FHV-1 gB dominant epitope peptide sequence and application of FHV-1 gB dominant epitope peptide sequence in feline herpesvirus vaccine

Abstract

The invention belongs to the technical field of cat herpesvirus vaccine development, and discloses two dominant epitope peptide sequences of FHV-1gB and application of the two dominant epitope peptide sequences in cat herpesvirus vaccines, and the amino acid sequences are SEQ ID NO: 1-2. Two dominant epitopes are screened out through an immune bioinformatics method, can be connected with corresponding vectors, and are connected with a Ferritin vector in a three-copy series connection manner to construct epitope nano vaccines FHB1F and FHB2F. Immunogenicity evaluation is carried out in mice, high-level cell, body fluid and mucous membrane immune responses can be induced, and a high-titer specific antibody SIgA aiming at the feline herpes virus can be generated. The dominant epitope peptide disclosed by the invention has high antigenicity and conservative property, and can be used as a candidate immunogen of a cat herpesvirus vaccine.

Description

Technical Field

[0001] The invention belongs to the technical field of feline herpes virus vaccine development, and in particular relates to two segments of FHV-1gB dominant epitope peptide sequences and applications thereof in feline herpes virus vaccines. Background Art

[0002] Feline Herpesvirus-1 (FHV-1) is a double-stranded DNA virus with a glycoprotein-lipid envelope, belonging to the genus Varicellavirus and the subfamily Alphaherpesvirinae. FHV-1 is highly prevalent in felines worldwide, and it is estimated that FHV-1 accounts for 50% to 75% of all known feline respiratory viral infections. The virus is an epitheliotropic and cytopathic virus, mainly associated with ulcerative and necrotizing rhinitis, sinusitis, rhinotracheitis, ulcerative keratitis, anterior uveitis, and eosinophilic conjunctivitis in cats, with ulcerative lesions of the skin and oral mucosa as occasional complications. The natural transmission route of FHV-1 is through oral, nasal, and ocular secretions of infected cats. Transmission occurs mainly through direct contact between infected and uninfected cats. Of course, indirect transmission occurs through contaminated cages, food, and cleaning equipment. Clinical signs, symptoms, and severity depend on the virus strain of each animal, its age, and the immune status it has received, so young animals are more susceptible to infection. Currently available commercial FHV-1 vaccines still cannot completely prevent FHV-1 infection or chronic infection, especially in multi-cat environments such as animal shelters, where FHV-1 infection remains a permanent risk due to over-allocation or low animal immunity.

[0003] Like other alphaherpesviruses, FHV-1 is characterized by establishing a neural latency in the host after the initial infection and can be reactivated under certain conditions, making it a latent infectious source. FHV-1 contains 23 virion-associated proteins and 13 envelope glycoproteins. Envelope glycoproteins play an important role in the herpesvirus infection process, among which glycoprotein B (gB), gH and gL are highly conserved and participate in the mechanism of virus invasion, including cell membrane fusion. gB is also a major immunogenic protein with abundant highly immunogenic epitopes. Its expression in mammalian cells can lead to cell fusion and polynucleosome formation, and it is the actual fusion mediator during the virus infection of cells. In addition, it has excellent immune induction function and has potential application value in the development of herpesvirus vaccines.

[0004] Therefore, there is an urgent need for an efficient, harmless, and easily mass-produced vaccine and a new immunization method to combat FHV-1 infection.

[0005] Prior art: Experimental epitope mapping

[0006] This approach typically involves experimentally identifying immunogenic regions in a protein using techniques such as peptide libraries, ELISA (enzyme-linked immunosorbent assay), Western blotting, or mass spectrometry. Through these methods, researchers can identify specific peptides that are able to induce an immune response.

[0007] Problems with existing technologies:

[0008] 1. Time and cost consumption:

[0009] Experimental approaches are often time-consuming and costly, especially when large numbers of samples need to be screened.

[0010] 2. Limited Coverage:

[0011] Due to resource and technical limitations, experimental methods are unable to comprehensively cover the entire protein sequence, resulting in the neglect of potentially important epitopes.

[0012] 3. Depends on experimental conditions:

[0013] The experimental results are affected by experimental conditions, such as the specificity and affinity of the antibody, and the solubility and stability of the peptide.

[0014] 4. Sample restrictions:

[0015] Experimental methods often require sufficient amounts of purified proteins or synthetic peptides, which are difficult to obtain in some cases. Summary of the invention

[0016] In view of the problems existing in the prior art, the present invention provides two dominant epitope peptide sequences and their application in feline herpes virus vaccines.

[0017] The present invention is achieved by providing two segments of FHV-1gB dominant epitope peptide sequences, wherein the amino acid sequences of the two segments of FHV-1gB dominant epitope peptide sequences B1 and B2 are SEQ ID NOs: 1-2, and the nucleotide sequences are SEQ ID NOs: 3-4.

[0018] SEQ ID NO: 1, Leu Arg Asp Gly Ala His Val Glu His Thr Ser Ser Asp ArpPhe Gln Ile Glu Gly Tyr

[0019] SEQ ID NO: 2, Ala Leu Lys Phe Tyr Asp Ile Asp Ser Ile Val Arg Val AspAsn Leu Val Ile Met Arg Gly

[0020] SEQ ID NO: 3, ctgcgcgatggcgcgcatgtggaacataccagctatagcagcgatcgctttcagcagattGaaggctat

[0021] SEQ ID NO: 4, gcgctgaaattttatgatattgatagcattgtgcgcgtggataacaacctggtgattatg

[0022] cgcggc

[0023] Furthermore, the method for screening the FHV-1gB dominant epitope peptide comprises: using FHV-1gB as the target protein for epitope peptide prediction by bioinformatics, and screening its dominant antigenic epitopes based on the protein amino acid properties, including hydrophilicity, surface accessibility, secondary structure, flexibility, conservation and antigenicity.

[0024] Further, a gene sequence encoding the epitope peptide.

[0025] Another object of the present invention is to provide an application of two segments of FHV-1gB dominant epitope peptides in feline herpes virus vaccines.

[0026] Furthermore, the dominant epitope peptide was connected to the Ferritin vector gene in the form of 3 copies and expressed in an Escherichia coli prokaryotic expression system, and the expressed antigen was collected and purified.

[0027] Furthermore, the vector includes but is not limited to Ferritin; the expression vector includes but is not limited to pET-20b; and the recombinant bacteria includes but is not limited to Escherichia coli.

[0028] Another object of the present invention is to provide a feline herpes virus epitope vaccine, which comprises a pharmaceutically acceptable adjuvant and a carrier.

[0029] Furthermore, the preparation method of the feline herpes epitope vaccine comprises: transferring the recombinant plasmids FHB1F and FHB2F into Escherichia coli BL21, fermenting with engineered bacteria, separating the supernatant, purifying with a Ni column, and dialysis and concentrating to obtain the feline herpes epitope vaccine.

[0030] Furthermore, the immunization routes of the feline herpes virus vaccine are subcutaneous injection and nasal mucosal immunization, but are not limited to these two routes.

[0031] In combination with the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solutions to be protected by the present invention are as follows:

[0032] First, currently, there are two main types of vaccines for FHV-1: modified live attenuated vaccine (MLV) and inactivated vaccine. The inactivated vaccine for FHV-1 was first developed in the 1970s, but it can only alleviate the diseases caused by FHV-1 but cannot prevent them, and its immunogenicity is poor. The live attenuated vaccine contains a complete viral genome, and the participation of these genes will better stimulate the body to produce immune regulation. Although it has undergone various treatments, it also retains some virulence, and improper vaccination can easily lead to some safety hazards.

[0033] The present invention is dedicated to epitope peptide vaccines. Currently, the use of epitopes has become a general trend in vaccine development because they are easily processed and presented by antigen presenting cells, leading to effective cell-mediated immune responses. Compared with some traditional vaccines, epitope-based vaccines are more likely to overcome some limitations, namely, more direct production, fewer side effects, higher purity, higher production efficiency, etc., and are considered to be one of the alternatives to conventional vaccines.

[0034] The present invention proves, through the immunogenicity test of the vaccine, that the epitope peptides B1 and B2 and the epitope vaccine prepared therefrom have excellent immunogenicity, can effectively induce the body's humoral and cellular immune responses, have good safety, can be applied to FHV-1 vaccines, and provide new ideas and basis for the research and development of new FHV-1 vaccines.

[0035] Second, as the number of people who choose to keep pets gradually increases, the economy brought about by pet keeping is also undergoing major changes, and people's requirements for keeping pets are getting higher and higher. Dogs and cats are the choices of most families. It is reported that my country has already formed a market of hundreds of billions of yuan in pet keeping. In the past five years, the market size has doubled to 300 billion yuan. Among them, pet preventive care and medical treatment account for the vast majority. People who regard pets as a member of the family value the health of their pets the most. Feline herpes is one of the concentrated and susceptible diseases that cats must prevent. There is a huge market demand for feline herpes vaccines. Whether it is the difficulty of treating feline herpes virus, the urgency of improving the current vaccines on the market, or the huge market demand for cat vaccines, the study of canine distemper vaccines has its practical significance and important value.

[0036] In recent years, the research on vaccines has become more and more in-depth. Among them, the pet vaccine "Felix Trio" is a triple inactivated vaccine developed based on feline calicivirus (FCV), feline rhinotracheitis, and feline panleukopenia (FPV). It is one of the most widely used vaccines in the world and is also the main feline vaccine in China. However, compared with FCV and FPV, the protective effect of the cat triple vaccine against FHV-1 infection is limited and the duration is shorter.

[0037] The present invention is devoted to developing an epitope peptide vaccine with high immunogenicity to feline herpes, which can resist feline herpes virus in a targeted and efficient manner. The research results of the present invention also show that the epitope peptide vaccine has a good binding level and neutralization level to feline herpes virus, and can effectively stimulate the production of cytokines. Moreover, the present invention adopts an Escherichia coli prokaryotic expression system, which has the advantages of low cost and good safety.

[0038] In addition, studies have found that the stimulation of FHV-1 mucosal respiratory immunity plays a vital role in stimulating the body to produce antibodies to form a more comprehensive protection, so there are now commercial vaccines on the market for mucosal respiratory immunity through intranasal (IN) vaccination. In the present invention, mucosal immunization is performed by nasal drops, and the serum of mice immunized with nasal mucosa is also tested for specific antibodies. The test results show that the specific antibody titers of the two epitope peptide vaccines are 4.9×10 3 and 1.92×10 4 , the IgG level induced by subcutaneous immunization is nearly one order of magnitude lower, but this invention lays the foundation for subsequent feline herpes nasal spray vaccine.

[0039] Third, the expected benefits and commercial value of the technical solution of the present invention after transformation are:

[0040] The global pet market has shown steady growth over the past decade, and will reach 280 billion yuan by 2023. Among them, pet cats account for 30.7%. The pet market mainly includes pet food, pet supplies, pet health products, pet medical care and other fields, and pet medical care accounts for 21.87% of the total pet consumption. In this field, namely the cat vaccine field, there are few pet vaccine manufacturers in China, and the cat vaccine field is almost blank. In 2011, Miao Sanduo obtained a formal approval document through the approval of the Ministry of Agriculture and Rural Affairs of China and entered the Chinese market. It is the only cat trivalent vaccine approved in the Chinese market in more than ten years. Cat vaccines are all imported. Imports have become more difficult after the epidemic, resulting in a shortage of supply and a doubling of vaccine prices. Therefore, it is urgent to develop China's own cat vaccine. The epitope peptide vaccine of the present invention has the advantages of low cost, good immunogenicity, and good safety. If the results are transformed, it will bring huge expected benefits and commercial value.

[0041] The technical solution of the present invention fills the technical gap in the industry at home and abroad: As mentioned above, one of the most widely used vaccines in the world is the "Miao Sanduo" vaccine under Zoetis, but it is an inactivated triple vaccine and still has the problem of low immunogenicity, requiring multiple vaccinations. The present invention uses an epitope peptide vaccine to screen the FHV-1gB dominant epitope peptide to stimulate specific humoral and cellular immune responses. In addition, no nasal spray cat herpes vaccine has been found on the market at home and abroad. The present invention explores the mucosal immune effect of the cat herpes epitope peptide vaccine, which undoubtedly fills the gap in the industry in this field at home and abroad.

[0042] (3) The technical solution of the present invention solves a technical problem that people have been eager to solve but have never been successful: for a long time, imported vaccines have been in a monopoly position in my country. Recently, the triple inactivated vaccine for feline rhinotracheitis, feline calicivirus disease, and feline panleukopenia (WX strain + SH14 strain + 0918 strain) developed by the companion animal biosafety risk warning and prevention and control technical team of the Shanghai Veterinary Research Institute of the Chinese Academy of Agricultural Sciences passed the emergency evaluation of the Ministry of Agriculture and Rural Affairs and obtained production approval, marking a zero breakthrough in domestic cat vaccines. However, both imported vaccines and domestic vaccines are inactivated vaccines, which have the disadvantages of poor immunogenicity and the need for multiple injections. The present invention uses genetic engineering to screen dominant epitope peptides, stimulate good humoral immunity and cellular immune responses against FHV-1, reduce the number of injections, and prolong immunity, laying the foundation for the subsequent approval of domestic epitope peptide vaccine production.

[0043] Fourth, compared with experimental methods, bioinformatics-based epitope prediction methods offer several significant advantages:

[0044] Efficient and cost-effective: Epitope prediction through computational analysis greatly reduces the time and cost of experiments.

[0045] Comprehensiveness: Ability to comprehensively evaluate the entire protein sequence without being limited by physical experimental conditions.

[0046] High-throughput screening capability: A large number of sequences can be analyzed quickly, suitable for high-throughput research.

[0047] Assisted experimental design: The information provided can be used to guide subsequent experimental verification and improve the efficiency and success rate of the experiment.

[0048] In summary, the bioinformatics-based approach you describe provides an effective alternative for rapid and comprehensive identification of immunogenic regions of pathogen proteins, particularly for settings where resources are limited or a rapid response is required. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments of the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0050] Figure 1 A secondary structure analysis diagram of FHV-1gB provided in an embodiment of the present invention;

[0051] Figure 2A prediction diagram of the hydrophilicity, antigenicity and surface accessibility of FHV-1gB provided in an embodiment of the present invention;

[0052] Figure 3 An amino acid conservation evaluation diagram of two epitopes provided in an embodiment of the present invention;

[0053] Figure 4 Native-PAGE and SDS-PAGE of the recombinant protein provided in the embodiment of the present invention; F, Ferritin; M, marker; 1, FHB1F; 2, FHB2F;

[0054] Figure 5 TEM images of FHB1F and FHB2F provided in the embodiments of the present invention;

[0055] Figure 6 Figure 1 is a graph showing the antibody serum binding activity detection provided in an embodiment of the present invention; Figure A, B1-specific antibody titer in serum 14 days after 3 immunizations; Figure B, B2-specific antibody titer in serum 14 days after 3 immunizations; Figures C and D, B1 and B2-specific antibody titers at different time points; Figure E, B1 and B2-specific antibody titers in serum of mice immunized with nasal mucosa;

[0056] Figure 7 Figure 1 is a diagram of serum antibody typing after immunization with different nanoparticles provided in the embodiments of the present invention; Figure A, serum IgG1 and IgG2a titers of mice immunized subcutaneously; Figure B, serum IgG1 and IgG2a titers of mice immunized mucosally; Figure C, nasal wash SIgA titer; Figure D, lung lavage fluid SIgA titer;

[0057] Figure 8 Figure 1 is a diagram showing the neutralization activity of different immune sera provided in an embodiment of the present invention against FHV-1 virus; Figure A, neutralization activity detection of subcutaneous immunization group mouse sera against FHV-1 virus; Figure B, neutralization activity detection of mucosal immunization group mouse sera against FHV-1 virus;

[0058] Fig. 9 CD4 provided in the embodiment of the present invention + With CD8 + Figure 1. Proliferation level of T lymphocytes. Figure A and B. CD3 in spleen lymphocytes in subcutaneous and mucosal immunization groups. + CD4 + T cell percentage; Figure C and Figure D, subcutaneous and mucosal immunization groups, CD3 in spleen lymphocytes + CD8 + T cell percentage;

[0059] Fig.10The spleen lymphocyte factor detection diagram provided in the embodiment of the present invention; Figure A and Figure B, ELISA detection of IFN-γ and IL-4 cytokine secretion of spleen lymphocytes of subcutaneously immunized mice; Figure C and Figure D, ELISA detection diagram of IFN-γ and IL-4 cytokine secretion of spleen lymphocytes of mucosal immunized mice. DETAILED DESCRIPTION

[0060] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0061] In view of the problems existing in the prior art, the present invention provides two dominant epitope peptide sequences of FHV-1gB and their application in feline herpes virus vaccine.

[0062] The two dominant epitope peptide sequences of FHV-1gB provided in the embodiment of the present invention, the amino acid sequences of the two dominant epitope peptide sequences B1 and B2 of FHV-1gB are SEQ ID NOs: 1-2, and the nucleotide sequences are SEQ ID NOs: 3-4.

[0063] SEQ ID NO: 1, Leu Arg Asp Gly Ala His Val Glu His Thr Ser Ser Asp ArpPhe Gln Ile Glu Gly Tyr

[0064] SEQ ID NO: 2, Ala Leu Lys Phe Tyr Asp Ile Asp Ser Ile Val Arg Val AspAsn Leu Val Ile Met Arg Gly

[0065] SEQ ID NO: 3, ctgcgcgatggcgcgcatgtggaacataccagctatagcagcgatcgctttcagcagatt gaaggctat

[0066] SEQ ID NO: 4, gcgctgaaattttatgatattgatagcattgtgcgcgtggataacaacctggtgattatg cgcggc

[0067] The method for screening the FHV-1gB dominant epitope peptide provided in an embodiment of the present invention comprises: using FHV-1gB as the target protein for epitope peptide prediction by bioinformatics, and screening its dominant antigenic epitopes based on the protein amino acid properties, including hydrophilicity, surface accessibility, secondary structure, flexibility, conservation and antigenicity.

[0068] Further, a gene sequence encoding the epitope peptide.

[0069] An embodiment of the present invention provides an application of two-segment FHV-1gB dominant epitope peptide in a feline herpes virus vaccine.

[0070] Furthermore, the dominant epitope peptide was connected to the Ferritin vector gene in the form of 3 copies and expressed in an Escherichia coli prokaryotic expression system, and the expressed antigen was collected and purified.

[0071] Furthermore, the vector includes but is not limited to Ferritin; the expression vector includes but is not limited to pET-20b; and the recombinant bacteria includes but is not limited to Escherichia coli.

[0072] An embodiment of the present invention provides a feline herpes virus epitope vaccine, which comprises a pharmaceutically acceptable adjuvant and a carrier.

[0073] Furthermore, the preparation method of the feline herpes epitope vaccine comprises: transferring the recombinant plasmids FHB1F and FHB2F into Escherichia coli BL21, fermenting with engineered bacteria, separating the supernatant, purifying with a Ni column, and dialysis and concentrating to obtain the feline herpes epitope vaccine.

[0074] Furthermore, the immunization routes of the feline herpes virus vaccine are subcutaneous injection and nasal mucosal immunization, but are not limited to these two routes.

[0075] Example 1: Bioinformatics analysis of the dominant antigenic epitopes of FHV-1gB

[0076] 1) FHV-1gB published by NCBI, with accession number YP_003331552.2 and an amino acid sequence length of 918aa. The secondary structure information of FHV-1gB was analyzed and predicted online using SOPMA software. According to the SOPMA prediction results, the content of random coiled amino acid residues in FHV-1_gB was the highest at 42.62%, the α-helix was composed of 36.29% amino acid residues, and the amino acid residues contained in β-turns and β-folds accounted for 16.46% and 4.64%, respectively. Suitable random coiled and β-turned amino acid residue sites were selected as potential antigenic epitopes of FHV-1_gB and used as one of the evaluation criteria ( Figure 1 ).

[0077] Total sequence length: 948 aa;

[0078] Alpha helix: 36.29%;

[0079] Beta turn: 4.64%

[0080] Random coil: 42.62%;

[0081] Extended strand: 16.46%.

[0082] 2) DNASTAR Protean software was used to analyze the hydrophilicity and antigenicity of FHV-1gB to assist in the analysis of the dominant B cell antigen epitopes of FHV-1gB ( Figure 2 ).

[0083] 3) The linear epitope parameters of B cell antigens predicted by ABCpred, BCPREDS and BepiPred, the parameters of the secondary structure amino acid residue sites predicted by SOPMA and DNAStar, and the parameters of B cell conformational epitopes predicted by ElliPro were used. Finally, two suitable dominant B cell antigen epitopes were selected as the research focus of the experiment, namely B1:315-337 and B2:751-722, and the amino acid conservation of the two epitopes was evaluated using the Clustal W tool. The results showed that the two amino residues were not only highly antigenic but also highly conserved ( Figure 3 , Figure 3 The middle left figure shows the location of B1 and B2 sequences on the tertiary structure of FHV-1gB; Figure 3 The middle right picture shows the conservation analysis of B1 and B2 sequences;).

[0084] Example 2: Construction and preparation of epitope nanoparticles containing B1 and B2 epitope peptides based on Ferritin carrier

[0085] This embodiment uses the Ferritin vector, which was constructed and expressed by the National Engineering Laboratory for AIDS Vaccines of Jilin University. The target fragments of the three epitope copies were connected in series through Linker (GGGGS) and connected to the N-terminus of the Ferritin sequence. The target gene and the vector pET20b (+) were connected using enzymes NdeⅠ and BamHⅠ to obtain the final recombinant plasmids FHB1F and FHB2F. The recombinant plasmids were induced to express on a large scale under the conditions of 16°C and 0.5mM IPTG overnight induction. The supernatant was obtained by ultrasonic disruption and purified by a HisTrap affinity column loaded with nickel ions. The protein obtained after purification was dialyzed to remove the imidazole contained, and the protein was concentrated using an ultrafiltration tube. In order to verify whether the protein obtained after the final dialysis and concentration formed a nanostructure, 15% SDS-PAGE and 6% Native-PAGE were used for identification. Ferritin, FHB1F and FHB2F all have a single band with high molecular weight and no obvious mixed bands, indicating that the purity meets the requirements of subsequent experiments ( Figure 4 ). Using transmission electron microscopy (TEM) to observe the structures of Ferritin, FHB1F and FHB2F, it was found that the two recombinant proteins were successfully expressed using the E. coli expression system and self-assembled to form nanocage-like particles ( Figure 5 , Figure 5 The middle left picture is the TEM of FHB1F. Figure 5 The middle right picture is the TEM of FHB2F;).

[0086] Example 3: Immunization of BALB / c mice with feline herpes epitope nanoparticle vaccine

[0087] This study involved two immunization methods, subcutaneous injection and nasal mucosal immunization. Experimental Animals BALB / c female mice were purchased from Liaoning Changsheng Biotechnology Co., Ltd., 4-6 weeks old and weighing 18-20g. The Prime-1stboost-2nd boost immunization strategy was used, with an immunization interval of two weeks.

[0088] 1) Subcutaneous injection immunization route (sc): The immunogen is prepared according to the recombinant protein concentration and the amount of adjuvant added. The dose of recombinant protein for mouse immunization is 15-20μg, 100μL / mouse. Al(OH)3 adjuvant and immunogen are mixed in a 1:1 ratio for subcutaneous co-immunization.

[0089] 2) Nasal mucosal immunization (in): FHB1F and FHB2F were immunized via the nasal mucosal route without adding other adjuvants. A Ferritin control group was set up. The immunization dose was the same as that of subcutaneous administration, which was 15-20μg, 20μL / mouse.

[0090] Example 4: Determination of humoral and cellular immunity levels in each group of immunized mice

[0091] Shanghai Jier Biochemical Co., Ltd. was commissioned to prepare B1 and B2 epitope peptides, and liquid chromatography-mass spectrometry (HPLC-MS) technical analysis ensured that the purity of B1 and B2 epitope peptides was >90%.

[0092] 1) ELISA was used to detect total serum IgG antibodies.

[0093] Before the first immunization, 2 weeks after each immunization, and 12 weeks, blood was collected from mice in each immunization group to separate serum. B1 and B2 epitope peptides were used as coating sources. The serum of immune mice was used as the primary antibody, and HRP-conjugated goat anti-mouse antibody was used as the secondary antibody. The total IgG titer in the serum of immune mice was detected by ELISA.

[0094] The results showed that subcutaneous and mucosal immunization of FHB1F and FHB2F could produce specific antibodies against their respective epitopes, and the antibody levels could remain stable in vivo for more than 12 weeks ( Figure 6 ).

[0095] 2) Serum antibody typing test

[0096] The total IgG typing titer in the sera of immune mice was detected by ELISA method, using the sera of immune mice as the primary antibody, goat anti-mouse IgG1 and IgG2a antibodies as the secondary antibody, and HRP-conjugated rabbit anti-goat antibody as the tertiary antibody.

[0097] The results showed that the IgG1 / IgG2a ratio of both nanoparticles was greater than 1, indicating that both tended to activate the Th2 pathway to promote humoral immune response ( Figure 7 ).

[0098] 3) Mucosal-specific SIgA antibody detection

[0099] The mice were euthanized after blood was collected on a sterile operating table. The limbs and head of the mice were fixed on a foam board, and the neck of the mice was disinfected by wiping with alcohol cotton. The skin on the neck of the mice was cut to expose the trachea, and a "V"-shaped opening was cut. 300 μL of sterile PBS was sucked into the syringe in advance, and a white gun tip was fixed. The gun tip was inserted along the opening, and PBS was slowly injected. The chest cavity of the mouse was pressed for 5 seconds, and the PBS was sucked back. Repeat 3 times, place it in an EP tube, and mark the lung lavage fluid. SIgA has a short half-life and should be tested as soon as possible. It should be frozen at -20°C to avoid repeated freezing. The subsequent detection method refers to the serum antibody typing test, in which the secondary antibody is changed to HRP-conjugated goat anti-mouse SIgA antibody.

[0100] The results showed that intranasal vaccination with FHB1F and FHB2F nanoparticle vaccines induced high titer SIgA antibody levels ( Figure 7 ).

[0101] 4) Neutralization activity detection

[0102] Add 50 μL of DMEM virus culture medium to 8 1.5 mL EP tubes, add 50 μL of serum to the first tube, dilute to the 8th tube in turn, discard 50 μL, add 50 μL of 100 TCID50 FH-B5 (FHV-1 virus strain) to each tube, mix slowly by pipetting, and incubate in a 37 ° C incubator for 30 min. Take the above different groups of immune serum-virus mixture and add it to a 96-well plate, then add FK81 cells (1.5×10 4 cells / well) and cultured in a 37°C incubator. After 48 hours of incubation, the ID 50 50% inhibitory dose (ID 50 ) is defined as the serum dilution that neutralizes 50% of the virus.

[0103] The results showed that the FHB2F immunization group had a certain neutralizing activity, but the FHB1F immunization group had no neutralizing activity. In addition, under the same FHB2F immunogen, the neutralizing ability of the subcutaneous immunization group was higher than that of the mucosal immunization group ( Figure 8 ).

[0104] 5) Flow cytometry of T lymphocytes

[0105] Sterilize gauze, scissors, tweezers, etc. in advance. Remove the mouse spleen tissue under sterile conditions, remove the connective tissue as much as possible, and mark it. Place the sterile gauze on a plate, add 5mL of tissue diluent, place the spleen on the gauze, grind it with a 5mL syringe plug, and after grinding, rinse the gauze with 2mL of tissue diluent, transfer it to a centrifuge tube, and collect the cell suspension. Discard the supernatant, add 2-3mL of red blood cell lysis buffer, mix thoroughly to lyse the red blood cells, react at 4℃ for 20min, and centrifuge at 250g for 10min at 4℃. After centrifugation, discard the supernatant, use 2mL of RPMI 1640 culture medium, mix the spleen cells thoroughly, and centrifuge at 250g for 10min. Discard the supernatant, resuspend with 5mL of RPMI 1640 containing 10% FBS, centrifuge at 250g for 10min, discard the supernatant, and set aside the cells. Resuspend spleen lymphocytes with Cell Stating Buffer, count, 105 cells / mL, 100μL / EP tube. Add fluorescent conjugated antibodies (5μL CD3-FITC, 3μL CD4-APC, 3μL CD8-PE) to the EP tubes respectively. Incubate on ice in the dark for 20 minutes, centrifuge at 350g for 5 minutes, and discard the supernatant. Wash twice with 1mL Cell Stating Buffer. Resuspend cells in 500μL CellStating Buffer, add 5μL 7-AAD, incubate on ice in the dark for 5 minutes, and immediately perform flow cytometry.

[0106] The results showed that all immune groups, including mucosal immune groups, tended to have CD3 + CD4 + T cells and CD3 + CD8 + The trend of T cell differentiation increased to varying degrees ( Fig. 9 ).

[0107] 6) Cytokine detection

[0108] 10% FBS RPMI 1640 was used to culture lymphocytes in 24-well plates. 5 cells / well. Synthetic epitope peptides were co-incubated with cells at 10 μg / well and cultured at 37°C for 24 h. The supernatant was aspirated and centrifuged at 12,000 rpm for 2 min. The precipitate was discarded to remove residual cells. The cytokine IFN-γ and IL-4 content were detected by ELISA.

[0109] The results showed that in the subcutaneous immunization group, the lymphocytes of the FHB1F and FHB2F immunization groups secreted higher levels of IFN-γ cytokines and a certain level of IL-4 cytokines after stimulation, indicating that the FHB1F and FHB2F immunization groups were mainly inclined to induce Th1 pathway-induced cellular immune responses. In the mucosal immunization group, FHB1F and FHB2F induced higher levels of Th1 and Th2 pathway cytokines than subcutaneous immunization, thereby triggering a certain level of cellular and humoral immune responses ( Fig.10 ).

[0110] At present, FHV-1 is widely prevalent worldwide. After infection, it is easy to cause serious respiratory diseases in cats, which has become one of the major problems threatening the life and health of cats. Vaccination has always been an effective method for preventing and controlling FHV-1. However, the existing vaccines or drugs have not been ideal in preventing infection and curing FHV-1. Data show that humoral and cell-mediated immune (CMI) responses are important for protecting and clearing herpes virus infection. In this work, in order to better present antigenic epitopes, we chose Ferritin nanocages as vaccine carriers, successfully displayed two nanoparticles FHB1F and FHB2F expressed by Escherichia coli, and clearly showed the good uniformity of the two nanoparticles by TEM and DLS analysis. We explored the two immunization routes of intranasal immunization and subcutaneous injection as a focus of nanoparticle vaccine development. By analyzing mouse serum, it was found that both nanoparticle vaccines could induce abundant B1 and B2 epitope-specific IgG in both intranasal and subcutaneous immunization routes, but the level of specific antibodies induced by intranasal immunization was one order of magnitude higher, but this also laid the foundation for the subsequent development of nasal spray vaccines. No obvious CTL killing effect was observed in the FHB1F immunization group, while there was a more significant CTL killing effect in the FHB2F immunization group, indicating that the lymphocytes in the FHB2F immunization group can destroy cells infected with FHV-1 by target cell lysis or mediating target cell apoptosis, thereby protecting the body. During the vaccination period, no abnormal performance was observed in the mice of each immunization group, and the results of the tissue sections of the mice also showed that there were no side effects after vaccination with FHB1F and FHB2F nanoparticle vaccines, indicating that both nanoparticles have certain safety. In summary, in the present invention, two epitope nanoparticle vaccines were designed based on the Ferritin nanoparticle platform through immune bioinformatics, and related immune evaluations were performed. Although we have proved in vitro that the FHB2F nanoparticle vaccine has certain neutralizing activity, due to the limitations of the mouse model, we need to evaluate the protective power on felines, which will be our next step.

[0111] The above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with the technical field within the technical scope disclosed by the present invention and within the spirit and principle of the present invention should be covered by the protection scope of the present invention.

Claims

1. Two dominant epitope peptide sequences of FHV-1gB, It is characterized in that The two segments of FHV-1gB dominant epitope peptide sequence B 1 and B 2 The amino acid sequence is SEQ ID NO: 1-2, and the nucleotide sequence is SEQ ID NO: 3-4.

2. The two segments of FHV-1gB dominant epitope peptide sequences as claimed in claim 1, It is characterized in that The method for screening the FHV-1gB dominant epitope peptide comprises: using FHV-1gB as the target protein predicted by the bioinformatics method as the epitope peptide, and screening its dominant antigenic epitopes based on the protein amino acid properties, including hydrophilicity, surface accessibility, secondary structure, flexibility, conservation and antigenicity.

3. The two segments of FHV-1gB dominant epitope peptide sequences as claimed in claim 1, It is characterized in that The gene sequence encoding the epitope peptide.

4. Use of the two segments of FHV-1gB dominant epitope peptides as claimed in any one of claims 1 to 3 in feline herpes virus vaccines.

5. An application of the two-segment FHV-1gB dominant epitope peptide in a feline herpes epitope vaccine as claimed in claim 4, It is characterized in that The dominant epitope peptide was connected to the Ferritin vector gene in the form of 3 copies and expressed in an Escherichia coli prokaryotic expression system, and the expressed antigen was collected and purified.

6. The use of two segments of FHV-1gB dominant epitope peptides in feline herpes virus epitope vaccines as claimed in claim 5, It is characterized in that The vector includes but is not limited to Ferritin; the expression vector includes but is not limited to pET-20b; and the recombinant bacteria includes but is not limited to Escherichia coli.

7. A feline herpes virus epitope vaccine as claimed in claims 1 to 6, It is characterized in that The epitope vaccine comprises a pharmaceutically acceptable adjuvant and a carrier.

8. The feline herpesvirus epitope vaccine according to claim 7, It is characterized in that The preparation method of the feline herpes epitope vaccine comprises: 1 F and FHB 2 F was transferred into Escherichia coli BL21, fermented by the engineered bacteria, and the supernatant was separated. After purification by Ni column, the feline herpes epitope vaccine was obtained by dialysis and concentration.

9. The feline herpesvirus epitope vaccine according to claim 7, It is characterized in that The immunization routes of the feline herpes virus vaccine are subcutaneous injection and nasal mucosal immunization, but are not limited to these two routes.

Images