fungal cells, bacteria or bacterial cells, insects or insect cells, and animals or animal cells. The mammal or animal may not be human. In a preferred embodiment, the host or host cell is a plant, a part of a plant, or a plant cell.

[0215] As used herein, the terms "plant", "part of a plant", "plant part", "plant matter", "plant biomass", "plant material", "plant extract" or "plant leaf" may include a whole plant, a plant cell, a tissue, a cell or any part thereof, an intracellular plant component, an extracellular plant component, a liquid or solid extract of a plant, or a combination thereof, which can provide transcription, translation and post-translational machinery for expressing one or more than one nucleic acid described herein, and / or from which the expressed protein or VLP can be extracted and purified. Plants may include, but are not limited to, herbaceous plants. Herbaceous plants may be annual, biennial or perennial plants. Plants may also include, but are not limited to, crops, including, for example, rapeseed, Brassica, corn, Nicotiana, (tobacco), for example, Nicotiana benthamiana, Nicotiana rustica, Nicotiana, tabacum, Nicotiana alata, Arabidopsis thaliana, alfalfa, potato. Sweet potato (Ipomoea batatus), ginseng, pea, oat, rice, soybean, wheat, barley, sunflower, cotton, corn, rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), safflower (Carthamus tinctorius).

[0216] As used herein, the term "plant part" refers to any part of a plant, including but not limited to leaves, stems, roots, flowers, fruits, plant cells obtained from leaves, stems, roots, flowers, fruits, plant extracts obtained from leaves, stems, roots, flowers, fruits, or combinations thereof. In one embodiment, a plant part refers to a regional part of a plant, such as, for example, leaves, stems, flowers, and fruits. As used herein, the term "plant extract" refers to a plant-derived product obtained after physically (e.g., by freezing, then extracting in a suitable buffer), mechanically (e.g., by grinding or homogenizing a plant or a part of a plant, then extracting in a suitable buffer), enzymatically (e.g., using cell wall degrading enzymes), chemically (e.g., using one or more chelating agents or buffers), or a combination thereof, treating a plant, a part of a plant, a plant cell, or a combination thereof. The plant extract can be further processed to remove unwanted plant components, such as cell wall fragments. Plant extracts can be obtained to help recover one or more components from a plant, a plant part, or a plant cell, such as recovering proteins (including protein complexes, protein superstructures, and / or VLPs), nucleic acids, lipids, carbohydrates, or combinations thereof from a plant, a plant part, or a plant cell. If a plant extract comprises protein, it can be referred to as a protein extract. The protein extract can be a crude plant extract, a partially purified plant or protein extract or a purified product from plant tissue, which comprises one or more proteins, a protein complex, such as a protein trimer, a protein superstructure and / or a VLP. If desired, a technical partially purified protein extract or a plant extract well known to those skilled in the art can be used, for example, extracts can be subjected to salt or pH precipitation, centrifugation, gradient density centrifugation, filtration, chromatography, such as size exclusion chromatography, ion exchange chromatography, affinity chromatography or its combination. Technical purified protein extracts well known to those skilled in the art can also be used.

[0217] The constructs disclosed herein can be introduced into plant cells using Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, etc. For a review of these techniques, see, for example, Weissbach and Weissbach, Methods for Plant Molecular Biology, Academy Press, New York VIII, pp. 421-463 (1988); Geierson and Corey, Plant Molecular Biology, 2nd ed., (1988); and Miki and Iyer, Fundamentals of Gene Transfer in Plants. In Plant Metabolism, 2nd ed., DT. Dennis, DH Turpin, DD Lefebvre, DB Layzell (eds.), Addison Wesly, Langmans Ltd. London, pp. 561-579 (1997). Other methods include direct DNA uptake, use of liposomes, electroporation, for example using protoplasts, microinjection, microbullets or whiskers, and vacuum infiltration.See, e.g., Bilang et al., (Gene 100:247-250 (1991), Scheid et al., (Mol. Gen. Genet. 228:104-112, 1991), Guerche et al., (Plant Science 52:111-116, 1987), Neuhause et al., (Theor. Appl Genet. 75:30-36, 1987), Klein et al., Nature 327:70-73 (1987); Howell et al., (Science 208:1265, 1980), Horsch et al., (Science 227:1229-1231, 1985), DeBlock et al., Plant Physiology 91:694-701, 1989), Methods for Plant Molecular Biology. Biology (Weissbach and Weissbach, eds., Academic Press Inc., 1988), Methods in Plant Molecular Biology (Schuler and Zielinski, eds., Academic Press Inc., 1989), Liu and Lomonossoff (J Virol Meth, 105:343-348, 2002), U.S. Patent Nos. 4,945,050; 5,036,006; and 5,100,792, U.S. Patent Application Serial Nos. 08 / 438,666, filed May 10, 1995, and 07 / 951,715, filed September 25, 1992 (all of which are incorporated herein by reference).

[0218] As described below, transient expression methods can be used to express the constructs of the present disclosure (see Liu and Lomonossoff, 2002, Journal of Virology methods, 105: 343-348; which is incorporated herein by reference). Alternatively, vacuum-based transient expression methods can be used, such as Kapila et al., 1997, which are incorporated herein by reference). These methods can include, for example, but not limited to, agroinoculation or agroinfiltration, syringe infiltration, however, as described above, other transient methods can also be used. Through agroinoculation, agroinfiltration or syringe infiltration, a mixture of Agrobacteria containing the desired nucleic acid enters the intercellular space of the tissue, such as leaves, aerial parts of plants (including stems, leaves and flowers), other parts of plants (stems, roots, flowers) or the entire plant. After passing through the epidermis, Agrobacterium infects and transfers t-DNA copies to the cell. T-DNA is transcribed through free genes and translated by mRNA, resulting in the production of the protein of interest by the infected cell, however, the passage of t-DNA in the nucleus is transient.

[0219] In order to help identify transformed plant cells, the construct of the present disclosure can be further manipulated to include plant selective markers. Useful selective markers include enzymes that provide resistance to chemical substances, such as antibiotics, such as gentamicin, hygromycin, kanamycin or herbicides such as phosphinothrycin, glyphosate, chlorsulfuron, etc. Similarly, enzymes that provide the production of compounds that can be identified by color changes, such as GUS (β-glucuronidase), or luminescent materials such as luciferase or GFP can be used.

[0220] A part of the disclosure is also considered to be a transgenic plant, plant cell or seed containing a gene construct of the disclosure, which can be used as a platform plant suitable for transient protein expression as described herein. The method of regenerating whole plants from plant cells is also known in the art (for example, see Guerineau and Mullineaux (1993, plant transformation and expression vectors). In Plant Molecular Biology Labfax (Croy RRD editor) Oxford, BIOS Scientific Publishers, pages 121-148). Generally, the transformed plant cells are cultured in a suitable culture medium, which may contain selective agents such as antibiotics, wherein selective markers are used to promote the identification of transformed plant cells. Once callus formation, appropriate plant hormones can be used according to known methods to promote bud formation, and the buds are transferred to a rooting medium to regenerate plants. Then, these plants can be used to establish repeated generations from seeds or using asexual propagation techniques. Transgenic plants can also be produced without using tissue culture. The stable transformation and regeneration methods of these organisms have been established in the art and are known to those skilled in the art. Useful techniques are reviewed in Vasil et al., (Cell Culture and Somatic Cell Genetics of Plants, Vols. I, II and III, Laboratory Procedures and Their Applications, Academic Press, 1984), and Weissbach and Weissbach (Methods for Plant Molecular Biology, Academic Press, 1989). The method by which the transformed and regenerated plants are obtained is not critical to the present disclosure.

[0221] If plant, plant part or vegetable cell will be transformed or co-transformed by two or more nucleic acid constructs, then nucleic acid construct can be introduced into Agrobacterium in a single transfection event, thereby collect nucleic acid, and transfect bacterial cell.Alternatively, construct can be introduced continuously.In this case, as described herein, the first construct is introduced into Agrobacterium, and cell is grown under selective conditions (for example, in the presence of antibiotic), and wherein only the bacterium of independent transformation can grow.After this first selection step, as described herein, the second nucleic acid construct is introduced into Agrobacterium, and under dual selective conditions, grow cell, wherein only the bacterium of dual transformation can grow.Then, as described herein, the bacterium of dual transformation can be used for transformation of plant, a part of plant or vegetable cell, or further transformation step can be carried out to accommodate the 3rd nucleic acid construct.

[0222] Alternatively, if a plant, plant part or plant cell is to be transformed or co-transformed with two or more nucleic acid constructs, the nucleic acid constructs can be introduced into the plant by co-infiltration of a mixture of Agrobacterium cells with the plant, plant part or plant cell, each Agrobacterium cell can contain one or more constructs to be introduced into the plant. In order to change the relative expression level of the nucleotide sequence of interest within the construct in the plant, plant part or plant cell, the concentration of the various Agrobacterium populations containing the desired constructs can be varied during the infiltration step.

[0223] A nucleic acid sequence or nucleotide sequence referred to in the present disclosure may be "substantially homologous," "substantially similar," or "substantially identical" to a sequence or a complement of a sequence if the nucleic acid sequence or nucleotide sequence hybridizes under stringent hybridization conditions to one or more nucleotide sequences or the complement of a nucleic acid sequence or nucleotide sequence as defined herein. A sequence is "substantially homologous," "substantially similar," or "substantially identical" to a sequence or a complement of a sequence when at least about 60% or 60% to 100% or any amount therebetween, such as 60%, 62%, 64%, 66%, 68%, 70%, 72%, 74%, 76%, 78%, 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 100% or any amount therebetween, of the nucleotides match over a defined length of the nucleotide sequence, provided that these homologous sequences exhibit one or more properties of the sequences or encoded products described herein.

[0224] When referring to specific sequences, the terms "percent similarity," "sequence similarity," "percent identity," or "sequence identity" are used, for example, as described in the University of Wisconsin GCG software program, or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology, Ausubel et al., eds., 1995 Supplement). Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be performed using, for example, the algorithm of Smith and Waterman (1981, Adv. Appl. Math. 2:482), by the alignment algorithm of Needleman and Wunsch (1970, J. Mol. Biol. 48:443), by the search for similarity method of Pearson and Lipman (1988, Proc. Natl. Acad. Sci. USA 85:2444), by computerized implementations of these algorithms (e.g., GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology (Ausubel et al., eds., 1995 suppl.)).

[0225] Examples of algorithms suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1977, Nuc. Acids Res. 25:3389-3402) and Altschul et al. (1990, J. Mol. Biol. 215:403-410), respectively. BLAST and BLAST 2.0 are used with the parameters described herein to determine percent sequence identity for nucleic acids and proteins of the present disclosure. For example, the BLASTN program (for nucleotide sequences) can use a word length (W) of 11, an expectation (E) of 10, M=5, N=-4, and a comparison of both chains as default values. For amino acid sequences, the BLASTP program can use a word length of 3, an expectation value (E) of 10, and the BLOSUM62 scoring matrix as defaults (see Henikoff and Henikoff, 1989, Proc. Natl. Acad. Sci. USA 89:10915), an alignment (B) of 50, an expectation value (E) of 10, M=5, N=-4, and a comparison of both chains. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (see URL: ncbi.nlm.nih.gov / ).

[0226] Many organisms prefer to use specific codons to encode the insertion of specific amino acids in growing peptide chains. Codon preference or codon bias, the difference in codon usage between organisms, is provided by the degeneracy of the genetic code and is well documented in many organisms. Codon bias is generally correlated with the efficiency of translation of messenger RNA (mRNA), which in turn is thought to depend, among other things, on the properties of the codons being translated and the availability of specific transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell generally reflects the codons that are most frequently used in peptide synthesis. Therefore, genes can be tailored based on codon optimization to achieve optimal gene expression in a given organism. The process of optimizing the nucleotide sequence encoding a heterologously expressed protein can be an important step in increasing the amount of expression. Optimization requirements can include steps to increase the host's ability to produce foreign proteins.

[0227] Different codon optimization techniques are known in the art to improve the translation dynamics of protein coding regions with low translation efficiency. These techniques mainly rely on identifying the codon usage of a specific host organism. If a gene or sequence should be expressed in this organism, the coding sequence of these genes and sequences will be modified so that the codons of the sequence of interest are replaced with codons that are more commonly used in the host organism.

[0228] "Codon optimization" is defined as the modification of a nucleic acid sequence by replacing at least one, more than one, or a large number of codons of the native sequence with codons that may be more frequently or most frequently used in genes of another organism or species to enhance expression in a host or host cell of interest. Various species exhibit specific biases for certain codons for specific amino acids.

[0229] The present disclosure includes synthetic polynucleotide sequences that have been codon-optimized, such as sequences that have been optimized for human codon usage or plant codon usage. The codon-optimized polynucleotide sequences can then be expressed in a host, such as a plant. More specifically, sequences optimized for human codon usage or plant codon usage can be expressed in plants. Without wishing to be bound by theory, it is believed that when plants are used as hosts, sequences optimized for human codons increase the guanine-cytosine content (GC content) of the sequence and increase expression.

[0230] As used herein, the term "construct", "vector" or "expression vector" refers to a recombinant nucleic acid used to transfer an exogenous nucleotide sequence (e.g., a nucleotide sequence encoding a modified S protein described herein) into a host cell (e.g., a plant cell) and direct the expression of the exogenous nucleic acid sequence in the host cell. An "expression cassette" refers to a nucleic acid that is contained under the control of an appropriate promoter or other regulatory element and is operably (or effectively) connected to an appropriate promoter or other regulatory element for transcribing a nucleotide sequence of interest for a nucleic acid of interest in a host cell. As will be appreciated by those skilled in the art, an expression cassette may include a termination (terminator) sequence, which is any sequence that is active against a host cell (e.g., a plant host). For example, in plants, the termination sequence may be derived from the RNA-2 genomic fragment of a bipartite RNA virus (e.g., cowpea mosaic virus group), the termination sequence may be the NOS terminator, or the terminator sequence may be obtained from the 3'UTR of the alfalfa plastocyanin gene.

[0231] As described herein, the nucleic acid comprising a nucleotide sequence encoding a modified S protein may further comprise a sequence that enhances the expression of the S protein in a host, a host part, or a host cell. The sequence that enhances expression may include a 5'UTR enhancer element or a plant-derived expression enhancer that is effectively bound to the nucleic acid encoding the modified viral structural protein. The sequence encoding the modified S protein may also be optimized to increase expression by, for example, optimizing human codon usage, increasing GC content, or a combination thereof.

[0232] "Regulatory region", "regulatory element" or "promoter" means a part of nucleic acid, usually but not always located upstream of the protein coding region of a gene, which may be composed of DNA or RNA, or both. When the regulatory region is active and operably combined or effectively connected to the nucleotide sequence of interest, this may result in the expression of the nucleotide sequence of interest. The regulatory element may be able to mediate organ specificity, or control development or time gene activation. "Regulatory region" includes promoter elements, core promoter elements that exhibit basal promoter activity, elements that can induce responses to external stimuli, and elements that mediate promoter activity (such as negative regulatory elements or transcription enhancers). As used herein, "regulatory region" also includes elements that are active after transcription, such as regulatory elements that regulate gene expression, such as translation and transcription enhancers, translation and transcription repressors, upstream activation sequences, and mRNA instability determinants. Several of the latter elements can be located at the proximal end of the coding region.

[0233] In the context of the present disclosure, the term "regulatory element" or "regulatory region" generally refers to a DNA sequence upstream (5') of a structural gene coding sequence, usually but not always, which controls the expression of the coding region by recognizing RNA polymerase and / or other factors required for transcription to start at a specific site. However, it should be understood that other nucleotide sequences located within introns or within the 3' of the sequence may also help to regulate the expression of the coding region of interest. An example of a regulatory element that provides recognition of RNA polymerase or other transcription factors to ensure initiation at a specific site is a promoter element. Most (but not all) eukaryotic promoter elements contain a TATA box, which is a conserved nucleic acid sequence consisting of adenosine and thymidine nucleotide base pairs, typically located about 25 base pairs upstream of the transcription start site. Promoter elements can include a basic promoter element responsible for initiating transcription, as well as other regulatory elements that modify gene expression.

[0234] There are several types of regulatory regions, including those that are developmentally regulated, inducible or constitutive. At a specific time during organ or tissue development, a regulatory region that activates developmental regulation in certain organs or the tissue of an organ, or a regulatory region that controls differential gene expression under its control. However, at a specific developmental stage, some developmentally regulated regulatory regions may be preferentially active in certain organs or tissues, and they may also be active in a developmentally regulated manner, or may also be at a basal level in other organs or tissues in a plant. Examples of tissue-specific regulatory regions, such as referring to specific regulatory regions, include rapeseed protein promoters and cruciferous protein promoters (Rask et al., 1998, J. Plant Physiol. 152: 595-599; Bilodeau et al., 1994, Plant Cell 14: 125-130). Examples of leaf-specific promoters include plastocyanin promoters (see US 7,125,978, which is incorporated herein by reference).

[0235] Inducible regulatory region is a regulatory region that can directly or indirectly activate the transcription of one or more DNA sequences or genes in response to an inducing agent. In the absence of an inducing agent, the DNA sequence or gene will not be transcribed. Usually, the protein factor that specifically binds to the inducible regulatory region to activate transcription may exist in an inactive form, and is then directly or indirectly converted into an active form by the inducing agent. However, protein factors may also be missing. Inducers can be chemical reagents, such as proteins, metabolites, growth regulators, herbicides or phenolic compounds, or physiological stresses directly applied by heat, cold, salt or toxic elements, or physiological stresses indirectly applied by the effect of pathogens or disease agents (such as viruses). Plant cells containing inducible regulatory regions can be exposed to inducing agents by applying inducing agents from the outside to cells or plants, such as by spraying, watering, heating or similar methods. Inducible regulatory elements may be derived from plants or non-plant genes (e.g., Gatz, C. and Lenk, IRP, 1998, Trends Plant Sci.3, 352-358). Examples of potential inducible promoters include, but are not limited to, tetracycline-inducible promoters (Gatz, C., 1997, Ann. Rev. Plant Physiol. Plant Mol. Biol. 48, 89-108), steroid-inducible promoters (Aoyama, T. and Chua, NH, 1997, Plant J. 2, 397-404) and ethanol-inducible promoters (Salter, MG, et al., 1998, Plant Journal 16, 127-132; Caddick, MX et al., 1998, Nature Biotech. 16, 177-180), cytokinin-inducible IB6 and CKI1 genes (Brandstatter, I. and Kieber, JJ, 1998, Plant Cell 10, 1009-1019; Kakimoto, T., 1996, Science 274, 982-985) and the auxin-inducible element DR5 (Ulmasov, T., et al., 1997, Plant Cell 9, 1963-1971).

[0236] Constitutive regulatory regions direct the expression of a gene in various parts of the plant and continue to be expressed throughout plant development. Examples of known constitutive regulatory elements include the promoter associated with the CaMV 35S transcript (p35S; Odell et al., 1985, Nature, 313:810-812; the patents of which are incorporated herein by reference), rice actin 1 (Zhang et al., 1991, Plant Cell, 3:1155-1165), actin 2 (An et al., 1996, Plant J., 10:107-121), or tms2 (US Pat. No. 5,428,147), and the triosephosphate isomerase 1 (Xu et al., 1994, Plant Physiol. 106:459-467) gene, the maize ubiquitin 1 gene (Cornejo et al., 1993, Plant Mol. Biol. 29:637-646), the Arabidopsis thaliana ubiquitin 1 and 6 genes (Holtorf et al., 1995, Plant Mol.Biol.29:637-646), tobacco translation initiation factor 4A gene (Mandel et al., 1995 Plant Mol.Biol.29:995-1004), cassava vein mosaic virus promoter pCAS (Verdaguer et al., 1996); ribulose bisphosphate carboxylase small subunit promoter pRbcS: (Outchkourov et al., 2003), pUbi (for monocots and dicots).

[0237] As used herein, the term "constitutive" does not necessarily mean that a nucleotide sequence under the control of a constitutive regulatory region is expressed at the same level in all cell types, but rather that the sequence is expressed in a variety of cell types, even though variations in abundance are often observed.

[0238] As required, one or more genetic constructs of the present disclosure may also include other enhancers, translation or transcription enhancers. The enhancer may be located 5' or 3' to the sequence being transcribed. The enhancer region is well known to those skilled in the art and may include an ATG start codon, adjacent sequences, etc. The start codon (if present) may be in phase with the reading frame ("in frame") of the coding sequence to provide correct translation of the transcribed sequence.

[0239] The term "5'UTR" or "5' untranslated region", "5' leader sequence" or "5'UTR enhancer element" refers to the untranslated region of an mRNA. The 5'UTR generally begins at the transcription start site and ends before the translation start site or the start codon of the coding region. The 5'UTR may regulate the stability and / or translation of the mRNA transcript.

[0240] As used herein, the term "plant-derived expression enhancer" refers to a nucleotide sequence obtained from a plant that encodes a 5'UTR. Examples of plant-derived expression enhancers are described in U.S. Provisional Patent Application No. 62 / 643,053 (filed March 14, 2018) and International Application No. PCT / CA2019 / 050319 (filed March 14, 2019); which are incorporated herein by reference) or Diamos AG et al. (2016, Front Plt Sci. 7: 1-15; which are incorporated herein by reference). The plant-derived expression enhancer can be selected from nbEPI42, nbSNS46, nbCSY65, nbHEL40, nbSEP44, nbMT78, nbATL75, nbDJ46, nbCHP79, nbEN42, atHSP69, atGRP62, atPK65, atRP46, nb30S72, nbGT61, nbPV55, nbPPI43, nbPM64 and nbH2A86, as described in US 62 / 643,053 and PCT / CA2019 / 050319. The plant-derived expression enhancer can be used in a plant expression system comprising a regulatory region operably linked to a plant-derived expression enhancer sequence and a nucleotide sequence of interest, such as a nucleotide sequence encoding a modified S protein.

[0241] By including a 3' untranslated region (3'UTR), the stability and / or translation efficiency of RNA can be further improved. Therefore, one or more genetic constructs of the present specification may further include a 3'UTR.

[0242] The 3' untranslated region may contain a polyadenylation signal and any other regulatory signal that can affect mRNA processing or gene expression. The polyadenylation signal is usually characterized by the addition of a polyadenylic acid footprint (track) at the 3' end of the mRNA precursor. The polyadenylation signal is usually identified by homology with the canonical form 5'AATAAA-3', although variations are not uncommon. Non-limiting examples of suitable 3' regions are 3' transcribed untranslated regions that contain polyadenylation signals of Agrobacterium tumor-inducing (Ti) plasmid genes, such as nopaline synthase (Nos gene) and plant genes such as soybean storage protein genes, small subunits of ribulose-1,5-bisphosphate carboxylase genes (ssRUBISCO; US 4,962,028; which is incorporated herein by reference), promoters for regulating plastocyanin expression, such as described in US 7,125,978 (which is incorporated herein by reference), derived from Arracacha virus (Arracacha virus) B isolate gene (AvB), a 3' UTR derived from beet necrotic yellow vein virus (trBNYVV), a 3' UTR derived from southern bean mosaic virus (SBMV), a 3' UTR derived from turnip ringspot virus (TuRSV), a 3' UTR derived from cowpea mosaic virus (CPMV), a 3' UTR derived from broad bean true mosaic virus (BBTMV), or a 3' UTR derived from muskmelon virus (trOUMV). The 3' UTR can be used in conjunction with a 5' UTR derived from a heterologous sequence to modulate expression levels.

[0243] Therefore, a "construct", "vector", "expression vector" or "expression cassette" is provided, which comprises a nucleic acid comprising a nucleotide sequence of interest (such as a modified viral structural protein) under the control of a 3'UTR and operatively (or operatively) linked to the 3'UTR. In addition, the nucleic acid may comprise a 3'UTR operatively (or operatively) linked to a nucleotide sequence of interest (such as a modified viral structural protein).

[0244] The modified S protein or VLP comprising the modified S protein as described herein can be used to elicit an immune response in a subject.

[0245] "Immune response" generally refers to the response of the adaptive immune system of a subject. The adaptive immune system generally includes humoral responses and cell-mediated responses. The humoral response is an aspect of immunity mediated by secretory antibodies produced in cells of the B lymphocyte lineage (B cells). Secretory antibodies bind to antigens on the surface of invading microorganisms (such as viruses or bacteria), which marks them for destruction. Humoral immunity is generally used to refer to antibody production and its accompanying processes, as well as the effector functions of antibodies, including Th2 cell activation and cytokine production, memory cell generation, opsonin-promoted phagocytosis, pathogen elimination, etc. The term "modulate" or "modulation" and the like refer to an increase or decrease in a specific response or parameter, as determined by any of several assays commonly known or used, some of which are exemplified herein.

[0246] A cell-mediated response is an immune response that does not involve antibodies, but rather involves the activation of macrophages, natural killer cells (NK), antigen-specific cytotoxic T lymphocytes, and the release of a variety of cytokines in response to antigens. Cell-mediated immunity is often used to refer to some Th cell activation, Tc cell activation, and T cell-mediated responses. Cell-mediated immunity may be particularly important in responding to viral infections.

[0247] For example, the induction of antigen-specific CD8 positive T lymphocytes can be measured using ELISPOT assays; the stimulation of CD4 positive T lymphocytes can be measured using proliferation assays. Anti-coronavirus antibody titers can be quantified using ELISA assays; the isotypes of antigen-specific or cross-reactive antibodies can also be measured using anti-isotype antibodies (e.g., anti-IgG, IgA, IgE, or IgM). Methods and techniques for performing such assays are well known in the art.

[0248] The presence or level of cytokines can also be quantified. For example, cells secreting IFN-γ and IL-4 will be measured using ELISA (e.g., BD Biosciences OptEIA kit) to characterize helper T cell responses (Th1 / Th2). Peripheral blood mononuclear cells (PBMC) or splenocytes obtained from a subject can be cultured and the supernatant analyzed. T lymphocytes can also be quantified using marker-specific fluorescent labels and methods known in the art by fluorescence activated cell sorting (FACS).

[0249] Microneutralization assays can also be performed to characterize immune responses in subjects, see, e.g., the method of Rowe et al., 1973. Virus neutralization titers can be quantified in a variety of ways, including: counting of lytic plaques after vigorous fixation / staining of cell crystals (plaque assay); microscopic observation of cell lysis in in vitro culture; and ELISA and spectrophotometric detection of coronaviruses.

[0250] As used herein, the term "epitope" or "epitopes" refers to the structural portion of an antigen to which an antibody specifically binds.

[0251] Provided is a method for producing an antibody or antibody fragment, the method comprising administering to a subject or host animal a modified S protein, trimer or trimer-modified S protein, VLP, a composition or vaccine comprising a modified S protein as described herein, thereby producing an antibody or antibody fragment. Also provided is an antibody or antibody fragment produced by the method.

[0252] Therefore, the present disclosure also provides the use of a modified coronavirus S protein or a VLP comprising a modified coronavirus S protein as described herein for inducing immunity to coronavirus infection in a subject. Also disclosed herein is an antibody or antibody fragment prepared by administering a modified coronavirus S protein or a VLP comprising a modified coronavirus S protein to a subject or a host animal.

[0253] A composition is further provided, comprising an effective dose of a modified coronavirus S protein as described herein or a VLP comprising a modified coronavirus S protein and a pharmaceutically acceptable carrier, adjuvant, solvent or excipient for inducing an immune response in a subject. A vaccine for inducing an immune response to coronavirus in a subject is also provided, wherein the vaccine comprises an effective dose of a modified coronavirus S protein or a VLP comprising a modified coronavirus S protein.

[0254] The composition or vaccine may comprise a VLP comprising a modified S protein from a class of coronavirus families, subgroups, types, subtypes, lineages, subgenus or strains, or the composition or vaccine may comprise a plurality of VLP types, wherein each VLP type comprises a modified S protein, wherein the modified S protein in the same VLP is derived from a class of coronavirus families, subgroups, types, subtypes, lineages, subgenus or strains, i.e., the composition or vaccine may comprise a mixture of different coronavirus VLPs, wherein each VLP may comprise a modified S protein from the same coronavirus family, subgroup, type, subtype, lineage, subgenus or strain. For example, the composition or vaccine may comprise a first VLP and a second VLP, wherein the first VLP comprises a first modified S protein from a first coronavirus family, subgroup, type, subtype, lineage or strain, and the second VLP comprises a second modified S protein from a second coronavirus family, subgroup, type, subtype, lineage or strain. In addition, the composition may also include a third VLP comprising a third modified S protein from a third coronavirus family, subgroup, type, subtype, lineage or strain, and / or the composition or vaccine may include a fourth VLP comprising a fourth modified S protein from a fourth coronavirus family, subgroup, type, subtype, lineage, subgenus or strain.

[0255] The composition or vaccine may further comprise a VLP comprising a modified S protein of more than one class from a coronavirus family, subgroup, type, subtype, pedigree, subgenus or strain. For example, the VLP may comprise a first modified S protein from a first coronavirus family, subgroup, type, subtype, pedigree or strain, and a second modified S protein from a second coronavirus family, subgroup, type, subtype, pedigree or strain. In addition, the VLP may comprise a third modified S protein from a third coronavirus family, subgroup, type, subtype, pedigree or strain, and / or the VLP may comprise a fourth modified S protein from a fourth coronavirus family, subgroup, type, subtype, pedigree, subgenus or strain.

[0256] Therefore, this specification also provides monovalent (monovalent) or multivalent (multivalent, polyvalent) compositions or vaccines. Monovalent compositions or vaccines can immunize subjects with a single type of coronavirus strain, while multivalent compositions or vaccines can immunize subjects with more than one coronavirus strain. For example, the composition or vaccine can be a bivalent composition or vaccine, which can immunize subjects with two different types of coronavirus families, subgroups, types, subtypes, lineages or strains after administration. In addition, the composition or vaccine can be a trivalent composition, or the vaccine or composition can be a quadrivalent or quadrivalent composition or vaccine. In addition, the vaccine may also be multivalent with respect to different types of viruses. For example, the vaccine can immunize subjects with one or more than one coronavirus strain (a first type of virus) and immunize a second type of virus, such as influenza virus.

[0257] The monovalent or multivalent composition or vaccine may further comprise a pharmaceutically acceptable carrier, adjuvant, vehicle or excipient for inducing an immune response in a subject.

[0258] Adjuvant systems that enhance the immune response of a subject to a vaccine antigen are well known and can be used in conjunction with the vaccines or pharmaceutical compositions described herein. Many types of adjuvants can be used. Commonly used adjuvants in humans include aluminum hydroxide, aluminum phosphate, and calcium phosphate. There are also many adjuvants based on oil emulsions (oil-in-water or water-in-oil emulsions, such as Freund's incomplete adjuvant (FIA), Montanide TM , Adjuvant 65 and Lipovant TM ), products from bacteria (or their synthetic derivatives), endotoxins, fatty acids, paraffin oil or vegetable oils, cholesterol and fatty amines or natural organic compounds (such as squalene). Non-limiting adjuvants that can be used include, for example, oil-in-water emulsions of squalene oil (e.g., MF-59 or AS03), adjuvants composed of the synthetic TLR4 agonist pyranosyl lipid A (GLA) incorporated into a stable emulsion (SE) (GLA-SE), or CpG 1018, a toll-like receptor (TLR9) agonist adjuvant.

[0259] Therefore, the vaccine or pharmaceutical composition may include one or more than one adjuvant. For example, the vaccine or pharmaceutical composition may include aluminum hydroxide, aluminum phosphate, calcium phosphate, oil-in-water or water-in-oil emulsions, emulsions containing squalene (e.g., MF-59 or AS03), emulsions containing GLA-SE, or CpG1018 adjuvants. In one embodiment, the adjuvant is AS03.

[0260] The pharmaceutical composition, vaccine or preparation of the present specification can be manufactured in a manner that is itself known, for example, by conventional mixing, dissolving, granulating, dragee-making, grinding, emulsifying, encapsulating, embedding or tableting processes.

[0261] A pharmaceutical composition, vaccine or formulation may be produced by mixing or premixing any of the constituent components prior to administration, for example by manual or mechanically assisted mixing of two or more vaccine suspensions, pharmaceutically acceptable carriers, adjuvants, vehicles or excipients, a step performed prior to administration of the final formulation, vaccine or pharmaceutical composition.

[0262] The pharmaceutical composition, vaccine or formulation may be administered to a subject orally, intradermally, intranasally, intramuscularly, intraperitoneally, intravenously or subcutaneously.

[0263] Injections can be prepared in conventional forms, either as liquid solutions or suspensions, or as solid forms suitable for dissolution or suspension in liquids prior to injection, or as emulsions. Suitable excipients are, for example, water, saline, glucose, mannitol, lactose, lecithin, albumin, sodium glutamate, cysteine ​​hydrochloride, and the like. In addition, if desired, the injectable pharmaceutical composition may contain a small amount of non-toxic auxiliary substances, such as wetting agents, pH buffers, and the like. Physiologically compatible buffers include, but are not limited to, Hank's solution, Ringer's solution, or physiological saline buffer. If desired, absorption enhancing preparations (e.g., liposomes) may be used.

[0264] A composition or vaccine (single dose) can be administered to a subject. In addition, multiple vaccines or compositions (multiple doses) can be administered to a subject. Therefore, a composition, preparation or vaccine can be administered to a subject in a single dose to cause an immune response, or a composition, preparation or vaccine can be administered multiple times (multiple doses). For example, a dose of a composition or vaccine can be administered 2, 3, 4 or 5 times. Therefore, a composition or vaccine can be administered to a subject in an initial dose, and then one or more than one dose can be administered to the subject. The administration of the dosage can be separated from each other in time. For example, after the initial dose is administered, one or more subsequent doses can be administered 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months or any time therebetween from the administration of the initial dose. In addition, the composition or vaccine can be administered annually. For example, the composition or vaccine can be administered as a seasonal vaccine.

[0265] The present disclosure also provides the following sequences.

[0266] Table 1: SEQ ID NO and sequence description

[0267]

[0268]

[0269]

[0270] The present invention will be further illustrated in the following examples.

[0271] Example

[0272] Example 1: Constructs

[0273] Modified coronavirus S protein in the 2X35S-nbHEL40 / AvB-NOS terminator expression system (Construct numbers 9125, 9588, 9801, 9802, 9808, 9513, 10011, 10090, 10092, 10346, 10351, 10502, 10503, 10504, 10505, 10506, 10507, 10508 and 10509).

[0274] The sequence encoding the spike (S) protein from lineage B SARS-CoV-2hCoV-19 / USA / CA2 / 2020 was cloned into the 2X35S / nbHEL40-AvB / NOS expression system using the following PCR-based method, in which the native signal peptide has been replaced by the signal peptide of alfalfa protein disulfide isomerase (PDISP / CoV S). The PDISP / CoV S sequence (SEQ ID NO:3) was used as a template to amplify a fragment containing the PDISP / CoV S coding sequence using primers IF(PDI)S-3-NY-CoV.c (SEQ ID NO:23) and IF(Avb)-H5I.r (SEQ ID NO:24). The PCR product was cloned into the 2X35S / nbHEL40-AvB / NOS expression system using the Fusion Cloning System (Clontech, Mountain View, CA). Construct number 8716 ( Figure 1A ), and the linearized plasmid was used for fusion assembly reaction. Construct number 8716 is a receptor plasmid intended for "fusion" cloning of genes of interest in an expression cassette based on 2X35S / nbHEL40-AvB / NOS. The receptor plasmid also incorporates a gene construct for co-expressing the TBSV P19 silencing suppressor under the alfalfa plastocyanin gene promoter and terminator. The backbone is the pCAMBIA binary plasmid, and the sequence of the t-DNA border from left to right is shown in SEQ ID NO:21. The resulting construct was numbered 9125 (SEQ ID NO:22). The amino acid sequence of the complete B lineage SARS-CoV-2 spike fused to PDISP is shown in SEQ ID NO:4. Plasmid 9125 is represented as follows Figure 1B shown.

[0275] Table 2: Summary of deletion constructs. The numbering of the amino acid residues corresponds to the positions in the reference sequence SEQ ID NO:1.

[0276]

[0277] Constructs 9588, 9801, 9802, 9808, 9513, 10011, 10090, 10092, 10346, 10351, 10502, 10503, 10504, 10505, 10506, 10507, 10508 and 10509 were cloned using the same method as used for plasmid 9125, and a summary of the primers, templates, receiving vectors and products is provided in Table 3 below.

[0278] Table 3

[0279]

[0280] Example 2: Method

[0281] Agrobacterium tumefaciens transfection

[0282] Agrobacterium tumefaciens strain AGL1 was transfected with a SARS-CoV-2 modified S protein expression vector by electroporation using the method described by D'Aoust et al., 2008 (Plant Biotech. J. 6:930-40).

[0283] Preparation of plant biomass, inoculum, and agroinfiltration

[0284] N. benthamiana plants were grown from seeds on flats filled with a peat moss substrate. The plants were allowed to grow in a greenhouse under controlled photoperiod and temperature conditions. Three weeks after sowing, individual plantlets were picked, transplanted into pots, and grown in the greenhouse under the same environmental conditions for another three weeks.

[0285] Grow Agrobacterium transfected with each expression vector until they reach an OD of 0.6 to 1.6. 600 Before use, the Agrobacterium suspension was centrifuged and resuspended in infiltration medium (10 mM MgCl 2 and 10mM MES pH 5.6) and stored at 4°C overnight. On the day of infiltration, the culture batch was diluted to 2.5 culture volumes and allowed to warm up before use. Whole plants of Nicotiana benthamiana were placed upside down in the bacterial suspension in a stainless steel jar sealed airtight under vacuum for 2 minutes. The plants were returned to the greenhouse for a 6- to 9-day incubation period until harvest.

[0286] Leaf harvest and total protein and VLP extraction

[0287] After incubation, the aerial parts of the plants were harvested, frozen at -80°C and crushed into pieces. Total soluble protein was extracted by mechanical homogenization (Polytron) of each frozen crushed plant material sample in two volumes of cold 50 mM Tris buffer + 500 mM NaCl, pH 8.0, 0.4 μg / ml metabisulfite and 1 mM phenylmethylsulfonyl fluoride. After homogenization, the slurry was centrifuged at 10,000 g for 10 minutes at 4°C, and the clarified crude extracts (supernatants) were retained for analysis.

[0288] The percentage of complete S protein in plants was assessed on clarified crude extracts and analyzed using a capillary-based electrophoresis technique (Protein Simple, BioTechne) and a WES analysis system. Briefly, soluble proteins in crude extracts were separated by molecular weight in a capillary and immobilized on a matrix. Anti-S2 antibodies (Novus biological, cat# NB100-56578) were used for detection according to the manufacturer's instructions. For this method, the anti-S2 antibody recognizes two bands (the complete S protein and a smaller fragment). The complete S ratio was measured to assess the percentage of complete protein. Figure 3A , 3B , 6B and 7 describe the ratio of complete S protein in plants of coronavirus S protein and modified coronavirus S protein.

[0289] Electron microscopy

[0290] To determine whether the expressed S protein assembled into VLPs, the purified VLPs were subjected to transmission electron microscopy (TEM) observation of immune capture particles. A glow-discharged carbon / copper grid (10 sec, 0.3 mbar) was placed on 20 μL of purified VLPs (100 μg / mL) for 5 min and then washed 4 times with sterile distilled water. The grid was floated on 20 μL of 2% uranyl acetate for 1 min, and then the excess solution was removed by touching a moist filter paper and dried on the filter paper for 24 h before being observed under TEM (Tecnai microscope). TEM images of VLPs formed by coronavirus S protein and modified coronavirus S protein are shown in Figure 2. Figure 2A-2E and Figure 6C As shown, as further described in this application.

[0291] Example 3: Complete S protein evaluation

[0292] As described above, the percentage (%) of complete S protein in plants was assessed by capillary Western blotting with crude extracts, using antibodies to detect modified coronavirus S protein and quantified using a standard curve. As further described in this application, Figure 3A , 3B, 6B and 7 show the in planta ratio of full-length coronavirus S protein to cleaved coronavirus S protein of coronavirus S protein and modified coronavirus S protein ("purity" or "complete S protein (%)").

[0293] The purity (%) of the drug substance (DS) after small-scale clarification and purification to remove impurities was assessed by densitometry analysis of Coomassie-stained proteins on SDS gels, and immune-related products were included in the quantification and purity measurements. As further described in this application, Figure 4A and Figure 4B The drug substance (DS) purity (%) of coronavirus S protein and modified coronavirus S protein is shown.

[0294] Example 4: Stability evaluation of S protein

[0295] The modified S protein and unmodified S protein were extracted using enzyme extraction at pH 5.5 (Enz.pH5.5) or pH 6.1 (Enz.pH6.1) or mechanical extraction (Mech). Figure 5 ). For enzymatic digestion, diced fresh leaves were incubated in a plastic container with a pectinase mixture in 200 mM mannitol + 125 mM citrate + 500 mM NaCl + 25 mM EDTA + 0.04% (W / V) bisulfite (pH 6.2), and the pH was adjusted to 5.5 or maintained at 6.1 for 5.25 hours at 20°C. For mechanical extraction, diced fresh biomass was extracted in a blender using 2 volumes of the same buffer for two minutes and the pH was adjusted to 5.5. The extract was clarified using a 400 μm mesh and centrifuged at 4500 g for 15 minutes at 4°C. The clarified extract was then incubated at 20°C for 20 hours and the percentage of complete S protein was assessed before and after overnight incubation using the method described previously.

[0296] Example 5: Sequence

[0297] SEQ ID NO:1

[0298] Natural SARS-CoV-2 S protein wtTM / CT AA (P0DTC2)

[0299]

[0300] SEQ ID NO:2

[0301] Native SARS-CoV-2 S protein wtTM / CT AA without signal peptide (SP) (P0DTC2)

[0302]

[0303] SEQ ID NO:3

[0304] B CoV S(GSAS-2P)DNA

[0305]

[0306] SEQ ID NO:4

[0307] B CoV S(GSAS-2P)AA

[0308]

[0309] SEQ ID NO:5

[0310] C.37 CoV S(GSAS-2P)DNA

[0311]

[0312] SEQ ID NO:6

[0313] C.37 CoV S(GSAS-2P)AA

[0314]

[0315] SEQ ID NO:7

[0316] B CoV S(GSAS-2P+del246-252)DNA

[0317]

[0318] SEQ ID NO:8

[0319] B CoV S(GSAS-2P+del246-252)AA

[0320]

[0321] SEQ ID NO:9

[0322] B CoV S(GSAS-2P+D253N)DNA

[0323]

[0324] SEQ ID NO:10

[0325] B CoV S(GSAS-2P+D253N)AA

[0326]

[0327] SEQ ID NO:11

[0328] B CoV S(GSAS-2P+del246-252+D253N)DNA

[0329]

[0330] SEQ ID NO:12

[0331] B CoV S(GSAS-2P+del246-252+D253N)AA

[0332]

[0333] SEQ ID NO:13

[0334] B.1.617.2 CoV S(GSAS-2P)DNA

[0335]

[0336] SEQ ID NO:14

[0337] B.1.617.2 CoV S(GSAS-2P)AA

[0338]

[0339] SEQ ID NO:15

[0340] B.1.617.2 CoV S(GSAS-2P+D253N)DNA

[0341]

[0342] SEQ ID NO:16

[0343] B.1.617.2 CoV S(GSAS-2P+D253N)AA

[0344]

[0345] SEQ ID NO:17

[0346] B.1.1.529 CoV S(GSAS-2P)DNA

[0347]

[0348] SEQ ID NO:18

[0349] B.1.1.529 CoV S(GSAS-2P)AA

[0350]

[0351] SEQ ID NO:19

[0352] B.1.1.529 CoV S(GSAS-2P+D253N)DNA

[0353]

[0354] SEQ ID NO:20

[0355] B.1.1.529 CoV S(GSAS-2P+D253N)AA

[0356]

[0357] SEQ ID NO:21

[0358] From left to right T-DNA cloning vector 8716

[0359]

[0360] SEQ ID NO:22

[0361] Construct 9125 from 2X35S promoter to NOS terminator

[0362]

[0363] SEQ ID NO:23

[0364] IF(PDI)S-3-NY-CoV.c

[0365] TCTCAGATCTTCGCGTCCCAATGCGTGAATCTTACGACGCGAACACAGT

[0366] SEQ ID NO:24

[0367] IF(Avb)-H5I.r

[0368] acgacacgactaaggcctttaaatgcaaattctgcattgtaacgatcc

[0369] SEQ ID NO:25

[0370] Mature B CoV S(GSAS-2P+del246-252)AA without SP

[0371]

[0372] SEQ ID NO:26

[0373] SP-free mature B CoV S(GSAS-2P+D253N)AA

[0374]

[0375] SEQ ID NO:27

[0376] SP-free mature B CoV S(GSAS-2P+del246-252+D253N)AA

[0377]

[0378] SEQ ID NO:28

[0379] SP-free mature B CoV S(GSAS-2P+S13+G252N)AA

[0380]

[0381] SEQ ID NO:29

[0382] SP-free mature B CoV S(GSAS-2P+S13+P251N+D253T)AA

[0383]

[0384] SEQ ID NO:30

[0385] SP-free mature B CoV S (GSAS-2P+S13+Δ247-250) AA

[0386]

[0387] SEQ ID NO:31

[0388] SP-free mature B CoV S(GSAS-2P+S13+Δ248-251)AA x

[0389]

[0390] SEQ ID NO:32

[0391] SP-free mature B CoV S (GSAS-2P+S13+Δ249-252) AA

[0392]

[0393] SEQ ID NO:33

[0394] SP-free mature B CoV S (GSAS-2P+S13+Δ246-250) AA

[0395]

[0396] SEQ ID NO:34

[0397] SP-free mature B CoV S (GSAS-2P+S13+Δ247-251) AA

[0398]

[0399] SEQ ID NO:35

[0400] SP-free mature B CoV S (GSAS-2P+S13+Δ248-252) AA

[0401]

[0402] SEQ ID NO:36

[0403] SP-free mature B CoV S (GSAS-2P+S13+Δ246-251) AA

[0404]

[0405] SEQ ID NO:37

[0406] SP-free mature B CoV S (GSAS-2P+S13+Δ247-252) AA

[0407]

[0408] SEQ ID NO:38

[0409] B CoV S(GSAS-2P+S13+G252N)DNA

[0410]

[0411] SEQ ID NO:39

[0412] B CoV S(GSAS-2P+S13+G252N)AA

[0413]

[0414] SEQ ID NO:40

[0415] B CoV S(GSAS-2P+S13+P251N+D253T)DNA

[0416]

[0417] SEQ ID NO:41

[0418] B CoV S(GSAS-2P+S13+P251N+D253T)AA

[0419]

[0420] SEQ ID NO:42

[0421] B CoV S(GSAS-2P+S13+Δ247-250)DNA

[0422]

[0423] SEQ ID NO:43

[0424] B CoV S(GSAS-2P+S13+Δ247-250)AA

[0425]

[0426] SEQ ID NO:44

[0427] B CoV S(GSAS-2P+S13+Δ248-251)DNA

[0428]

[0429] SEQ ID NO:45

[0430] B CoV S(GSAS-2P+S13+Δ248-251)AA

[0431]

[0432] SEQ ID NO:46

[0433] B CoV S(GSAS-2P+S13+Δ249-252)DNA

[0434]

[0435] SEQ ID NO:47

[0436] B CoV S(GSAS-2P+S13+Δ249-252)AA

[0437]

[0438] SEQ ID NO:48

[0439] B CoV S(GSAS-2P+S13+Δ246-250)DNA

[0440]

[0441] SEQ ID NO:49

[0442] B CoV S(GSAS-2P+S13+Δ246-250)AA

[0443]

[0444] SEQ ID NO:50

[0445] B CoV S(GSAS-2P+S13+Δ247-251)DNA

[0446]

[0447] SEQ ID NO:51

[0448] B CoV S(GSAS-2P+S13+Δ247-251)AA

[0449]

[0450] SEQ ID NO:52

[0451] B CoV S(GSAS-2P+S13+Δ248-252)DNA

[0452]

[0453] SEQ ID NO:53

[0454] B CoV S(GSAS-2P+S13+Δ248-252)AA

[0455]

[0456] SEQ ID NO:54

[0457] B CoV S(GSAS-2P+S13+Δ246-251)DNA

[0458]

[0459] SEQ ID NO:55

[0460] B CoV S(GSAS-2P+S13+Δ246-251)AA

[0461]

[0462] SEQ ID NO:56

[0463] B CoV S(GSAS-2P+S13+Δ247-252)DNA

[0464]

[0465] SEQ ID NO:57

[0466] B CoV S(GSAS-2P+S13+Δ247-252)AA

[0467]

Claims

1. A modified coronavirus S protein, comprising one or more amino acid sequence modifications when compared to the corresponding parent amino acid sequence, in, The one or more modifications stabilize the modified coronavirus S protein, and wherein the one or more modifications include: i) substitution of one or more amino acids to introduce an N-glycosylation site at the position corresponding to position 251, 252 or 253 of the reference sequence SEQ ID NO: 1, wherein the N-glycosylation site is asparagine (N) in the consensus sequence NX-(S or T); or ii) a deletion of at least four consecutive amino acid residues, wherein the deletion includes at least the residues corresponding to positions 249 and 250 of the reference sequence SEQ ID NO:

1.

2. The modified coronavirus S protein according to claim 1, in, The modified coronavirus S protein comprising i) substitution of one or more amino acids to introduce the N-glycosylation site also comprises deletion of one or more amino acids.

3. The modified coronavirus S protein according to claim 1, in, The deletions include: i) the amino acid residues corresponding to at least positions 247, 248, 249 and 250 of the reference sequence SEQ ID NO: 1; ii) at least the amino acid residues corresponding to positions 248, 249, 250 and 251 of the reference sequence SEQ ID NO: 1; iii) amino acid residues corresponding to at least positions 249, 250, 251 and 252 of the reference sequence SEQ ID NO: 1; iv) the amino acid residues corresponding to at least positions 246, 247, 248, 249 and 250 of the reference sequence SEQ ID NO: 1; v) the amino acid residues corresponding to at least positions 247, 248, 249, 250 and 251 of the reference sequence SEQ ID NO: 1; vi) the amino acid residues corresponding to at least positions 248, 249, 250, 251 and 252 of the reference sequence SEQ ID NO: 1; vii) amino acid residues corresponding to at least positions 246, 247, 248, 249, 250 and 251 of the reference sequence SEQ ID NO: 1; viii) the amino acid residues corresponding to at least positions 247, 248, 249, 250, 251 and 252 of the reference sequence SEQ ID NO: 1; or ix) the amino acid residues corresponding to at least positions 246, 247, 248, 249, 250, 251 and 252 of the reference sequence SEQ ID NO:

1.

4. The modified coronavirus S protein according to claim 2, in, i) the N-glycosylation site is introduced at the amino acid corresponding to position 251 of the reference sequence SEQ ID NO: 1, and the deletion comprises at least the amino acid residues corresponding to positions 249 and 250 of the reference sequence SEQ ID NO: 1; ii) the N-glycosylation site is introduced at the amino acid corresponding to position 252 of the reference sequence SEQ ID NO: 1, and the deletion comprises at least the amino acid residues corresponding to positions 249 and 250 of the reference sequence SEQ ID NO: 1; iii) the N-glycosylation site is introduced at the amino acid corresponding to position 253 of the reference sequence SEQ ID NO: 1, and the deletion comprises at least the amino acid residues corresponding to positions 249 and 250 of the reference sequence SEQ ID NO: 1; iv) the N-glycosylation site is introduced at the amino acid corresponding to position 253 of the reference sequence SEQ ID NO: 1, and the deletion comprises at least four consecutive amino acid residues, wherein the deletion comprises at least the residues corresponding to positions 249 and 250 of the reference sequence SEQ ID NO: 1; v) the N-glycosylation site is introduced at the amino acid corresponding to position 253 of the reference sequence SEQ ID NO: 1, and the deletion comprises at least the amino acid residues corresponding to positions 246, 247, 248, 249, 250, 251 and 252 of the reference sequence SEQ ID NO:

1.

5. The modified coronavirus S protein according to claim 1, in, The amino acid sequence modification includes replacement of asparagine (N) at a position corresponding to position 252 or 253 of the reference sequence SEQ ID NO: 1, or the amino acid sequence modification includes replacement of asparagine (N) at a position corresponding to position 251 of the reference sequence SEQ ID NO: 1 and replacement of threonine (T) at a position corresponding to position 253.

6. The modified coronavirus S protein according to claim 1, in, The modified coronavirus S protein comprises 80% to 100% identity to the sequence of SEQ ID NO:8, 10, 12, 16, 20, 39, 41, 43, 45, 47, 49, 51, 53, 55 or 57.

7. The modified coronavirus S protein according to claim 1, in, The modified coronavirus S protein is a chimeric S protein, wherein the chimeric S protein comprises a cytoplasmic tail region derived from influenza virus hemagglutinin.

8. The modified coronavirus S protein according to any one of claims 1 to 7, in, The parent amino acid sequence is derived from a beta coronavirus.

9. The modified coronavirus S protein according to claim 8, in, The beta coronavirus is from lineage A, B, C or D of the beta coronavirus.

10. The modified coronavirus S protein according to any one of claims 1 to 9, in, The modified coronavirus S protein contains plant-specific N-glycans.

11. A nucleic acid comprising a nucleotide sequence encoding the modified coronavirus S protein according to any one of claims 1 to 9.

12. A virus-like particle (VLP) comprising the modified coronavirus S protein of any one of claims 1-10.

13. The VLP according to claim 12, in, The VLPs also include plant lipids.

14. A composition comprising an effective dose of the modified coronavirus S protein according to any one of claims 1 to 10 or the VLP according to claim 12 or 13 and a pharmaceutically acceptable carrier, solvent or excipient.

15. A vaccine for inducing an immune response, the vaccine comprising an effective dose of the modified coronavirus S protein of any one of claims 1-10 or the VLP of claim 12 or 13, or the composition of claim 14.

16. The vaccine according to claim 15, further comprising an adjuvant.

17. The vaccine according to claim 15 or 16, in, The vaccine is a multivalent vaccine comprising a mixture of VLPs.

18. A method of inducing immunity to coronavirus infection in a subject, the method comprising administering to the subject the composition of claim 14 or the vaccine of any one of claims 15-17.

19. Use of the composition according to claim 14 or the vaccine according to any one of claims 15-17 for inducing immunity to coronavirus infection in a subject.

20. An antibody or antibody fragment prepared using the composition of claim 14 or the vaccine of any one of claims 15-17.

21. A host or host cell comprising the modified coronavirus S protein of any one of claims 1-10, the nucleic acid of claim 11, or the VLP of claim 12 or 13.

22. A method for producing a modified coronavirus S protein in a host or host cell, include: a) introducing the nucleic acid of claim 11 into the host or host cell, or providing the host or host cell comprising the nucleic acid of claim 11, and b) incubating the host or host cell under conditions allowing expression of the nucleic acid, thereby producing the modified coronavirus S protein.

23. The method according to claim 22, in, The modified coronavirus S protein is further extracted and purified from the host or host cell.

24. A method for producing virus-like particles (VLPs) in a host or host cell, include: a) introducing the nucleic acid of claim 11 into the host or host cell, or providing the host or host cell comprising the nucleic acid of claim 11, and b) incubating the host or host cell under conditions allowing expression of the nucleic acid, thereby producing the VLP.

25. The method according to claim 24, in, The VLP is further extracted and purified from the host or host cell.

26. A VLP produced by the method of claim 24 or 25.

27. A method for increasing the yield of full-length coronavirus S protein in a host or host cell by modifying the parent coronavirus S protein, the method include: a) introducing the nucleic acid of claim 11 into the host or host cell, or providing the host or host cell comprising the nucleic acid of claim 11, and b) incubating the host or host cell under conditions that allow expression of the nucleic acid, thereby producing a modified coronavirus S protein, wherein a higher amount or a higher proportion of the modified coronavirus S protein is a full-length modified coronavirus S protein compared to the parent coronavirus S protein produced in the host or host cell under similar conditions.

28. The method according to claim 27, in, The modified coronavirus S protein is further extracted and purified from the host or host cell.

29. A method for producing a modified coronavirus S protein having increased stability against proteolysis in a host or host cell, the method include: a) introducing the nucleic acid of claim 11 into the host or host cell, or providing the host or host cell comprising the nucleic acid of claim 11, and b) incubating the host or host cell under conditions that allow expression of the nucleic acid, thereby producing the modified coronavirus S protein, wherein the anti-proteolytic stability of the modified coronavirus S protein is improved compared to the anti-proteolytic stability of the parent S protein produced in the host or host cell under similar conditions.

30. The method according to claim 29, in, The modified coronavirus S protein is further extracted and purified from the host or host cell.

31. A method for modifying a coronavirus S protein to produce a coronavirus S protein having one or more amino acid sequence modifications, in, The one or more than one amino acid modification stabilizes the modified coronavirus S protein, and the method comprises: i) introducing one or more amino acid substitutions into the coronavirus S protein to introduce an N-glycosylation site at a position corresponding to position 251, 252 or 253 of the reference sequence SEQ ID NO: 1, wherein the N-glycosylation site is asparagine (N) in the consensus sequence NX-(S or T); or ii) introducing a deletion of at least four consecutive amino acid residues into the coronavirus S protein, wherein the deletion includes at least the residues corresponding to positions 249 and 250 of the reference sequence SEQ ID NO: 1, thereby modifying the coronavirus S protein.

32. A modified coronavirus S protein prepared by the method of any one of claims 22, 23 and 27-31.

33. A VLP comprising the modified coronavirus S protein of claim 32.

Images