A PTK7-targeted nucleic acid aptamer conjugate drug and its new application
By coupling with the drug at the 3 ends of the PTK7-targeted nucleic acid aptamer, PTK7-targeted nucleic acid aptamer coupled drug SM was constructed, which solved the problem of insufficient stability and efficacy of anti-tumor drugs in the prior art, and achieved efficient inhibitory effect on a variety of tumors.
Patent Information
- Application Number
- CN202411662863.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-20
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2044-11-20
AI Technical Summary
The prior art lacks efficient anti-tumor nucleic acid aptamer-conjugated drugs when treating tumors such as non-small cell lung cancer and colorectal cancer, and the stability and efficacy of the existing drugs are insufficient.
By coupling to the drug at the 3 end of the targeted PTK7 nucleic acid aptamer, a covalent coupling reaction of thiol-maleimide was used to construct a PTK7-targeted nucleic acid aptamer-coated drug SM with a significant improvement in anti-tumor effect.
It significantly improves the blood stability and anti-tumor effect of the drug, has a 100% inhibitory rate on a variety of malignant tumors such as breast cancer and pancreatic cancer, and provides a more efficient anti-tumor treatment plan.
Smart Images

Figure CN119139485B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and specifically relates to a PTK7-targeted nucleic acid aptamer conjugate drug and its new application. Background Art
[0002] PTK7, Protein tyrosine kinase 7, is a receptor tyrosine kinase in the Wnt pathway and is involved in Wnt signal transduction during hematopoiesis, somatic progenitor cells, and stem cell development. It is overexpressed in various tumor types, including advanced triple-negative breast cancer, non-small cell lung cancer, ovarian cancer, colorectal cancer, gastric cancer, and esophageal cancer, etc. In addition, PTK7 expression is associated with lymph node metastasis and is highly expressed in tumor-initiating cells (TICs) or cancer stem cells (CSCs) and stromal cells that are closely related to tumor recurrence and progression. Developing targeted drugs targeting PTK7 is expected to overcome the problem of limited efficacy of drugs for malignant tumors such as triple-negative breast cancer and non-small cell lung cancer. For example, Chinese Patent Application Publication No. CN 113491773 A discloses an artemisinin derivative nucleic acid aptamer-drug conjugate, its preparation method and use. By conjugating a PTK7-targeted nucleic acid aptamer with the drug molecules combretastatin and artemisinin to construct a PTK7-targeted nucleic acid aptamer conjugate drug, effective inhibition of PTK7-highly expressed cells and tumors is achieved. Although existing nucleic acid aptamer conjugate drugs show certain anti-tumor efficacy in the treatment of individual tumors, there is still a lack of highly effective anti-tumor nucleic acid aptamer conjugate drugs for tumors such as non-small cell lung cancer and colorectal cancer. Therefore, there is an urgent need to develop a PTK7-targeted nucleic acid aptamer conjugate drug with higher stability and better efficacy and fully verify its anti-tumor potency. Summary of the Invention
[0003] To solve the above problems, the present invention provides a PTK7-targeted nucleic acid aptamer conjugate drug and its application. By studying the conjugation of drugs at the 3'-end and 5'-end of the PTK7-targeted nucleic acid aptamer respectively, it is found that there are obvious differences in the stability and efficacy of the constructed drugs. For the PTK7 target, the most preferred nucleic acid aptamer and the most preferred drug are found, and the most suitable linker is selected. Based on the covalent coupling reaction of thiol-maleimide, the PTK7-targeted nucleic acid aptamer conjugate drug SM that can significantly improve the anti-tumor effect is constructed, providing a new direction for screening more efficient anti-tumor drugs.
[0004] On the one hand, the present invention provides a nucleic acid aptamer conjugate drug targeting PTK7, and the nucleic acid aptamer conjugate drug includes a nucleic acid aptamer targeting PTK7 and a drug containing a linker, and the drug containing the linker is conjugated to the 3'-end of the nucleic acid aptamer.
[0005] The present invention deeply explores the specific preparation process and structure of nucleic acid aptamer-conjugated drugs targeting PTK7, hoping to start from more details to construct safer and more effective anti-tumor drugs. By conjugating drugs to the 5'-end and 3'-end of the nucleic acid aptamer targeting PTK7 respectively and comparing the plasma stability of the constructed nucleic acid aptamer-conjugated drugs, it is found that the drug conjugated to the 3'-end of the nucleic acid aptamer targeting PTK7 has better stability during long-term incubation in plasma and is not easily degraded. Therefore, it can be used to prepare more potential anti-tumor drugs.
[0006] Further, the nucleic acid aptamer targeting PTK7 has the sequence shown in SEQ ID No.1 in the sequence listing.
[0007] By screening more suitable nucleic acid aptamers targeting PTK7 for constructing nucleic acid aptamer-conjugated drugs, it helps to improve their affinity with the target, thereby enhancing the targeting effect.
[0008] Further, the drug is the auristatin-based tubulin inhibitor MMAE.
[0009] Compared with other drugs, the drug constructed by conjugating MMAE with the nucleic acid aptamer targeting PTK7 has a better tumor inhibitory effect.
[0010] However, MMAE can only be conjugated to the 3'-end of the nucleic acid aptamer to obtain a highly stable drug. When conjugated to the 5'-end, the stability is not ideal and the anti-tumor efficacy cannot be fully exerted. Through in-depth research on the nucleic acid aptamer-conjugated drug constructed by MMAE, the present invention finally successfully obtains the nucleic acid aptamer-conjugated drug SM with high stability, superior targeting effect, and significantly stronger anti-tumor effect, enabling the full exertion of the efficacy of MMAE and fully exploring its anti-tumor potential.
[0011] Further, the linker is a Vc linker, and the drug containing the linker has the following structural formula:
[0012] .
[0013] Further, the nucleic acid aptamer targeting PTK7 and the drug containing the linker are prepared by a covalent coupling reaction based on thiol-maleimide.
[0014] Further, the structural formula of the nucleic acid aptamer-conjugated drug targeting PTK7 is as follows:
[0015]
[0016] The belt with a thiol group is the nucleic acid aptamer targeting PTK7.
[0017] On the other hand, the present invention provides the use of a nucleic acid aptamer-conjugated drug targeting PTK7 for preparing a reagent for improving plasma stability. The nucleic acid aptamer-conjugated drug comprises a nucleic acid aptamer targeting PTK7 and a linker-containing drug, and the linker-containing drug is conjugated to the 3'-end of the nucleic acid aptamer.
[0018] Research has shown that for the nucleic acid aptamer-conjugated drug targeting PTK7, when the drug is conjugated to the 3'-end of the nucleic acid aptamer, compared with when the drug is conjugated to the 5'-end of the nucleic acid aptamer, the amount of nucleic acid cleavage in plasma is significantly increased. The higher the amount of nucleic acid cleavage, the less likely it is to break, that is to say, conjugating the drug to the 3'-end of the nucleic acid aptamer can significantly improve stability.
[0019] Furthermore, the nucleic acid aptamer is Sgc8, which has the sequence shown in SEQ ID No.1 in the sequence listing; the drug is the auristatin-based tubulin inhibitor MMAE, and the linker is the Vc linker.
[0020] On the other hand, the present invention provides the use of a nucleic acid aptamer-conjugated drug targeting PTK7 for preparing a reagent for improving the tumor suppression effect. The nucleic acid aptamer-conjugated drug comprises a nucleic acid aptamer targeting PTK7 and a linker-containing drug, and the linker-containing drug is conjugated to the 3'-end of the nucleic acid aptamer.
[0021] Furthermore, the nucleic acid aptamer targeting PTK7 has the sequence shown in SEQ ID No.1 in the sequence listing; the drug is an auristatin-based tubulin inhibitor; the tumors include any one or more of colorectal cancer, lung cancer, ovarian cancer, breast cancer, and pancreatic cancer.
[0022] In some embodiments, the auristatin-based tubulin inhibitor is MMAE, and the linker is the Vc linker.
[0023] As mentioned above, the drug SM conjugated to the 3'-end of the nucleic acid aptamer targeting PTK7 has better stability in plasma during long-term incubation and is not easily degraded. Therefore, theoretically, when delivering the drug conjugated to the 3'-end of the nucleic acid aptamer targeting PTK7 in animals, its anti-tumor effect may be better than that of the drug MS conjugated to the 5'-end of the nucleic acid aptamer targeting PTK7. However, good drug stability does not necessarily mean high anti-tumor activity. Whether the anti-tumor activity can be improved depends crucially on whether the structure of the nucleic acid aptamer-conjugated drug itself promotes the drug activity.
[0024] The present invention has been proven by a large number of studies that for most tumor cells, compared with the drug MS conjugated to the 5'-end of the nucleic acid aptamer, the anti-tumor activity of the drug SM conjugated to the 3'-end of the nucleic acid aptamer is significantly improved. The reason may be that when the nucleic acid aptamer targeting PTK7 is conjugated to the 3'-end, its conformation is more conducive to the anti-cancer activity of the MMAE drug.
[0025] However, for different tumor cells, there are significant differences in the anti-cancer activities of the aptamer-conjugated drugs. The present invention verified the inhibitory effects of the drugs conjugated to the 3'-end or 5'-end of the aptamer targeting PTK7 in a variety of different tumors. It was found that for some tumor cells, such as pancreatic cancer, lung cancer, breast cancer, colon cancer, ovarian cancer and other tumor cells, the inhibitory effect of the drug conjugated to the 3'-end of the aptamer targeting PTK7 was significantly better than that of the drug conjugated to the 5'-end. Among them, the most obvious effects were observed in breast cancer and pancreatic cancer cells, and the drug conjugated to the 3'-end could achieve an almost 100% inhibition rate. However, in some tumor cells, such as soft tissue sarcoma and bladder cancer Scaber cells, when the drug conjugated to the 3'-end of the aptamer targeting PTK7 was compared with the drug conjugated to the 5'-end, the difference in inhibitory effect was not obvious. In osteosarcoma, thymoma, and central neurocytoma cells, the drug conjugated to the 3'-end of the aptamer targeting PTK7 was even slightly worse than the drug conjugated to the 5'-end. This also shows that it is not the case that the higher the stability, the better the tumor inhibitory effect. Instead, it is necessary to analyze different tumor cells separately.
[0026] It can be understood that the aptamer-conjugated drug is related to the tumor inhibitory activity in the following four aspects: 1. The sequence of the aptamer; 2. The drug conjugated to the aptamer; 3. The linker; 4. The conjugation method. These four aspects complement each other and exert their effects comprehensively to improve the anti-tumor effect.
[0027] First, in terms of the aptamer sequence, the binding receptors of different tumor cells are different, resulting in different binding strengths of aptamers. The targeting ability of the same aptamer sequence may be stronger in some tumor cells, but weaker in other cells. Therefore, it is necessary to design aptamers with specific sequences for different tumor cells to conjugate drugs. However, aptamers with stronger targeting effects do not necessarily lead to higher tumor suppression activities. It is necessary to comprehensively consider whether the conformation of the aptamer is optimized after conjugating the drug to effectively release the drug activity. Secondly, in terms of drug selection, the inhibitory activities of different drugs on different tumor cells are different. Some drugs have significant effects on specific tumor cells, but are weaker on other cells. Therefore, it is necessary to select suitable drugs for various tumor cells. In addition, when the drug is conjugated with the aptamer, the influence of the conjugation method on the conformation and its effect on the drug efficacy need to be considered, including whether the spatial structure changes brought by different linkers will affect the drug activity. The linker plays a crucial role in this process, and its spatial conformation, affinity and conjugation effect can all affect the drug efficacy. Selecting different linkers will significantly change the drug efficacy performance. Finally, the choice of the conjugation method is also crucial, that is, whether the aptamer is conjugated with the drug at its 5'-end or 3'-end. The conjugation method can affect the sequence stability and targeting effect of the aptamer, and also has an important impact on the release of drug activity. In summary, it is necessary to comprehensively consider four aspects: aptamer, linker, drug and conjugation method, and select a suitable combination for specific tumor cells, so as to develop an aptamer-conjugated drug that can effectively inhibit the tumor cells and improve the anti-tumor efficacy.
[0028] Furthermore, the tumors include lung cancer, breast cancer and pancreatic cancer.
[0029] In some ways, especially for pancreatic cancer, breast cancer, etc., the aptamer conjugated with the drug SM at the 3'-end constructed by the present invention can achieve a tumor inhibition rate of even 100% for these pancreatic cancers, breast cancers, etc., significantly improving the curative effect and having great potential. The reason may be that the aptamer targeting PTK7 (SEQ ID No.1) conjugated with the drug MMAE at the 3'-end and the linker being the Vc linker, the constructed drug SM is particularly suitable for the treatment of pancreatic cancer and breast cancer.
[0030] On the other hand, the present invention provides the use of an aptamer-conjugated drug targeting PTK7 for preparing a reagent for improving the tumor suppression effect. The aptamer-conjugated drug includes an aptamer targeting PTK7 and a drug containing a linker. The drug containing a linker is conjugated with the 5'-end of the aptamer. The aptamer targeting PTK7 has the sequence shown in SEQ ID No.1 in the sequence listing; the drug is the auristatin-based microtubule inhibitor MMAE, and the linker is the Vc linker; the tumors include any one or more of osteosarcoma, thymoma, and central neurocytoma.
[0031] Research has shown that for osteosarcoma, thymic carcinoma, and central neurocytoma, when using the nucleic acid aptamer targeting PTK7 (SEQ ID No.1) and conjugating the drug MMAE at the 5'-end with the Vc linker, the constructed drug MS can significantly improve the inhibitory effect on ovarian cancer cells. Therefore, it is recommended for the treatment of osteosarcoma, thymic carcinoma, and central neurocytoma.
[0032] Furthermore, the structural formula of the drug conjugated to the 5'-end of the nucleic acid aptamer is as follows:
[0033]
[0034] On the other hand, the present invention provides the use of sgc8c for preparing a reagent for improving the targeting property of a nucleic acid aptamer-conjugated drug targeting PTK7, and the sgc8c has the sequence shown in SEQ ID No.1 in the sequence listing.
[0035] Research has shown that compared with other nucleic acid aptamers, the nucleic acid aptamer-conjugated drug targeting PTK7 prepared using sgc8c has better affinity with the target protein and more obvious targeting effect, thus improving the anti-tumor effect.
[0036] On the other hand, the present invention provides the use of MMAE with a Vc linker for preparing a reagent for improving the efficacy of a nucleic acid aptamer-conjugated drug targeting PTK7, and the drug containing the Vc linker has the structural formula shown below:
[0037] 。
[0038] Compared with other linkers, the PTK7-targeted nucleic acid aptamer-conjugated drug constructed using the Vc linker has better anti-tumor efficacy.
[0039] The present invention has the following beneficial effects:
[0040] (1) It is found that conjugating the drug at the 3'-end of the PTK7-targeted nucleic acid aptamer can significantly improve its blood stability compared with conjugating the drug at the 5'-end;
[0041] (2) Different PTK7-targeted nucleic acid aptamers are screened, and it is found that sgc8c can significantly improve the targeting effect compared with other nucleic acid aptamers, so the nucleic acid aptamer-conjugated drug constructed can also significantly improve the efficacy;
[0042] (3) The differences in constructing SM with different linkers are compared to further improve the anti-tumor efficacy;
[0043] (4) A PTK7-targeted nucleic acid aptamer-conjugated drug that can significantly improve the anti-tumor effect is constructed, which can inhibit a variety of malignant tumors. BRIEF DESCRIPTION OF THE DRAWINGS
[0044] Figure 1 Mass spectrum of SM prepared in Example 1;
[0045] Figure 2 Mass spectrum of MS prepared in Example 2;
[0046] Figure 3 Mass spectrum of SD prepared in Example 3;
[0047] Figure 4 Schematic diagram of the detection results of nucleic acid cleavage amounts of SM and MS incubated in vitro in mouse plasma at different time points in Example 4;
[0048] Figure 5 Schematic diagram of the detection results of the affinity of SM with human PTK7 protein in Example 5;
[0049] Figure 6 Schematic diagram of the detection results of the affinity of JHG35-2AM with human PTK7 protein in Example 5;
[0050] Figure 7 Schematic diagram of the detection results of the affinity of CJH-C4M with human PTK7 protein in Example 5;
[0051] Figure 8 Schematic diagram of the comparison results of the cytotoxicity of SM and SD in Example 6;
[0052] Figure 9 Schematic diagram of the inhibitory results of SM on the proliferation of HT-29 cells in Example 7;
[0053] Figure 10 Schematic diagram of the inhibitory results of SM on the proliferation of NCI-H1975 cells in Example 7;
[0054] Figure 11 Schematic diagram of the inhibitory results of SM on the proliferation of SKOV3 cells in Example 7;
[0055] Figure 12 Schematic diagram of the inhibitory results of SM on the proliferation of SUM159 cells in Example 7;
[0056] Figure 13 Schematic diagram of the inhibitory effect of SM on the tumor volume of HT-29 in Example 8;
[0057] Figure 14 Schematic diagram of the inhibitory effect of SM on the tumor volume ratio of HT-29 in Example 8;
[0058] Figure 15 Schematic diagram of the effect of SM on the body weight of mice in Example 8;
[0059] Figure 16 Schematic diagram of the effect of SM on the body weight ratio of mice in Example 8;
[0060] Figure 17 Schematic diagram of the inhibitory effect of SM on the tumor volume of human lung cancer NCI-H1975 in Example 9;
[0061] Figure 18 Schematic diagram of the inhibitory effect of SM on the tumor volume ratio of human lung cancer NCI-H1975 in Example 9;
[0062] Figure 19 Schematic diagram of the effect of SM on the body weight of mice in Example 9;
[0063] Figure 20 Schematic diagram of the effect of SM on the body weight ratio of mice in Example 9;
[0064] Figure 21 Schematic diagram of the inhibitory effect of SM on the tumor volume of human ovarian cancer SKOV3 in Example 10;
[0065] Figure 22 Schematic diagram of the inhibitory effect of SM on the tumor volume ratio of human ovarian cancer SKOV3 in Example 10;
[0066] Figure 23 Schematic diagram of the effect of SM on the body weight of mice in Example 10;
[0067] Figure 24 Schematic diagram of the effect of SM on the body weight ratio of mice in Example 10;
[0068] Figure 25 Schematic diagram of the inhibitory effect of SM on the tumor volume of human breast cancer SUM159 in Example 11;
[0069] Figure 26 Schematic diagram of the inhibitory effect of SM on the tumor volume ratio of human breast cancer SUM159 in Example 11;
[0070] Figure 27 Schematic diagram of the effect of SM on the body weight of mice in Example 11;
[0071] Figure 28 Schematic diagram of the effect of SM on the body weight ratio of mice in Example 11;
[0072] Figure 29 Schematic diagram of the inhibitory effect of SM on the tumor volume of human pancreatic cancer MIA PaCa-2 in Example 12;
[0073] Figure 30 Schematic diagram of the inhibitory effect of SM on the tumor volume ratio of human pancreatic cancer MIA PaCa-2 in Example 12;
[0074] Figure 31 Schematic diagram of the effect on the body weight of mice in Example 12;
[0075] Figure 32 Schematic diagram of the effect on the body weight ratio of mice in Example 12;
[0076] Figure 33 Schematic diagram of the inhibitory effect of SM on the tumor volume of human lung cancer A549 in Example 13;
[0077] Figure 34 Schematic diagram of the inhibitory effect of SM on the tumor volume ratio of human lung cancer A549 in Example 13;
[0078] Figure 35 Schematic diagram of the effect on the body weight of mice in Example 13;
[0079] Figure 36 Schematic diagram of the effect on the body weight ratio of mice in Example 13;
[0080] Figure 37 Schematic diagram of the inhibitory effect of SM on the tumor volume of pancreatic cancer PDX in Example 14;
[0081] Figure 38 Schematic diagram of the inhibitory effect of SM on the tumor volume ratio of pancreatic cancer PDX in Example 14;
[0082] Figure 39 Schematic diagram of the effect on the body weight of mice in Example 14;
[0083] Figure 40 Schematic diagram of the effect on the body weight ratio of mice in Example 14;
[0084] Figure 41 Schematic diagram of the inhibitory effect of SM on the tumor volume of breast cancer MDA-MB-468 in Example 15;
[0085] Figure 42 Schematic diagram of the inhibitory effect of SM on the tumor volume ratio of breast cancer MDA-MB-468 in Example 15;
[0086] Figure 43 Schematic diagram of the effect on the body weight of mice in Example 15;
[0087] Figure 44 Schematic diagram of the effect on the body weight ratio of mice in Example 15;
[0088] Figure 45 Schematic diagram of the inhibitory effect of SM on the tumor volume of ovarian cancer OVCAR3 in Example 16;
[0089] Figure 46Schematic diagram of the inhibitory effect of SM on the tumor volume ratio of ovarian cancer OVCAR3 in Example 16;
[0090] Figure 47 Schematic diagram of the effect of SM on the body weight of mice in Example 16;
[0091] Figure 48 Schematic diagram of the effect of SM on the body weight ratio of mice in Example 16;
[0092] Figure 49 Schematic diagram of the inhibitory effect of SM on the tumor volume of pancreatic cancer BxPC3 in Example 17;
[0093] Figure 50 Schematic diagram of the inhibitory effect of SM on the tumor volume ratio of pancreatic cancer BxPC3 in Example 17;
[0094] Figure 51 Schematic diagram of the effect of SM on the body weight of mice in Example 17;
[0095] Figure 52 Schematic diagram of the effect of SM on the body weight ratio of mice in Example 17;
[0096] Figure 53 Schematic diagram of the inhibitory effect of SE on the tumor volume of colorectal cancer HT-29 in Example 21;
[0097] Figure 54 Schematic diagram of the inhibitory effect of SE on the tumor volume ratio of colorectal cancer HT-29 in Example 21;
[0098] Figure 55 Schematic diagram of the effect of SE on the body weight of mice in Example 21;
[0099] Figure 56 Schematic diagram of the effect of SE on the body weight ratio of mice in Example 21;
[0100] Figure 57 Schematic diagram of the tumor inhibitory effect of SM on the bladder perfusion treatment of Scaber tumor in Example 22. Detailed implementation mode
[0101] The present invention will be further described in detail below with reference to the drawings and embodiments. It should be noted that the following embodiments are intended to facilitate the understanding of the present invention and do not limit it in any way.
[0102] Example 1. Preparation of the PTK7-targeted nucleic acid aptamer conjugated with the drug SM at the 3'-end
[0103] In this example, a PTK7 (sgc8c, publicly disclosed sequence) nucleic acid aptamer-conjugated drug SM conjugated with a 3-terminal VcMMAE (MMAE drug with a Vc linker) drug was prepared. The thiol-maleimide chemical reaction was used to synthesize SM, and the reaction formula is as follows:
[0104]
[0105] Among them, the thiol-bearing strip is a nucleic acid aptamer, and DMTr is a dimethoxytrityl protecting group.
[0106] The preparation process is as follows:
[0107] (1) Preparation of an aqueous solution of a thiol-modified PTK7 nucleic acid aptamer:
[0108] First, compound a in the above reaction formula needs to be synthesized. Compound a is directly synthesized in a solid-phase synthesizer (K&A H8), and its synthesis reaction formula is as follows (the synthesis process of compound a is a conventional technical means in the art):
[0109]
[0110] A controlled-pore glass bead with thiol modification (Controlled-pore glass, 3’thiol S-S CPG) was selected as the solid-phase carrier for the synthesis reaction. During this reaction process, strict water and oxygen removal of the synthesis reagents are required. The nucleic acid sequence (sgc8c: 5’-3’: ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA) (SEQ ID No.1) was input into the control software of the solid-phase synthesizer, and the bases were coupled in sequence from 3’ to 5’ to finally obtain the target oligonucleotide chain.
[0111] After the synthesis is completed, the solid-phase carrier part (compound a) is rinsed with acetonitrile and dried, and 30% concentrated ammonia water is used for ammonolysis treatment to remove the protecting group on the oligonucleotide chain and hydrolyze and shed from the carrier. After the heat treatment is completed, the reaction solution is cooled, and 10% volume of 3 M sodium chloride solution is added according to the volume of the added ammonia water. After mixing evenly, anhydrous ethanol is added in an amount 2.5 times the volume of the added ammonia water. After mixing evenly again, white flocculent precipitates are produced, which is the crude product obtained by synthesis. The supernatant is removed by centrifugation and dried as much as possible, and then pure water is added for re-dissolution. After filtration, the crude product is obtained and purified by HPLC, and the corresponding fractions are collected. It is treated with a 40% aqueous acetic acid solution to remove the DMT protecting group and expose the 5’-terminal hydroxyl group to obtain compound I.
[0112] At this time, the sulfhydryl group of the aptamer product is protected by a disulfide bond, and 20-fold equivalent of TCEP is used for reduction. After desalting to remove small molecules, an aqueous solution of the PTK7 aptamer modified with a sulfhydryl group at the 3'-end (Compound II) is obtained.
[0113] (2) Preparation of aptamer-conjugated drug SM:
[0114]
[0115] Add an aqueous solution of the PTK7 aptamer modified with a sulfhydryl group at the 3'-end (1 equivalent) to a centrifuge tube, and add a mixed solution of the auristatin tubulin inhibitor VcMMAE (CAS: 646502-53-6, purchased from Shanghai Haoyuan Biomedical Technology Co., Ltd.) with a Vc linker in acetonitrile / water (1 / 5 - 3 / 1, preferably 1 / 1) (2 - 30 equivalents, preferably 3 equivalents). Keep the temperature at 4 - 40 °C, preferably 25 °C, and stir for 2 - 24 hours, preferably 12 hours. Purify by a reverse-phase preparative column and freeze-dry to obtain the PTK7 aptamer-conjugated drug SM (Sgc8c-MMAE) conjugated with MMAE at the 3'-end. The yield is about 75%. After desalting, it is freeze-dried for standby. The mass spectrum is as Figure 1 shown, SM: Calculated: 14147.1 (Found: 14147).
[0116] In this example, different aptamers targeting PTK7, JHG35-2A (ATAACGGATTGCCACGCCGCCGGGTTTTCTTCGTACGGGTCGTTAT, SEQ ID No.2) and CJH-C4 (GTTCGTGGTGTGCTGGATGTCCCGGGGGGGGCTTGTCGGTTTTCCAGGGGTGGGAGTGACACATCCAGCAGCACGA, SEQ ID No.3), were also used. According to the same method provided in this example, VcMMAE was conjugated at the 3'-end to construct JHG35-2AM and CJH-C4M, and they were successfully prepared and verified by mass spectrometry.
[0117] Example 2. Preparation of PTK7-targeted aptamer conjugated with drug MS at the 5'-end
[0118] In this example, a PTK7 (sgc8c: ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA) aptamer-conjugated drug MS conjugated with VcMMAE at the 5'-end was prepared. The MS was synthesized by a sulfhydryl maleimide chemical reaction, and the reaction formula is as follows:
[0119]
[0120] Among them, the thiol-bearing strip is an aptamer, and DMTr is a dimethoxytrityl protecting group. is a solid-phase carrier.
[0121] The preparation process is as follows:
[0122] (1)Preparation of an aqueous solution of a PTK7 aptamer modified with a thiol group:
[0123] Controlled-pore glass (CPG) was selected as the solid-phase carrier for the synthesis reaction, and strict water and oxygen removal of the synthesis reagents were required during this reaction process. The nucleic acid sequence (sgc8c: 5'-3': ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA) (SEQ ID No.1) was input into the control software of the solid-phase synthesizer, and the bases were coupled in sequence from 3' to 5', and a thiol phosphoramidite monomer modification was introduced at the 5' end, and finally the target oligonucleotide chain was obtained. After the synthesis was completed, the solid-phase carrier part was rinsed with acetonitrile and dried, and then treated with 30% concentrated ammonia water for ammonolysis to remove the protecting groups on the oligonucleotide chain and hydrolyze and fall off from the carrier. After the heat treatment was completed, the reaction solution was cooled, and 10% volume of 3 M sodium chloride solution was added according to the volume of the added ammonia water. After mixing evenly, anhydrous ethanol was added 2.5 times the volume of the added ammonia water. After mixing evenly again, white flocculent precipitates were generated at this time, which was the crude product obtained by synthesis. The supernatant was removed by centrifugation and dried as much as possible, and then dissolved in pure water, filtered to obtain the crude product, and purified by HPLC, and the corresponding fractions were collected. At this time, the thiol group of the aptamer product was protected by a disulfide bond, and 20-fold equivalent TCEP was used for reduction, and then desalted to remove small molecules to obtain an aqueous solution of the PTK7 aptamer modified with a thiol group at the 5' end.
[0124] (2)Preparation of an aptamer-conjugated drug MS:
[0125] An aqueous solution of the PTK7 aptamer modified with a thiol group at the 5' end (1 equivalent) was added to a centrifuge tube, and a mixed solution of the Vc linker-bearing auristatin tubulin inhibitor VcMMAE (in acetonitrile / water (1 / 5 - 3 / 1, preferably 1 / 1)) (2 - 30 equivalents, preferably 3 equivalents) was added, and the temperature was maintained at 4 - 40 °C, preferably 25 °C, and stirred for 2 - 24 hours, preferably 12 hours. Purification by a reverse-phase preparation column and freeze-drying gave the PTK7 aptamer-conjugated drug MS (MMAE-Sgc8c) conjugated with MMAE at the 5' end, with a yield of about 70%. After desalting, it was freeze-dried for standby. The mass spectrum is as Figure 2 shown, MS: Calculated: 14147.1 (Found: 14147).
[0126] Example 3. Preparation of ApDCs Conjugated with Different Drugs SD
[0127] In this example, two nucleic acid aptamer-conjugated drugs SD were prepared, which were PTK7 (sgc8c, the disclosed sequence) with the drug GGFG-Dxd (Deruxtecan) conjugated at the 3'-end. The SD was synthesized by the thiol-maleimide chemical reaction, and the reaction formulas are as follows:
[0128]
[0129] (1) The preparation process of the aqueous solution of the PTK7 nucleic acid aptamer modified with thiol was as shown in Example 1.
[0130] (2) Preparation of the nucleic acid aptamer-conjugated drug SD:
[0131] Add the aqueous solution of the 3'-thiol-modified PTK7 nucleic acid aptamer (1 equivalent) into a centrifuge tube, and add the mixed solution of the DNA topoisomerase I inhibitor Deruxtecan (CAS No.: 1599440-13-7, purchased from Shanghai Aoyuansheng Biomedical Technology Co., Ltd.) in acetonitrile / water (1 / 5 - 3 / 1, preferably 1 / 1) (2 - 30 equivalents, preferably 3 equivalents). Keep the temperature at 4 - 40 °C, preferably 25 °C, and stir for 2 - 24 hours, preferably 12 hours. Purify by a reverse-phase preparation column and freeze-dry to obtain the PTK7 nucleic acid aptamer-conjugated drug SD (Sgc8c-Deruxtecan) with Deruxtecan conjugated at the 3'-end. The yield is about 75%. After desalting, it is freeze-dried for standby. The mass spectrum is as Figure 3 shown, SD: Calculated: 13778 (Found: 13778).
[0132] Example 4. Comparison of Plasma Stability of Drugs Conjugated at Different Sites of Nucleic Acid Aptamers
[0133] In this example, SM with the drug conjugated at the 3'-end and MS with the drug conjugated at the 5'-end prepared in Example 1 and Example 2 were respectively used for the in vitro plasma stability comparison experiment of the drugs. The specific process is as follows:
[0134] SM and MS were added to mouse plasma at a final concentration of 20 μM respectively, and incubated in a thermostatic shaker at 37 °C and 200 rpm for 5 different time points (0 h, 0.5 h, 1 h, 2 h, 4 h). Nucleic acids in the incubated samples were separated by 10% denaturing PAGE, and blank mouse plasma, pure SM strand and pure MS strand were set as control groups. The electrophoresis conditions were: 160 V, 60 min, and the sample loading amount was 2 μM. After electrophoresis, the gel was stained with 1×Gel Red in the dark for 5 min. After staining, it was washed two to three times, and the Cy3 channel was selected for gel imaging. Image Quant was used for data processing to further analyze the nucleic acid cleavage amounts of SM and MS incubated in mouse plasma in vitro at different time points. The results are as Figure 4 shown. It can be seen that the nucleic acid cleavage amounts of SM incubated in mouse plasma in vitro at different time points are all higher than those of MS, and MS is basically completely cleaved after 4 h of incubation. This indicates that the Sgc8 aptamer conjugated with the drug at the 3'-end has a significantly improved stability compared with the Sgc8 aptamer conjugated with the drug at the 5'-end, indicating that the ApDC modified with the 3'-end drug has a higher stability. The higher the drug stability, the more it can prevent the degradation of the drug during in vivo transportation when administered by intravenous injection, thereby enhancing the efficacy of the drug. It can be inferred from this that SM will also have better drug efficacy than MS.
[0135] Example 5: SPR Characterization of Different PTK7 Nucleic Acid Aptamer-Conjugated Drugs
[0136] In this comparative example, SPR experiments were used to characterize the binding of SM prepared in Example 1 and two other PTK7 aptamer-conjugated drugs, JHG35-2AM and CJH-C4M, to human PTK7 protein.
[0137] The specific process is as follows:
[0138] Human PTK7 protein was immobilized on a CM5 chip using a pH 4.5 NaAC buffer, with His protein as the control protein, and an ethanolamine solution was used to block the unreacted carboxyl groups on the chip. Then, the samples of SM, JHG35-2AM, and CJH-C4M diluted with the mobile phase (DPBS solution containing 5 mM MgCl2) were passed through the chip surface in ascending order of concentration, with a binding time of 180 s and a dissociation time of 180 s at a flow rate of 30 μL / min. Finally, after each cycle, the chip was regenerated with 1.5 M NaCl solution at a flow rate of 30 μL / min for 30 s. The equilibrium dissociation constant Kd was obtained by analyzing with Biacore Insight Evaluation software. The results are as Figures 5 - 7 shown. As Figure 5 can be seen, SM binds strongest to human PTK7 protein, with a Kd value of 2.97 nM. AsFigure 6 It was found that the binding ability of JHG35-2AM to human PTK7 protein was similar to that of SM, and the Kd value was 7.48 nM. From Figure 7 It can be seen that the binding of CJH-C4M to human PTK7 protein was relatively weak, with a Kd value of 34.2 nM. Its binding was slow and dissociation was fast, resulting in a higher Kd value. It can be seen that the aptamer in SM had better affinity for the target human PTK7 protein, with better targeting effect, which was helpful to improve the curative effect.
[0139] Example 6. Cytotoxicity comparison of different drugs SM, SD, and SE
[0140] HT-29 cells were inoculated into 96-well plates (3000 cells per well) and cultured at 37 °C under 5% carbon dioxide for 24 hours. Then, PTK7 aptamer drugs SM (Sgc8c-MMAE) (prepared in Example 1), SD (Sgc8c-Dxd) (prepared in Example 3), and SE (prepared in Example 20) with the same concentration but different conjugated drugs were added. After culturing at 37 °C under 5% carbon dioxide for 24 hours, the drug-containing culture medium was discarded, and the cells were continued to be cultured in drug-free culture medium for 96 hours. After a total of 120 hours, the inhibitory effect of the drugs was measured using a CCK8 kit, and the results are as Figure 8 shown. From Figure 8 It can be seen that the aptamer-conjugated drugs SM, SD, and SE gradually enhanced the inhibitory effect on colorectal HT-29 cells with the increase of drug concentration, and the inhibitory activity was SE > SM > SD. Among them, the IC50 of SE was about 60 nM, the IC50 of SM was about 250 nM, and the IC50 of SD was about 2500 nM.
[0141] Example 7. Effect of aptamer-conjugated drugs on the inhibition of malignant cell proliferation
[0142] In this example, SM prepared in Example 1 was used for the proliferation inhibition experiments of human colorectal cancer HT-29, human lung cancer NCI-H1975, human ovarian cancer SKOV3, human breast cancer SUM159 cells, and osteosarcoma Saos-2. The specific process is as follows:
[0143] HT-29, NCI-H1975, SKOV3, SUM159, and Saos-2 cells were seeded into 96-well plates (3000 cells per well) and cultured at 37 °C under 5% carbon dioxide for 24 hours. Different concentrations of the PTK7 aptamer drug SM (Sgc8c-MMAE) were added. After culturing for 24 hours at 37 °C under 5% carbon dioxide, the drug-containing medium was discarded, and the cells were cultured in drug-free medium for an additional 96 hours (SUM159 cells were cultured for an additional 48 hours). After a total of 120 hours (SUM159 cells were cultured for a total of 72 hours), the inhibitory effect of the drug was measured using a CCK8 kit.
[0144] This example investigated the proliferation inhibition results of SM on HT-29, NCI-H1975, SKOV3, SUM159, and Saos-2 cells. Figures 9 - 12 The proliferation inhibition results of SM on HT-29, NCI-H1975, SKOV3, and SUM159 cells are as follows. Figure 9 The proliferation inhibition result of SM on HT-29 cells is shown in Figure 9 As can be seen, SM has a good inhibitory effect on human colorectal cancer HT-29 cells, with an IC50 value of 250 nM. Figure 10 The proliferation inhibition result of SM on NCI-H1975 cells is shown in Figure 10 As can be seen, SM has a good inhibitory effect on human lung cancer NCI-H1975 cells, with an IC50 value of 131 nM. Figure 11 The proliferation inhibition result of SM on SKOV3 cells is shown in Figure 11 As can be seen, SM has a good inhibitory effect on human ovarian cancer SKOV3 cells, with an IC50 value of 500 nM. Figure 12 The proliferation inhibition result of SM on SUM159 cells is shown in Figure 12 As can be seen, SM has a good inhibitory effect on human breast cancer SUM159 cells, with an IC50 value of 105 nM.
[0145] Meanwhile, in this example, the proliferation inhibitory effect of MS on HT-29, NCI-H1975, SKOV3, SUM159, and Saos-2 cells was also investigated under the same conditions. The comparison of the detection results with those of SM is shown in Table 1. The lower the IC50 value, the higher the activity of inhibiting tumor cells.
[0146] Table 1. Proliferation inhibition results of SM and SM on tumor cells
[0147]
[0148] As can be seen from Table 1, except for osteosarcoma Saos-2, the SM prepared from the aptamer with a drug conjugated at the 3'-end showed significantly better effects in inhibiting the proliferation of tumor cells than the MS prepared from the PTK7 aptamer with a drug conjugated at the 3'-end. The IC50 value was significantly lower, showing a significant difference. Especially for human breast cancer SUM159 cells, the IC50 value decreased by more than 50%. It can be seen that conjugating a drug at the 3'-end of the aptamer helps to improve the effect of inhibiting the proliferation of tumor cells.
[0149] Example 8. Influence of Aptamer-Conjugated Drug on Tumor Inhibition Effect of Colorectal Cancer HT-29
[0150] In this example, the SM prepared in Example 1 was used for the tumor inhibition experiment of the colorectal cancer HT-29 xenograft tumor model. The specific process is as follows:
[0151] Twenty-four mice with a colorectal cancer HT-29 cell-bearing tumor model and a tumor volume of 100 - 200 mm 3 were randomly divided into 6 groups. SM was divided into different dose groups of 3.5 mg / kg (0.25 μmol / kg), 7 mg / kg (0.5 μmol / kg), 10.5 mg / kg (0.75 μmol / kg), different dosing frequency groups, and different dosing interval groups. The Saline group and the SM group were given tail vein injections every four days, for a total of 5 times, 7 times, and 8 times respectively. The SM group was given tail vein injections every 7 days, for a total of 5 times. The body weight of the mice, the length (a) of the tumor, and the width (b) of the tumor were measured and recorded during each injection. The formula for calculating the tumor volume (V) is: V = (a×b 2 ) / 2. When the tumor volume exceeded 1500 mm 3 or the body weight decreased by more than 15%, the experiment was terminated by euthanizing the mice. The experimental results are as Figures 13 - 14 shown. Compared with the Saline group, the tumors of the mice in the SM group were effectively inhibited. The inhibition rate of the SM 3.5 mg / kg q4d×8 group was 42%, the inhibition rate of the SM 7 mg / kg q7d×5 group reached 68%, the inhibition rate of the SM 7 mg / kg q4d×5 group reached 98%, the inhibition rate of the SM 7 mg / kg q4d×7 group reached 94.5%, and the inhibition rate of the SM 10.5 mg / kg q7d×5 group reached 96%. At the same time, the body weight of the mice was observed, and the results are as Figures 15 - 16 shown. There was no significant difference in the body weight of the mice in the SM group compared with the Saline group. Therefore, the most preferred was the SM 7 mg / kg q4d×5 group, which was given tail vein injections every four days, for a total of 5 times.
[0152] Compared with the tumor suppression effect of SE in the HT-29 tumor model in Example 21, although SE has higher cytotoxicity than SM at the same concentration in Example 6, at a lower dose than SE (2 μmol / kg), SM (0.5 μmol / kg) shows better in vivo tumor suppression effect, indicating that MMAE is a more preferred drug molecule that can be conjugated with the nucleic acid aptamer sgc8c.
[0153] In this example, the inhibitory effect of MS prepared in Example 2 on tumors in the colorectal cancer HT-29 xenograft tumor model was further investigated. It was found that compared with the Saline group, the inhibition rates of the MS 7 mg / kg q4d×5 group, the MS 7mg / kg q4d×7 group, and the MS 10.5 mg / kg q7d×5 group were 76.5%, 75.8%, and 75.6% respectively. It can be seen that conjugating the drug SM at the 3'-end of the nucleic acid aptamer can significantly improve the inhibitory activity against colorectal cancer HT-29 cells and is more suitable as a therapeutic drug for anti-colorectal cancer HT-29.
[0154] Example 9. Influence of Nucleic Acid Aptamer-Conjugated Drug on Tumor Suppression Effect of Human Lung Cancer NCI-H1975
[0155] In this example, SM prepared in Example 1 was used for the tumor suppression experiment of the human lung cancer NCI-H1975 xenograft tumor model. The specific process is as follows:
[0156] Twelve mice with a human lung cancer cell NCI-H1975 cell-bearing tumor model and a tumor volume of 100 - 200 mm 3 were randomly divided into 3 groups. The Saline group and the SM group were given tail vein injections every four days at a dose of 0.36 mg / kg (0.5 μmol / kg) equivalent of MMAE, for a total of 5 injections. The Paclitaxel group was given intraperitoneal injections every four days at a dose of 10 mg / kg, for a total of 4 injections. The body weight of the mice, the length (a) and width (b) of the tumor were measured and recorded during each injection. The formula for calculating the tumor volume (V) is: V = (a×b 2 ) / 2. When the tumor volume exceeded 1500 mm 3 or the body weight loss exceeded 15%, the mice were euthanized and the experiment was terminated. The experimental results are as Figures 17 - 18 shown. Compared with the Saline group, the tumor inhibition rate of the Paclitaxel group was 60%, and the SM group achieved a 99% objective response rate and complete remission of the mice's tumors. At the same time, the body weight of the mice was observed, and the results are as Figures 19 - 20 shown. There was no significant difference in the body weight of the mice in the SM group compared with the Saline group, indicating that SM has good biosafety at this dose.
[0157] In this example, the inhibitory effect of MS prepared in Example 2 on tumors in a human lung cancer NCI-H1975 xenograft tumor model was further investigated. It was found that compared with the Saline group, the inhibition rate of the MS 7 mg / kg q4d×5 group was only 76.5%, significantly lower than that of the SM group. It can be seen that conjugating the drug SM to the 3'-end of the aptamer can significantly improve the inhibitory activity against human lung cancer NCI-H1975 cells, and is more suitable as a therapeutic drug for anti-human lung cancer.
[0158] Meanwhile, in this example, the inhibitory effects of SD (Sgc8c-Dxd) (prepared in Example 3) and SE (prepared in Example 20) on tumors in a human lung cancer NCI-H1975 xenograft tumor model were also investigated respectively. It was found that the tumor inhibition rates of the SM group were significantly higher than those of the SD group and the SE group.
[0159] Example 10. Influence of Aptamer-Conjugated Drugs on Tumor Inhibition Effect of Human Ovarian Cancer SKOV3
[0160] In this example, SM prepared in Example 1 was used for the tumor inhibition experiment of a human ovarian cancer SKOV3 xenograft tumor model. The specific process is as follows:
[0161] Six mice with a human ovarian cancer SKOV3 cell-bearing tumor model, whose tumor volumes were in the range of 100 - 200 mm 3 , were randomly divided into 2 groups. The Saline group and the SM group were given tail vein injections every four days at a dose of 0.36 mg / kg (0.5 μmol / kg) equivalent of MMAE, for a total of 5 administrations. The body weights of the mice, the lengths (a) and widths (b) of the tumors were measured and recorded each time of injection. The formula for calculating the tumor volume (V) is: V = (a×b 2 ) / 2. When the tumor volume exceeded 1500 mm 3 or the body weight loss exceeded 15%, the experiment was terminated by euthanizing the mice. The experimental results are as Figures 21 - 22 shown. Compared with the Saline group, the tumor inhibition rate of the SM group for the mice was 96%. At the same time, the body weights of the mice were observed, and the results are as Figures 23 - 24 shown. There was no significant difference in the body weights of the mice in the SM group compared with the Saline group, indicating that SM had good biosafety at this dose.
[0162] In this example, the inhibitory effect of MS prepared in Example 2 on tumors in a human ovarian cancer SKOV3 xenograft tumor model was further investigated. It was found that compared with the Saline group, the inhibition rate of the MS 7 mg / kg q4d×5 group was 98.2%, slightly higher than that of the SM group. It can be seen that conjugating the drug MS to the 5'-end of the aptamer is more conducive to improving the inhibitory activity against human ovarian cancer SKOV3 cells, and is more suitable as a therapeutic drug for anti-human ovarian cancer.
[0163] Meanwhile, in this example, the inhibitory effects of SD (Sgc8c-Dxd) (prepared in Example 3) and SE (prepared in Example 20) on tumors in a human ovarian cancer SKOV3 xenograft tumor model were also investigated respectively, and it was found that the tumor inhibition rates in the SM group were significantly higher than those in the SD group and the SE group.
[0164] Example 11. Influence of nucleic acid aptamer-conjugated drug on tumor inhibition effect of human breast cancer SUM159
[0165] In this example, the SM prepared in Example 1 was used for the tumor inhibition experiment in a human breast cancer SUM159 xenograft tumor model. The specific process is as follows:
[0166] Twenty-five mice with a human breast cancer cell SUM159 cell-bearing tumor model and a tumor volume of 100 - 200 mm 3 were randomly divided into 5 groups. SM was divided into different dose groups of 5.25 mg / kg (0.375 μmol / kg), 7 mg / kg (0.5 μmol / kg), and 10.5 mg / kg (0.75 μmol / kg). The Saline group, the 5.25 mg / kg SM group, and the 7 mg / kg SM group were given tail vein injections every four days for a total of 5 times. The 7 mg / kg SM group and the 10.5 mg / kg SM group were given tail vein injections every 7 days for a total of 4 times. The body weight of the mice, the length (a) of the tumor, and the width (b) of the tumor were measured and recorded during each injection. The calculation formula for the tumor volume (V) is: V = (a×b 2 ) / 2. When the tumor volume exceeded 1500 mm 3 or the body weight loss exceeded 15%, the experiment was terminated by euthanizing the mice. The experimental results are as Figures 25 - 26 shown. Compared with the Saline group, SM within the dose range of 5.25 - 10.5 mg / kg could significantly inhibit the tumors in mice. Among them, SM 7 mg / kg q4d×5 and SM 10.5 mg / kgq7d×4 had the strongest tumor inhibitory effect, and the tumor inhibition rate reached more than 70%. At the same time, the body weight of the mice was observed, and the results are as Figures 27 - 28 shown. There was no significant difference in the body weight of the mice in each SM dose group compared with the Saline group, indicating that SM had good biosafety within the dose range of 5.25 - 10.5 mg / kg.
[0167] In this example, the inhibitory effect of MS prepared in Example 2 on tumors in a human breast cancer SUM159 xenograft tumor model was further investigated. It was found that compared with the Saline group, the inhibition rates of the MS 7 mg / kg q4d×5 group and the MS 7 mg / kg q7d×5 group were significantly lower than those of the SM 7 mg / kg q4d×5 group and the SM 7 mg / kg q7d×5 group. It can be seen that coupling the nucleic acid aptamer at the 3'-end with the drug SM can significantly improve the inhibitory activity against human breast cancer SUM159 cells and is more suitable as a therapeutic drug for anti-human breast cancer.
[0168] Example 12. Influence of Nucleic Acid Aptamer-Conjugated Drug on Tumor Inhibition Effect of Human Pancreatic Cancer MIA PaCa-2
[0169] In this example, SM prepared in Example 1 was used for the tumor inhibition experiment of a human pancreatic cancer MIA PaCa-2 xenograft tumor model. The specific process is as follows:
[0170] Ten mice with a human pancreatic cancer MIA PaCa-2 cell-bearing tumor model and a tumor volume of 100 - 200 mm 3 were randomly divided into 2 groups. Administration was carried out every four days, and normal saline Saline and SM were respectively injected into the tail vein at a dose of 0.36 mg / kg (0.5 μmol / kg) equivalent of MMAE, and a total of 5 administrations were given. The body weight of the mice, the length (a) of the tumor, and the width (b) of the tumor were measured and recorded during each injection. The calculation formula for the tumor volume (V) is: V = (a×b 2 ) / 2. When the tumor volume exceeded 1500 mm 3 or the body weight loss exceeded 15%, the mice were euthanized and the experiment was terminated. The experimental results are as Figures 29 - 30 shown. Compared with the Saline group, the tumors of the mice in the SM group achieved a 99% objective response rate and complete remission. At the same time, the body weight of the mice was observed, and the results are as Figures 31 - 32 shown. There was no significant difference in the body weight of the mice in the SM group compared with the Saline group, indicating that SM has good biosafety at this dose.
[0171] In this example, the inhibitory effect of MS prepared in Example 2 on tumors in a human pancreatic cancer MIA PaCa-2 xenograft tumor model was further investigated. It was found that compared with the Saline group, the inhibition rate of the MS 7 mg / kg q4d×5 group was only 51.5%, showing a significant decrease compared with SM. It can be seen that coupling the nucleic acid aptamer at the 3'-end with the drug SM can significantly improve the inhibitory activity against human pancreatic cancer MIA PaCa-2 cells, making the inhibitory activity reach 99%, almost able to completely inhibit. Therefore, SM is more suitable as a therapeutic drug for anti-human pancreatic cancer.
[0172] Meanwhile, in this example, the inhibitory effects of SD (Sgc8c-Dxd) (prepared in Example 3) and SE (prepared in Example 20) on tumors in a human pancreatic cancer MIA PaCa-2 xenograft tumor model were also investigated respectively, and it was found that the tumor inhibition rates in the SM group were significantly higher than those in the SD group and the SE group.
[0173] Example 13. Influence of Aptamer-Conjugated Drug on Tumor Inhibition Effect of Human Lung Cancer A549
[0174] In this example, the SM prepared in Example 1 was used for the tumor inhibition experiment in a human lung cancer A549 xenograft tumor model. The specific process is as follows:
[0175] Twelve tumor-bearing mice models of human lung cancer A549 cells with a tumor volume of 100 - 200 mm 3 were randomly divided into 3 groups. The Saline group and the SM group were given tail vein injections every four days, with a dose of 0.36 mg / kg (0.5 μmol / kg) equivalent of MMAE for a total of 5 injections. The Cisplatin group was given intraperitoneal injections every 7 days, with a dose of 2.5 mg / kg for a total of 2 injections. The body weight of the mice, the length (a) and width (b) of the tumor were measured and recorded during each injection. The formula for calculating the tumor volume (V) is: V = (a × b 2 ) / 2. When the tumor volume exceeded 1500 mm 3 or the body weight loss exceeded 15%, the experiment was terminated by euthanizing the mice. The experimental results are as Figures 33 - 34 shown. Compared with the Saline group, the tumor inhibition rate of the Cisplatin group on mouse tumors was 10%, and the tumor inhibition rate of the SM group reached 62%. At the same time, the body weight of the mice was observed, and the results are as Figures 35 - 36 shown. There was no significant difference in the body weight of the mice in the SM group compared with the Saline group, indicating that SM had good biosafety at this dose.
[0176] In this example, the inhibitory effect of MS prepared in Example 2 on tumors in a human non-small cell lung cancer A549 xenograft tumor model was further investigated. It was found that compared with the Saline group, the inhibition rate of the MS 7 mg / kg q4d×5 group was 60%, slightly lower than that of the SM group. This also shows that conjugating the drug SM at the 3'-end of the aptamer helps to improve the inhibitory activity against human non-small cell lung cancer A549 cells and is more suitable as a therapeutic drug for anti-human non-small cell lung cancer.
[0177] However, when targeting human lung cancer NCI-H1975, the effects of SM and MS on the treatment outcome are more obvious. While for non-small cell lung cancer A549, the impact of SM and MS on the treatment outcome is somewhat mitigated. It can be seen that for different types of lung cancer, the conjugation methods of aptamer-conjugated drugs also have different effects.
[0178] Example 14. Influence of Aptamer-Conjugated Drug on the Tumor Inhibitory Effect of Pancreatic Cancer PDX
[0179] The SM prepared in Example 1 was used for the tumor inhibitory experiment of the pancreatic cancer PDX xenograft tumor model. The specific process is as follows:
[0180] Tumor pieces of pancreatic cancer PDX were implanted using a trocar. After 19 days, the tumor volume reached 100 - 200 mm 3 . Ten mice with a pancreatic cancer PDX model tumor volume of 100 - 200 mm 3 were randomly divided into 2 groups. The Saline group and the SM group were given tail vein injections every four days at a dose of 0.36 mg / kg (0.5 μmol / kg) equivalent of MMAE, for a total of 6 injections. The body weight of the mice, the length (a) and width (b) of the tumor were measured and recorded during each injection. The formula for calculating the tumor volume (V) is: V = (a×b 2 ) / 2. When the tumor volume exceeded 1500 mm 3 or the body weight loss exceeded 15%, the experiment was terminated and the mice were euthanized. The tumor volume and relative tumor volume are shown as Figures 37 - 38 . Compared with the Saline group, the tumors of the mice in the SM group were effectively inhibited, and the inhibition rate reached 92%. At the same time, the body weight of the mice was observed, and the results are shown as Figures 39 - 40 . There was no significant difference in the body weight of the mice in the SM group compared with the Saline group.
[0181] In this example, the inhibitory effect of MS prepared in Example 2 on the tumors of the pancreatic cancer PDX xenograft tumor model was further investigated. It was found that compared with the Saline group, the inhibition rate of the MS 7 mg / kg q4d×6 group was 57%, showing a significant decrease compared with SM. It can be seen that aptamer 3'-conjugated drug SM can significantly improve the inhibitory activity against human pancreatic cancer PDX cells and is more suitable as a therapeutic drug for anti-human pancreatic cancer.
[0182] Example 15. Influence of Aptamer-Conjugated Drug on the Tumor Inhibitory Effect of Breast Cancer MDA-MB-468
[0183] In this example, the SM prepared in Example 1 was used for the tumor inhibitory experiment of the breast cancer MDA-MB-468 xenograft tumor model. The specific process is as follows:
[0184] Fifteen mice with a breast cancer cell MDA-MB-468 xenograft model, whose tumor volumes were between 100 and 200 mm 3 , were randomly divided into three groups. The Saline group and the SM group were administered drugs via the tail vein every four days at a dose of 0.36 mg / kg (0.5 μmol / kg) equivalent of MMAE, for a total of three administrations. The Paclitaxel group was administered drugs via the intraperitoneal cavity every four days at a dose of 10 mg / kg, for a total of three administrations. The body weight of the mice, the length (a) and width (b) of the tumor were measured and recorded during each injection. The formula for calculating the tumor volume (V) was: V = (a × b 2 ) / 2. When the tumor volume exceeded 1500 mm 3 or the body weight loss exceeded 15%, the experiment was terminated by euthanizing the mice. The experimental results are as Figures 41 - 42 shown. Compared with the Saline group, the inhibition rate of the Paclitaxel group on the tumors of the mice was 60%, and the SM group achieved a 100% objective response rate and complete remission of the tumors in the mice. At the same time, the body weight of the mice was observed. As Figures 43 - 44 shown, there was no significant difference in the body weight of the mice in the SM group compared with the Saline group.
[0185] In this example, the inhibitory effect of MS prepared in Example 2 on the tumors of the breast cancer MDA-MB-468 xenograft model was further investigated. It was found that compared with the Saline group, the inhibition rate of the MS 7 mg / kg q4d×3 group was 89%, which was significantly lower than that of the SM group. The use of SM could achieve an inhibition rate of 100%, indicating that SM is particularly suitable for preparing drugs against breast cancer MDA-MB-468.
[0186] In this example, the inhibitory effects of SD (Sgc8c-Dxd) (prepared in Example 3) and SE (prepared in Example 20) on the tumors of the breast cancer MDA-MB-468 xenograft model were also investigated respectively. It was found that the tumor inhibition rates of the SM group were significantly higher than those of the SD group and the SE group.
[0187] Example 16, Influence of Nucleic Acid Aptamer-Conjugated Drug on Tumor Inhibition Effect of Ovarian Cancer OVCAR3
[0188] In this example, SM prepared in Example 1 was used for the tumor inhibition experiment of the ovarian cancer OVCAR3 xenograft model. The specific process was as follows:
[0189] Fifteen mice with an ovarian cancer cell OVCAR3 xenograft model, whose tumor volumes were between 100 and 200 mm 3Nine mice were randomly divided into three groups. Mice in the Saline group and the SM group were administered by tail vein injection every four days with a dose of 0.36 mg / kg (0.5 μmol / kg) equivalent of MMAE, for a total of 5 administrations. Mice in the Paclitaxel group were administered by intraperitoneal injection every four days with a dose of 10 mg / kg, for a total of 5 administrations. During each injection, the body weight of the mice, the length (a) and width (b) of the tumor were measured and recorded. The formula for calculating the tumor volume (V) is: V = (a×b 2 ) / 2. When the tumor volume exceeded 1500 mm 3 or the body weight loss exceeded 15%, the experiment was terminated and the mice were euthanized. The experimental results are as Figures 45 - 46 shown. Compared with the Saline group, the tumor inhibition rate of the Paclitaxel group on mouse tumors was 33%, and the inhibition rate of the SM group on mouse tumors was 98.5%. At the same time, the body weight of the mice was observed. As Figures 47 - 48 shown, there was no significant difference in the body weight of the mice in the SM group compared with the Saline group.
[0190] In this example, the inhibitory effect of MS prepared in Example 2 on tumors in the ovarian cancer OVCAR3 xenograft tumor model was further investigated. It was found that compared with the Saline group, the inhibition rate of the MS 7 mg / kg q4d×5 group was 82.5%, which was lower than the inhibitory effect of SM. It can be seen that the nucleic acid aptamer conjugated with the drug SM can significantly improve the inhibitory activity against ovarian cancer OVCAR3 cells and is more suitable as a therapeutic drug for anti-ovarian cancer OVCAR3.
[0191] At the same time, in this example, the inhibitory effects of SD (Sgc8c-Dxd) (prepared in Example 3) and SE (prepared in Example 20) on tumors in the ovarian cancer OVCAR3 xenograft tumor model were investigated respectively, and it was found that the tumor inhibition rates of the SM group were significantly higher than those of the SD group and the SE group.
[0192] Example 17. Influence of nucleic acid aptamer conjugated drug on tumor inhibition effect of pancreatic cancer BxPC3
[0193] In this example, SM prepared in Example 1 was used for the tumor inhibition experiment of the pancreatic cancer BxPC3 xenograft tumor model. The specific process is as follows:
[0194] Take a mouse model bearing BxPC3 pancreatic cancer cells, with a tumor volume of 100 - 200 mm 3Nine mice were randomly divided into three groups. Mice in the Saline group and the SM group were administered by tail vein injection every four days at a dose of 0.36 mg / kg (0.5 μmol / kg) equivalent of MMAE, for a total of 5 administrations. Mice in the Gemcitabine group were administered by intraperitoneal injection every seven days at a dose of 80 mg / kg, for a total of 3 administrations. The body weight of the mice, the length (a) and width (b) of the tumor were measured and recorded during each injection. The formula for calculating the tumor volume (V) is: V = (a×b 2 ) / 2. When the tumor volume exceeded 1500 mm 3 or the body weight loss exceeded 15%, the experiment was terminated and the mice were euthanized. The experimental results are shown in Figures 49 - 50 . Compared with the Saline group, the Gemcitabine group did not inhibit the tumor growth in mice, while the inhibition rate of the SM group on mouse tumors was 87%. At the same time, the body weight of the mice was observed, and the results are shown in Figures 51 - 52 . There was no significant difference in the body weight of the mice in the SM group compared with the Saline group, indicating that SM had good biosafety at this dose.
[0195] In this example, the inhibitory effect of MS prepared in Example 2 on the tumors of the pancreatic cancer BxPC3 xenograft tumor model was further investigated. It was found that compared with the Saline group, the inhibition rate of the MS 7 mg / kg q4d×5 group was 56%, which was significantly lower than that of the SM group.
[0196] Example 18, Nucleic Acid Aptamer Conjugated Drug S-M with an Uncleavable Linker Coupled at the 3'-End
[0197] In this example, a nucleic acid aptamer conjugated drug S-M with Mc-MMAE drug conjugated at the 3'-end of the PTK7 (sgc8c, the disclosed sequence) was prepared. S-M was synthesized by a thiol-maleimide chemical reaction, and the reaction formula is as follows:
[0198]
[0199] Among them, the nucleic acid aptamer is a strip with a thiol group, and DMTr is a dimethoxytrityl protecting group.
[0200] The preparation process is as follows:
[0201] (1) The preparation process of the thiol-modified PTK7 nucleic acid aptamer aqueous solution is as shown in Example 1.
[0202] (2) Preparation of the nucleic acid aptamer conjugated drug S-M:
[0203] Add an aqueous solution of the 3'-thiol-modified PTK7 nucleic acid aptamer (1 equivalent) to a centrifuge tube, and a mixed solution of acetonitrile / water (1 / 5 - 3 / 1, preferably 1 / 2) of the auristatin-based tubulin inhibitor Mc-MMAE (CAS: 863971-24-8, purchased from Shanghai Haoyuan Biomedical Technology Co., Ltd.) with a maleimide hexanamide protecting group (2 - 30 equivalents, preferably 3 equivalents). Keep the temperature at 4 - 40 °C, preferably 25 °C, and stir the reaction for 2 - 24 hours, preferably 12 hours. Purify by reverse-phase preparative column and freeze-dry to obtain the PTK7 nucleic acid aptamer-conjugated drug S-M (Sgc8c-Mc-MMAE) conjugated with Mc-MMAE at the 3' end, with a yield of approximately 60%. After desalting, freeze-dry for later use. S-M: Calculated: 13741.1 (Found: 13741).
[0204] Example 19. Influence of constructing nucleic acid aptamer-conjugated drugs by conjugating different linkers at the 3' end
[0205] This example was constructed using the method provided in Example 1, where the linkers on MMAE were respectively the cleavable maleimide VC linker SM and the non-cleavable maleimide hexanoyl linker S-M. The construction method of VcMMAE was as in Example 1, and the construction method of the non-cleavable maleimide hexanoyl linker S-M was as shown in Example 18. According to the method provided in Example 16, the inhibitory effects of different linker drugs SM and S-M on human pancreatic cancer MIA PaCa-2 cells were investigated. The results showed that the PTK7 nucleic acid aptamer-conjugated drug SM constructed with the Vc linker was significantly superior to the non-cleavable linker drug S-M, with the IC50 reduced by more than 30%. The reason may be that the non-cleavable linker restricted the activity of the MMAE drug. Therefore, the most preferred linker is the Vc linker.
[0206] Example 20. Preparation of the PTK7-targeted nucleic acid aptamer conjugated with drug SE at the 3' end
[0207] In this example, a PTK7 (sgc8c, the disclosed sequence) nucleic acid aptamer-conjugated drug SE conjugated with the MC-VA-PAB-Exatecan drug at the 3' end was prepared. SE was synthesized by the thiol-maleimide chemical reaction, and the reaction formula is as follows:
[0208]
[0209] Among them, the ribbon with a thiol group is the nucleic acid aptamer, and DMTr is the dimethoxytrityl protecting group.
[0210] The preparation process is as follows:
[0211] (1) The preparation process of the aqueous solution of the thiol-modified PTK7 nucleic acid aptamer is as shown in Example 1.
[0212] (2) Preparation of nucleic acid aptamer-conjugated drug SE:
[0213] Add an aqueous solution of PTK7 nucleic acid aptamer modified with a thiol group at the 3'-end (1 equivalent) to a centrifuge tube, and a DMSO / water (1 / 5 - 3 / 1, preferably 1 / 1) mixed solution of the DNA topoisomerase I inhibitor irinotecan MC-VA-PAB-Exatecan (CAS: 2680543-57-9, purchased from Shanghai Haoyuan Biomedical Technology Co., Ltd.) with an MC-VA-PAB linker (2 - 30 equivalents, preferably 3 equivalents). Keep the temperature at 4 - 40 °C, preferably 25 °C, and stir the reaction for 2 - 24 hours, preferably 12 hours. Purify by reverse-phase preparative column and freeze-dry to obtain the PTK7 nucleic acid aptamer-conjugated drug SE (Sgc8c-EXA) with Exatecan conjugated at the 3'-end, with a yield of about 60%. After desalting, it is freeze-dried for later use. Characterize the product SE by mass spectrometry: Calculated: 13778.1 (Found: 13778).
[0214] Example 21. Effect of nucleic acid aptamer-conjugated drug SE on the tumor inhibitory effect of colorectal cancer HT-29
[0215] In this example, SE prepared in Example 20 was used for the tumor inhibition experiment of the colorectal cancer HT-29 xenograft tumor model. The specific process is as follows:
[0216] Select 8 mice with a colorectal cancer cell HT-29 tumor-bearing mouse model and a tumor volume of 100 - 200 mm 3 . Randomly divide them into 2 groups. The Saline group and the SE group were intravenously administered through the tail vein every four days at a dose of 27.6 mg / kg (dose: 2 μmol / kg) for a total of 5 times. Measure and record the body weight of the mice, the length (a) and width (b) of the tumor each time of injection. The calculation formula for the tumor volume (V) is: V = (a × b 2 ) / 2. When the tumor volume exceeds 1500 mm 3 or the body weight loss exceeds 15%, euthanize the mice to terminate the experiment. The experimental results are as Figures 53 - 54 shown. Compared with the Saline group, the tumor inhibition rate of the SE group on the tumors of the mice was only 26.7%. At the same time, observe the body weight of the mice. The results are as Figures 55 - 56 shown. There was no significant difference in the body weight of the mice in the SE group compared with the Saline group, indicating that SE has good biosafety at this dose.
[0217] Example 22. Effect of nucleic acid aptamer-conjugated drug on the tumor inhibitory effect of other tumors
[0218] In this example, the SM prepared in Example 1 was used for tumor inhibition experiments on xenograft tumor models of soft tissue sarcoma SW872, osteosarcoma Saos-2, thymic carcinoma Ty-82, and central neurocytoma ONS-76 cells. The specific process is as follows:
[0219] Nine mice with tumor-bearing models of soft tissue sarcoma SW872, osteosarcoma Saos-2, thymic carcinoma Ty-82, and central neurocytoma ONS-76 cells were taken respectively, and the tumor volume was 100 - 200 mm 3 These mice were randomly divided into 3 groups. The Saline group and the SM group were given intravenous tail vein injections every four days, with a dose of 0.36 mg / kg (0.5 μmol / kg) equivalent of MMAE, and a total of 5 injections were given. The body weight of the mice, the length (a) and width (b) of the tumor were measured and recorded each time of injection. The calculation formula for the tumor volume (V) is: V = (a×b 2 ) / 2. When the tumor volume exceeded 1500 mm 3 or the body weight loss exceeded 15%, the mice were euthanized and the experiment was terminated. The inhibitory effect of SM on the tumors of the tumor-bearing mouse models of soft tissue sarcoma SW872, osteosarcoma Saos-2, thymic carcinoma Ty-82, and central neurocytoma ONS-76 cells was calculated. At the same time, in this example, the same method was also used to investigate the inhibitory effect of MS prepared in Example 2 on the tumors of the xenograft tumor models of soft tissue sarcoma SW872, osteosarcoma Saos-2, thymic carcinoma Ty-82, and central neurocytoma ONS-76. The detection results are shown in Table 2.
[0220] Table 2. Inhibitory results of SM and SM on tumor cell proliferation
[0221]
[0222] It can be seen from Table 2 that except for soft tissue sarcoma SW872, the effect of MS prepared by coupling the drug at the 5'-end of the PTK7 nucleic acid aptamer in inhibiting tumor cell proliferation is significantly better than that of SM prepared by coupling the drug at the 3'-end of the PTK7 nucleic acid aptamer, showing a significant difference. Especially for thymic carcinoma Ty-82 cells, the inhibitory effect of SM decreased by more than 34%. It can be seen that coupling the drug at the 5'-end of the nucleic acid aptamer helps to improve the effect of inhibiting the proliferation of osteosarcoma Saos-2, thymic carcinoma Ty-82, and central neurocytoma ONS-76 cells. However, for soft tissue sarcoma SW872, there is no obvious difference in the effect between using MS and SM. This shows that for different tumors, it is not necessarily the case that the higher the stability of the nucleic acid aptamer-coupled drug, the better the tumor inhibitory effect, and specific tumor cells need to be analyzed specifically.
[0223] Example 23. Effect of Nucleic Acid Aptamer-Conjugated Drug on the Inhibition of Bladder Cancer Scaber
[0224] In this example, the SM prepared in Example 1 was used for the bladder perfusion experiment of the bladder cancer Scaber xenograft tumor model. The specific process is as follows:
[0225] 200,000 bladder cancer Scaber cells were inoculated into the inner wall of the mouse bladder at 200,000 cells / 10 μL to construct a tumor-bearing mouse model. When the tumor fluorescence intensity reached 10 7 it was randomly divided into 6 groups, with 8 mice in each group. Each group was perfused into the bladder once a week. The doses of SM were 0.25, 0.5, and 1 nmol / kg of SM, and sgc8 and VC-MMAE were 1 nmol / kg, and a total of 4 doses were administered. The body weight of the mice and the fluorescence intensity of the tumor site were measured and recorded before each administration. When the weight loss exceeded 15%, the mice were euthanized and the experiment was terminated. The experimental results are as Figure 57 shown. Compared with the Saline group, the inhibition rate of the SM group on the tumors of the mice was 75-100%. The tumors of the mice in the 1 nmol / kg SM group achieved a 100% objective response rate and complete remission.
[0226] In this example, the inhibitory effect of MS prepared in Example 2 on the tumors of the bladder cancer Scaber xenograft tumor model was further investigated. It was found that compared with the Saline group, at the same concentration, the inhibition rate of the MS group was also 75-100%. It can be seen that for bladder cancer Scaber cells, when the drug conjugated to the 3'-end of the nucleic acid aptamer targeting PTK7 is compared with the drug conjugated to the 5'-end, the difference in its inhibitory effect is not obvious.
[0227] Although the present invention is disclosed as above, the present invention is not limited thereto. Any person skilled in the art can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be subject to the scope defined by the claims.
Claims
1. A use of a PTK7-targeting aptamer-coupled drug for preparing a reagent for improving tumor inhibition effect, characterized in that: The aptamer-coupled drug comprises a PTK7-targeting aptamer and a linker-containing drug, wherein the linker-containing drug is coupled to the 5-end of the aptamer, and the PTK7-targeting aptamer has a sequence as shown in the sequence table SEQ ID No. 1; the drug is an auristatin microtubule protein inhibitor MMAE, and the linker is a Vc linker; the tumor is thymic carcinoma; the structural formula of the PTK7-targeting aptamer-coupled drug is as follows: 。
Citation Information
Patent Citations
Artemisinin derivative aptamer medicine conjugate as well as preparation method and application thereof
CN113491773A
PTK7 targeted nucleic acid aptamer coupling medicine
CN115990264A