RNA-guided DNA nuclease and application thereof
Through the formation of complexes between IscB polypeptides and guided nucleic acids, the problem of insufficient flexibility and accuracy of target DNA cleavage in existing gene editing technologies is solved, efficient gene editing in eukaryotic cells is achieved, and a new gene editing tool is provided. .
Patent Information
- Application Number
- CN202410082311.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-12-27
- Filing Date
- 2024-01-19
- Publication Date
- 2024-12-17
AI Technical Summary
Existing gene editing technologies lack flexibility and accuracy in guiding DNA cleavage, making it difficult to effectively modify specific target sequences efficiently.
It provides an IscB polypeptide and its system, which can efficiently identify and cleave specific sequences in the target DNA by forming a complex with the guide nucleic acid, and realize gene editing. The system comprises an IscB polypeptide and a polynucleotide encoding it, as well as a guide sequence capable of hybridizing to a scaffolding sequence and a target DNA that forms a complex with an IscB polypeptide, which is capable of guiding the complex to a guide sequence of a target DNA.
Achieve efficient and precise cleavage and modify target DNA sequences in eukaryotic cells, with similar functions to Cas9 protein, but with different domains and cleavage mechanisms, providing a new gene editing tool that can be used in eukaryotic cells DNA cleavage application is realized.
Smart Images
Figure CN119144582A_ABST
Abstract
Description
This application claims priority and the benefit of the filing date of PCT patent application PCT / CN2023 / 142506 filed on December 25, 2023, and the entire contents of the PCT patent application (including any drawings and sequence listing) are incorporated by reference into this application. Technical Field
[0001] The present invention belongs to the field of gene editing technology and relates to an IscB polypeptide and uses thereof. Background Art
[0002] As a class of endonucleases encoded by the IS200 / IS605 transposon family, IscB proteins exhibit nucleic acid-guided endonuclease activity and have the potential to be used as gene editing tools. Summary of the invention
[0003] In one aspect, the present disclosure provides an IscB polypeptide, whose amino acid sequence is shown in SEQ ID NO:1.
[0004] In another aspect, the present disclosure provides a non-naturally occurring or engineered IscB system or composition comprising: (1) an IscB polypeptide of the present disclosure, or a polynucleotide encoding the IscB polypeptide; and (2) a guide nucleic acid, or a polynucleotide encoding the guide nucleic acid, wherein the guide nucleic acid comprises: (a) a scaffold sequence capable of forming a complex with said IscB polypeptide; and (b) a guide sequence capable of hybridizing to a target sequence in a target DNA, thereby directing the complex to the target DNA.
[0005] In yet another aspect, the present disclosure provides a polynucleotide comprising a polynucleotide encoding the IscB polypeptide of the present disclosure.
[0006] In yet another aspect, the present disclosure provides a vector comprising the polynucleotide of the present disclosure.
[0007] In yet another aspect, the disclosure provides use of an IscB polypeptide of the disclosure, a non-naturally occurring or engineered IscB system or composition of the disclosure, a polynucleotide of the disclosure, or a vector of the disclosure in the preparation of a reagent for modifying a target sequence in a target DNA.
[0008] This disclosure contains a sequence listing XML file submitted electronically in XML format, the entire text of which is incorporated herein by reference. The XML file was created on November 29, 2023 by the "WIPO Sequence" software in accordance with WIPO Standard ST.26, named HEP007CN10.xml, and is 9,709 bytes in size.
[0009] According to WIPO Standard ST.26, the symbol "t" is used to represent T in DNA and U in RNA. Therefore, in the present sequence listing prepared according to ST.26, when the sequence is RNA, T in the sequence should be regarded as U. BRIEF DESCRIPTION OF THE DRAWINGS
[0010] Figure 1 The endonuclease activity of a representative IscB polypeptide, IscB.m14, is shown, indicated by points falling outside the dashed line on the right. DETAILED DESCRIPTION
[0011] 1. Overview As a type of prokaryotic endonuclease encoded by the IS200 / IS605 transposon family, the IscB protein exhibits programmable DNA endonuclease activity that can be guided to the target DNA by a guide nucleic acid, and has certain functional similarities with the Cas9 protein, but does not belong to the Cas protein (CRISPR-associated protein) category, nor does it belong to the Cas9 protein category. The IscB protein contains PLMP, RuvC I, BH, linker, RuvCII, HNH, RuvC III, P1D and TID domains, of which the HNH and RuvC domains are responsible for cutting the targeted and non-targeted DNA chains of dsDNA, respectively. The guide nucleic acid that guides the IscB protein can be RNA, which is called guide RNA (gRNA) or omega RNA (ωRNA). The guide nucleic acid comprises a scaffold sequence capable of interacting with the IscB protein to form a complex (protein-RNA complex) and a guide sequence (also called spacer sequence) capable of hybridizing with a target sequence in a target DNA, thereby guiding the complex to the target DNA.
[0012] 2. IscB polypeptide In one aspect, the present disclosure provides an IscB polypeptide, whose amino acid sequence is shown in SEQ ID NO: 1. The IscB polypeptide exhibits DNA cleavage activity and is suitable for DNA cleavage applications, such as in eukaryotic cells, such as cleaving eukaryotic cell genomes. The present disclosure also provides an IscB polypeptide, which comprises the amino acid sequence shown in SEQ ID NO: 1, or comprises an amino acid sequence having at least about 60% (e.g., at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity with the amino acid sequence shown in SEQ ID NO: 1. In some embodiments, the IscB polypeptide is isolated.
[0013] 3. Guide RNA In another aspect, the present disclosure provides a guide nucleic acid, or a polynucleotide encoding the guide nucleic acid, comprising: (a) a scaffold sequence capable of forming a complex with an IscB polypeptide of the present disclosure; and (b) a guide sequence capable of hybridizing to a target sequence in a target DNA, thereby directing the complex to the target DNA.
[0014] In some embodiments, the scaffold sequence is as shown in SEQ ID NO: 3. In some embodiments, the scaffold sequence comprises the polynucleotide sequence shown in SEQ ID NO: 3, or comprises a polynucleotide sequence having at least about 60% (e.g., at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to the polynucleotide sequence shown in SEQ ID NO: 3.
[0015] 4. IscB system or composition In yet another aspect, the present disclosure provides an IscB system or composition comprising: (1) an IscB polypeptide of the present disclosure, or a polynucleotide encoding the IscB polypeptide; and (2) a guide nucleic acid, or a polynucleotide encoding the guide nucleic acid, wherein the guide nucleic acid comprises: (a) a scaffold sequence capable of forming a complex with an IscB polypeptide of the present disclosure; and (b) a guide sequence capable of hybridizing to a target sequence in a target DNA, thereby directing the complex to the target DNA.
[0016] In some embodiments, the IscB system or composition is non-naturally occurring or engineered.
[0017] In some embodiments, the target DNA is a target dsDNA. In some embodiments, the target DNA is a prokaryotic DNA. In some embodiments, the target DNA is a eukaryotic DNA.
[0018] In some embodiments, the guide nucleic acid is a guide nucleic acid of the disclosure.
[0019] In some embodiments, the guide sequence is about 14 nucleotides in length or at least about 14 nucleotides in length, for example, about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 nucleotides in length. 64, 65, 66, 67, 68, 69, or 70 nucleotides in length, or a range of values between any two of the foregoing values, for example, from about 16 to about 50 nucleotides in length.
[0020] In some embodiments, the guide sequence is about 90-100% complementary to the target sequence of the target DNA. In some embodiments, the guide sequence is 100% complementary to the target sequence of the target DNA.
[0021] In some embodiments, there are no more than 1, 2, 3, 4, or 5 mismatches between the guide sequence and the target sequence.
[0022] In some embodiments, the IscB system comprises a plurality (e.g., 2, 3, 4, 5, or more) of guide sequences capable of hybridizing to a plurality of target sequences, respectively.
[0023] In some embodiments, the scaffold sequence is at the 5' end or the 3' end of the guide sequence.
[0024] In some embodiments, the multiple target sequences are on the same polynucleotide, or on separate polynucleotides.
[0025] In some embodiments, the IscB system further comprises a donor DNA template for integration into the target DNA. In some embodiments, after the IscB polypeptide of the present disclosure cleaves the target DNA, the donor DNA template is inserted into the target DNA. In some embodiments, the insertion is performed by homologous recombination.
[0026] In some embodiments, directing the complex to the target DNA results in modification of the target sequence.
[0027] In some embodiments, the modification of the target sequence is a double-stranded cut or a single-stranded cut of the target sequence. In some embodiments, the double-stranded cut or the single-stranded cut of the target sequence results in a deletion and / or an insertion mutation (Indel). In some embodiments, the deletion and / or the insertion mutation (Indel) changes the transcription and / or expression of the target sequence.
[0028] In some embodiments, directing the complex to the target DNA results in modification of transcription of the target sequence.
[0029] In some embodiments, the modification of transcription of the target sequence is transcriptional upregulation, transcriptional downregulation, transcriptional activation, or transcriptional repression.
[0030] 5. Polynucleotides In yet another aspect, the present disclosure provides a polynucleotide comprising (1) a first polynucleotide encoding an IscB polypeptide of the present disclosure; and / or (2) a second polynucleotide encoding a guide RNA of the present disclosure.
[0031] In some embodiments, the first polynucleotide and / or the second polynucleotide is codon-optimized for expression in eukaryotic (eg, mammalian, such as human) cells.
[0032] In some embodiments, the first polynucleotide and the second polynucleotide are encoded on the same or different polynucleotides. In some embodiments, when encoded on the same polynucleotide, the first polynucleotide is at the 3' end or the 5' end of the second polynucleotide.
[0033] 6. Carrier In yet another aspect, the present disclosure provides a vector comprising the polynucleotide of the present disclosure.
[0034] In some embodiments, the vector is a plasmid. In some embodiments, the vector is a retroviral vector, a phage vector, an adenoviral vector, a herpes simplex virus (HSV) vector, an AAV vector or a lentiviral vector. In some embodiments, the AAV vector is a recombinant AAV vector of serotype AAV1, AAV2, AAV3, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV.PHP.eB, a member of the evolutionary branch to which any one of AAV1-AAV13 belongs, or a functional truncated variant or a functional mutant thereof.
[0035] 7. Modification method In yet another aspect, the present disclosure provides a method for modifying a target sequence in a target DNA, comprising contacting the target DNA with the IscB polypeptide of the present disclosure, the IscB system or composition of the present disclosure, the polynucleotide of the present disclosure, or the vector of the present disclosure, wherein the target sequence is modified by the complex.
[0036] In yet another aspect, the present disclosure provides use of the IscB polypeptide of the present disclosure, the IscB system or composition of the present disclosure, the polynucleotide of the present disclosure, or the vector of the present disclosure in the preparation of a reagent for modifying a target sequence in a target DNA.
[0037] In yet another aspect, the disclosure provides an IscB polypeptide of the disclosure, an IscB system or composition of the disclosure, a polynucleotide of the disclosure, or a vector of the disclosure for use in modifying a target sequence in a target DNA.
[0038] The sequences mentioned in this disclosure are as follows: SEQ ID NO: 1, IscB.m14 amino acid sequence, 487aa MNTYVYVQASDGTPLMPTKRKHHVQKLLKRGKAVVVEHVPFVVRLKYKGPKNVQPLYGGTDPGRTNLGDSVMTSDGTVVYKDHVETRNKEVAKLMAGRRGFRQASRRGERLARKRLAKRLGTTTKKLLERVLPGCGKPVKVKDIINTEARFNNRHRPENWITPSVRQLVQTHVNMVRRIRKFLPVDTWTLETNKFAFMKLDDGSVVGTDFQNGKLRGYKDDDDYVFHLQNGRRIDHYHHIVPKSRGGSDRWYNKAGLCNGCHDKVHTGKIDLSAAGEKKRYAGLSVLNQAIPRIAEEIGKTVRHFNTCTGRDTHDIRELFGIEKDHDNDAVCIAAYGAPVSEIKDTVHTYEVKQCRRHDRARIRSQRERTYCVQNGFTKKGKLKYKIVAKNRRPRYEQEKSGYKALSDMGYTRQQISMLHVKKSMRYYNDTGRNLPGMEFFHNGRRYVKSGQSNGGLYLRAEGQGKTNFPASECRIVKKNRGLVYLS SEQ ID NO:2, Coding sequence of IscB.m14, 1461bp SEQ ID NO:3, Scaffold sequence, 240 nt GTCAATAACCCATGACTGAAGTCACGGGCTTGCGGTCGCAGGCCGTTAGTTTGTGATACAGTTATGCATTGTTGAGCAGAGGCATGACACGCCGCTTACCCCGGAGCGCCTTACTAACTCCGGGCCATGGGCACAGGCGTGCCAAGCCTAAGGAAACATGTCAGGCAGTGCGGAGCTTTACAGGCTGTGAAACACTGCCGCCCCCCTCCGGGGGATTTATCAGGAAAAGGAGGCATAGTG SEQ ID NO:4, Guide sequence, 14 nt CAGTAGGAGCATAC SEQ ID NO:5, Guide RNA, 254 nt CAGTAGGAGCATAC GTCAATAACCCATGACTGAAGTCACGGGCTTGCGGTCGCAGGCCGTTAGTTTGTGATACAGTTATGCATTGTTGAGCAGAGGCATGACACGCCGCTTACCCCGGAGCGCCTTACTAACTCCGGGCCATGGGCACAGGCGTGCCAAGCCTAAGGAAACATGTCAGGCAGTGCGGAGCTTTACAGGCTGTGAAACACTGCCGCCCCCCTCCGGGGGATTTATCAGGAAAAGGAGGCATAGTG SEQ ID NO:6, Coding sequence of guide RNA, 254 nt CAGTAGGAGCATAC GTCAATAACCCATGACTGAAGTCACGGGCTTGCGGTCGCAGGCCGTTAGTTTGTGATACAGTTATGCATTGTTGAGCAGAGGCATGACACGCCGCTTACCCCGGAGCGCCTTACTAACTCCGGGCCATGGGCACAGGCGTGCCAAGCCTAAGGAAACATGTCAGGCAGTGCGGAGCTTTACAGGCTGTGAAACACTGCCGCCCCCCTCCGGGGGATTTATCAGGAAAAGGAGGCATAGTG SEQ ID NO:7, Target sequence, 14 nt CAGTAGGAGCATAC It should be understood that any title or subheading of the present disclosure is used for illustrative purposes only and not for limiting purposes, and any implementation in any section under any title or subheading may be combined with any other implementation in the same section or different sections without departing from the scope of the present disclosure.
[0039] Example 1: Evaluation of endonuclease activity of representative IscB polypeptides.
[0040] A representative IscB polypeptide recently identified by applicants, designated IscB.m14 (SEQ ID NO: 1), was selected for evaluation of its endonuclease activity.
[0041] This example demonstrates the endonuclease activity of this representative IscB polypeptide.
[0042] Design and Build: Expression plasmids and target cleavage plasmids were constructed to detect the endonuclease activity of the representative IscB polypeptide IscB.m14.
[0043] The expression plasmid contains the coding sequence (SEQ ID NO:2) of IscB.m14 (SEQ ID NO:1) under the regulation of lacI promoter and the coding sequence (SEQ ID NO:6) of guide RNA (SEQ ID NO:5) under the regulation of J23119 promoter, wherein the guide RNA consists of a guide sequence (SEQ ID NO:4) and a scaffold sequence (SEQ ID NO:3) in the 5'-3' direction.
[0044] The target cutting plasmid comprises a chloramphenicol resistance gene CmR under the regulation of the cat promoter, and a target sequence (SEQ ID NO:7) intended to be targeted by a guide RNA. The chloramphenicol resistance gene CmR is intended to allow the Escherichia coli transformed by the target cutting plasmid to grow on a culture vessel containing chloramphenicol. Considering that IscB.m14 may have a target sequence recognition preference, it is affected by the TAM (target adjacent motif, target sequence adjacent motif) sequence at the 3' end of the target sequence, and an 8N TAM sequence at the 3' end of the target sequence is also set in the target cutting plasmid, wherein N represents nucleotides A, T, C or G, that is, 4^8=65536 kinds of TAM are given, thereby constituting a target cutting plasmid library containing all possible TAMs.
[0045] When the expression plasmid and the target cutting plasmid library are co-transformed into E. coli (each E. coli cell may be transformed with the expression plasmid and one or more target cutting plasmids), the expression plasmid expresses IscB.m14 and the guide RNA, and the two form a complex, and the guide RNA (and therefore the complex) targets the target sequence contained in the target cutting plasmid. If IscB.m14 has endonuclease activity and can recognize the TAM at the 3' end of the target sequence, it will cut the target sequence, resulting in degradation of the target cutting plasmid and the inability to express the chloramphenicol resistance gene CmR, thereby causing E. coli to be unable to grow in a culture vessel containing chloramphenicol.
[0046] Specifically, according to the manufacturer's instructions, 100ng of expression plasmid and 100ng of target cutting plasmid library were transformed into 30 μL of competent Escherichia coli (TransforMax EC100 Electrocompetent E.coli) by electroporation (experimental group), and a blank control (control group) was prepared at the same time. After transformation, Escherichia coli was cultured at 37°C with shaking for 1 hour, then spread on a culture plate covered with a conventional bacterial culture medium containing chloramphenicol, and grown at 37°C for 12-16 hours. Then Escherichia coli was scraped off the plate, resuspended with culture medium, mixed evenly, and used to extract plasmid (MN). 300ng of the extracted plasmid was used for PCR amplification of the TAM-containing region, and Illumina connectors and barcodes were added for high-throughput sequencing to confirm the cutting situation.
[0047] result: The sequencing results are summarized as follows Figure 1 Each point on the graph represents one of the 65,536 TAMs. Figure 1 The solid line in the figure indicates that the abundance of each TAM in the experimental group E. coli is the same as that of the corresponding TAM in the control group E. coli (ratio 1:1) (for example, the former is 10 -4 , the latter is also 10 -4 ), the dashed lines on the left and right of the solid line represent the statistical +3σ or -3σ, respectively.
[0048] In the absence of recognition and corresponding cleavage of a certain TAM, the abundance of each TAM in the experimental group E. coli should be basically the same as the abundance of the corresponding TAM in the untreated control group E. coli, and the point representing the TAM will basically fall on the solid line.
[0049] If the point representing a TAM falls below the right dashed line (i.e., <-3σ), it means that for the TAM represented by the point and its adjacent target sequence, IscB.m14 recognizes and causes a statistically significant difference in cleavage, resulting in degradation of the target cleavage plasmid and no expression of the resistance gene, which in turn leads to the death of the experimental group E. coli, resulting in the abundance of TAM in the experimental group E. coli collected at the end (e.g., 10 -5 ) is lower than the abundance of the corresponding TAM in the untreated control group (e.g. 10 -4 ), and therefore falls to the lower right of the solid line. When it not only falls to the lower right of the solid line but also falls to the lower right of the dotted line on the right side of the solid line, it indicates that the difference in TAM abundance exceeds the statistical 3σ and is statistically significant.
[0050] Figure 1 It is shown that a large number of points fall to the lower right of the right dashed line, proving that IscB.m14 recognizes and exhibits endonuclease activity for a large number of corresponding TAMs, and can be used to cleave DNA target sequences with the 3' end being these TAMs.
Claims
1. An IscB polypeptide, the amino acid sequence of which is shown in SEQ ID NO:
1.
2. A non-naturally occurring or engineered IscB system or composition comprising: (1) the IscB polypeptide of claim 1, or a polynucleotide encoding the IscB polypeptide; and (2) a guide nucleic acid, or a polynucleotide encoding the guide nucleic acid, wherein the guide nucleic acid comprises: (a) a scaffold sequence capable of forming a complex with said IscB polypeptide; and (b) a guide sequence capable of hybridizing to a target sequence in a target DNA, thereby directing the complex to the target DNA.
3. The non-naturally occurring or engineered IscB system or composition of claim 2, wherein the scaffold sequence is as shown in SEQ ID NO:
3. A polynucleotide comprising a polynucleotide encoding the IscB polypeptide of claim 1.
5. The polynucleotide of claim 4, which is shown in SEQ ID NO:
2. A vector comprising the polynucleotide according to claim 4 or 5.
7. The vector of claim 6, further comprising a polynucleotide encoding a guide nucleic acid, the guide nucleic acid comprising: (a) a scaffold sequence capable of forming a complex with said IscB polypeptide; and (b) a guide sequence capable of hybridizing to a target sequence in a target DNA, thereby directing the complex to the target DNA.
8. Use of the IscB polypeptide of claim 1, the non-naturally occurring or engineered IscB system or composition of claim 2 or 3, the polynucleotide of claim 4 or 5, or the vector of claim 6 or 7 for preparing a reagent for modifying a target sequence in a target DNA.