A gene of Drosophila glycosyltransferase ApCGT67 and its application in preparing bergenin

Abstract

The present invention relates to a kind of glycosyltransferase ApCGT67 The invention discloses a gene and its application in preparing bergenin, belonging to the field of biotechnology. ApCGT67 The gene nucleotide sequence is shown in SEQ ID NO.1, and the full length of the sequence is 1356 bp; the amino acid sequence of the encoded protein is shown in SEQ ID NO.2, and it encodes 451 amino acid residues. ApCGT67 The gene can be used as a biosynthesis regulatory gene for bergenin and can be used to prepare bergenin. It has significant application prospects and is easy to promote and apply.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a gene of a glycosyltransferase ApCGT67 of Aesculus flavus and its application in preparing bergenin. Background Art

[0002] Ardisia pusilla is a plant of the genus Ardisia in the family Primulaceae. This genus is distributed in Guangdong, Guangxi, Yunnan, Sichuan and other places. It grows under sparse forests or in the shade and wet places under forests at an altitude of 500-1540m. There are many medicinal ingredients in Ardisia pusilla, and bergenin is one of the main active ingredients. Bergenin has attracted wide attention due to its various pharmacological activities, such as antitussive, anti-inflammatory, anti-anxiety, antioxidant, anti-malarial, anti-cancer, treatment of diabetes, anti-hepatotoxicity, immunomodulation and neuroprotection. Unlike morphine-like central inhibitory cough suppressants, bergenin has a selective inhibitory effect on the cough center and has no inhibitory effect on other nerve centers. It has the characteristics of small toxic side effects, few adverse reactions, and no drug resistance after continuous use. Bergenin has been made into a variety of dosage forms and is widely used in China to treat respiratory diseases, such as compound bergenin tablets and bergenin capsules.

[0003] The precursor of bergenin biosynthesis is 2-glucose-4-methoxygallic acid, which is generated by intramolecular dehydration, rearrangement and ring closure; 2-glucose-4-methoxygallic acid is generated by 4-methoxygallic acid connecting glucose at the 2-position with uridine diphosphate glucose (UDP-glucose) as the glycosyl donor under the catalysis of carbon glycosyltransferase (CGT); 4-methoxygallic acid is catalyzed by gallic acid oxygen methyltransferase (OMT) with gallic acid as substrate and S-adenosyl-methionine (SAM) as the methyl donor; gallic acid is catalyzed by shikimate dehydrogenases (SDH) with NADP+ as the proton donor.

[0004] With the increasing number of chronic bronchitis diseases, the gap in raw materials for bergenin is increasing. At present, the raw materials for bergenin on the market are mainly obtained by extraction, and the annual demand for dry medicinal materials for extracting bergenin has reached more than 2,000 tons. The extensive mining in recent decades has caused a sharp decline in wild resource reserves and is on the verge of exhaustion. At the same time, the high altitude, many mountainous areas and cold climate conditions in the origin make it difficult to cultivate artificially on a large scale, further expanding the gap in the market for bergenin raw materials and causing prices to rise year by year. In recent years, with the rapid development of the field of synthetic biology, the use of synthetic biology technology to produce natural drug monomers can effectively solve the above problems. However, to understand the biosynthetic pathways of these active ingredients, it is necessary to identify the key genes related to these pathways, and discovering these catalytic enzyme genes has become a key link in studying the biosynthetic pathways of plant metabolites. Currently, the synthesis pathway of 4-methoxygallic acid catalyzing the glycosylation reaction at the C-2 position to form 2-glucose-4-methoxygallic acid has been clarified, but the function of the carbon glycosyltransferase responsible for glycosylation has been less verified, which has affected the advancement of the biosynthesis of bergenin. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a gene of the A. cerana glycosyltransferase ApCGT67, which can be used as a biosynthesis regulatory gene of bergenin and can be used in the preparation of bergenin.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides a gene of the Acanthopanax glycosyltransferase ApCGT67. The nucleic acid sequence of the Acanthopanax glycosyltransferase ApCGT67 gene is shown in SEQ ID NO.1, and the full length of the sequence is 1356 bp.

[0008] The second aspect of the present invention provides a protein encoded by the above-mentioned Jiujielong carbon glycosyltransferase ApCGT67 gene, the amino acid sequence of which is shown in SEQ ID NO.2, encoding 451 amino acid residues.

[0009] The third aspect of the present invention provides a recombinant plasmid containing the above-mentioned Jiujielong carbon glycosyltransferase ApCGT67 gene.

[0010] Preferably, the recombinant plasmid is obtained by homologous recombination of the above-mentioned ApCGT67 gene of the Jiujielong carbon glycosyltransferase with the pET28a vector and is named pET28a-ApCGT67.

[0011] The fourth aspect of the present invention provides a transgenic engineered bacterium, comprising the recombinant plasmid, or the genome of the genetically engineered bacterium is integrated with the exogenous gene of the aforementioned glycosyltransferase ApCGT67.

[0012] Preferably, the genetically modified bacteria is Escherichia coli BL21 (DE3) strain.

[0013] The fifth aspect of the present invention provides an application of the gene of the Dictyophora japonica carbonyl transferase ApCGT67 in the preparation of bergenin.

[0014] Preferably, 4-methoxygallic acid and glycosyl donor uridine diphosphate glucose (UDP-glucose) are used as raw materials, and a glycosylation reaction is carried out at the C-2 position of 4-methoxygallic acid under the catalysis of the glycosyltransferase encoded by the above-mentioned glycosyltransferase ApCGT67 gene to produce bergenin.

[0015] The present invention obtains the target protein after in vitro expression through the recombinant plasmid, and directly generates bergenin by further catalyzing the substrate 4-methoxygallic acid.

[0016] The gene of the glycosyltransferase ApCGT67 of the present invention was identified from the plant of the glycosyltransferase by transcriptome sequencing and bioinformatics technology after a large number of experiments and screening; RNA was extracted from the rhizome of the glycosyltransferase using RNA reagents, and then reverse transcribed into cDNA and amplified by PCR. The amplification primers of the glycosyltransferase ApCGT67 gene of the glycosyltransferase ApCGT67 of the glycosyltransferase ApCGT67 are as follows:

[0017] 5'F:ATGTCTAACTCCGGCAACC; (SEQ ID NO.3)

[0018] 3'R: CTAATTTTTCTTCAACGTAGTAATT; (SEQ ID NO.4)

[0019] In addition, when homologous recombination is performed with the vector pET28a, the ApCGT67 gene needs to be amplified and recovered using primers with homologous walls. The primers with homologous walls are as follows:

[0020] Upstream homology arm primer:

[0021] 5'F: cagcaaatgggtcgcggatccATGTCTAACTCCGGCAACC; (SEQ ID NO: 5)

[0022] Downstream homology arm primer:

[0023] 3'R: acggagctcgaattcggatccCTAATTTTTCTTCAACGTAGTAATT; (SEQ ID NO: 6)

[0024] The glycosyltransferase ApCGT67 gene isolated and identified from the quinquefolius can be used as an important marker gene for the molecular-assisted breeding of quinquefolius, and can also be used as an important candidate gene for the production of bergenin in the construction of yeast chassis cells.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] (1) The present invention provides a gene for the glycosyltransferase ApCGT67 of the Drosophila chinensis, which can be used as a biosynthesis regulatory gene of bergenin and can be used in the preparation of bergenin.

[0027] (2) With the rapid development of bioinformatics technology, the mining of key enzyme genes in the biosynthetic pathway of bergenin has been greatly promoted. The biosynthetic regulatory gene of bergenin in the present invention, namely the carbon glycosyltransferase ApCGT67 gene, was identified and successfully verified for the first time, opening up a new biosynthetic method for producing bergenin. The present invention obtains the target product by enzyme catalysis in vitro through heterologous expression of Escherichia coli proteins, adopts in vitro biosynthesis, and carries out directional production, which has the advantages of less by-products, etc.

[0028] (3) The present invention also provides a recombinant plasmid, a genetically engineered bacterium and a recombinant protein containing the carbon glycosyltransferase ApCGT67 gene, which lays a foundation for synthesizing a large amount of bergenin by bioengineering methods and further for constructing a cell factory that produces bergenin.

[0029] (4) The in vitro biosynthesis of bergenin is highly controllable, which can reduce the demand for raw material planting, produce a single product, facilitate the separation and purification of bergenin in the later stage, and reduce the difficulties of chemical synthesis and the complexity of the synthesis path. The bergenin carbon glycosyltransferase ApCGT67 gene, as a key gene for the biosynthesis of bergenin, can also be used for breeding research of plants rich in bergenin such as Ardisia japonica. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Schematic diagram of the synthetic route derived for bergenin;

[0031] Figure 2 Schematic diagram of the construction of the recombinant expression plasmid pET28a-ApCGT67;

[0032] Figure 3 The electrophoresis test results of the recombinant gene of the glycosyltransferase ApCGT67 of Jiujielong. Among them, M is the nucleic acid Mar, 1 and 2 are the positive single colony test results;

[0033] Figure 4This is the SDS-PAGE protein electrophoresis detection diagram of Jiujielong carbon glycosyltransferase ApCGT67. Among them, M is the protein molecular weight standard; lanes 1, 2, 3, and 4 are respectively the flow-through eluent, precipitation eluent, 20mmol / L imidazole eluent, and 50mmol / L imidazole eluent; lanes 5-10 are all proteins in 250mmol / L imidazole eluent;

[0034] Figure 5 The HPLC was used to detect the glycosylation of 4-methoxygallic acid by glycosyltransferase ApCGT67. The horizontal axis is time, in min; the vertical axis is the response value, in mAU; CK: the result of the enzyme activity reaction of the control group (4-methoxygallic acid + UDP-glucose + inactivated ApCGT67); Standard: 4-methoxygallic acid standard + Bergenin standard; ApCGT67: the result of the enzyme activity reaction of the experimental group (4-methoxygallic acid + UDP-glucose + ApCGT67);

[0035] Figure 6 is the mass spectrometry analysis (LC / MS / MS) spectrum of the standard, wherein A is the retention time of the standard 4-methoxygallic acid, 20.04 minutes; B is the retention time of the standard bergenin, 19.43 minutes;

[0036] Figure 7 The mass spectrometry analysis (LC / MS / MS) spectrum of the reaction product for enzyme activity verification, wherein A is the retention time of the substrate 4-methoxygallic acid, 20.05 minutes; B is the retention time of the reaction product bergenin, 19.41 minutes;

[0037] Figure 8 The fragment ion pattern of the standard substance bergenin (theoretical molecular weight 328) (LC / MS / MS);

[0038] Fig. 9 The fragment ion pattern of the reaction product bergenin (theoretical molecular weight 328) (LC / MS / MS). DETAILED DESCRIPTION

[0039] The present invention is further described in detail below in conjunction with embodiments.

[0040] Those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the art or the product specifications are used. If the manufacturer of the materials or equipment used is not specified, they are all conventional products that can be purchased.

[0041] Example 1

[0042] Based on the Unigene basic functional annotation information of the Jiujielong transcriptome, CGT candidate genes were screened in the sequencing annotation results. At the same time, the carbon glycosyltransferase (CGT) identified in plants was analyzed by sequence local BLAST, and then the screening results were sorted and analyzed. Finally, a carbon glycosyltransferase (CGT) gene was found. After a series of work such as cDNA preparation, candidate gene amplification and recovery, homologous recombination, protein expression, in vitro enzyme activity reaction, and HPLC and LC / MS detection, the target candidate carbon glycosyltransferase ApCGT67 gene (which can catalyze the glycosylation reaction of 4-methoxygallic acid to produce bergenin) was finally identified. Figure 1 The operation steps of each stage of the synthesis of bergenin are as follows (the reagents, raw materials, instruments and equipment used in the following implementation are all commercially available):

[0043] (1) Preparation of cDNA template

[0044] Fresh samples of the nine-section dragon were taken, sliced, and then quickly frozen in liquid nitrogen for RNA extraction. Total RNA was extracted using the HiPure Plant RNA Mini Kit from Magen (Guangzhou Meiji Biotechnology Co., Ltd.). RNA was extracted according to the operating procedures of the kit. After passing the test, the RNA was reverse transcribed into cDNA using the TAKARA reverse transcription kit and stored at -20°C for later use.

[0045] (2) Gene amplification and recovery

[0046] Primers for amplifying the gene of the glycosyltransferase ApCGT67 of the nine-section dragon were designed using primer design software (CE Design) v1.04. The primers consisted of primer F (SEQ ID NO.3) and primer R (SEQ ID NO.4). The high-fidelity KOD enzyme was operated according to the instruction manual, and the KOD high-fidelity enzyme was used to amplify the gene using the Bergenia cDNA as a template. The PCR reaction program was: 94°C, 5min; 94°C, 30S, 58°C, 90S, 72°C, 1min, 35 cycles; 72°C, 7min. After the PCR was completed, the gel was run, and the target band was recovered after confirming that the amplification was successful. The EasyPure Quick Gel Extraction Kit of Beijing Quanshijin Biotechnology Co., Ltd. was used for gene gel extraction and recovery to recover the target gene. After recovery, the recovery concentration was measured on a NanoReady ultra-micro UV-visible spectrophotometer, and finally stored in a -20°C refrigerator for later use. The gene fragment of the Jiujielong carbon glycosyltransferase ApCGT67 was obtained, and its nucleic acid sequence was sequenced as shown in SEQ ID NO.1.

[0047] 5'F:ATGTCTAACTCCGGCAACC; (SEQ ID NO.3)

[0048] 3'R: CTAATTTTTCTTCAACGTAGTAATT; (SEQ ID NO.4)

[0049] In addition, when the fragment of the Jiujielong carbon glycosyltransferase ApCGT67 with a vector homology arm undergoes homologous recombination with the vector pET28a (the homology arm is Escherichia coli pET28a), the Jiujielong carbon glycosyltransferase ApCGT67 gene needs to be amplified and recovered using primers with homology walls (i.e., homology arm primers). The homology arm primers are composed of an upstream homology arm primer (shown in SEQ ID NO.5 in the sequence table) and a downstream homology arm primer (shown in SEQ ID NO.6 in the sequence table). Using the Jiujielong carbon glycosyltransferase ApCGT67 gene as a template, follow the instructions for use of the high-fidelity KOD enzyme and perform PCR amplification again to obtain the Jiujielong carbon glycosyltransferase ApUGT67 gene fragment with a vector homology arm.

[0050] Upstream homology arm primer: 5'F: cagcaaatgggtcgcggatccATGTCTAACTCCGGCAACC. (SEQ ID NO.5)

[0051] Downstream homology arm primer: 3'R: acggagctcgaattcggatccCTAATTTTTCTTCAACGTAGTAATT (shown in SEQ ID NO.6).

[0052] The lowercase letters in the above upstream homology arm primer (SEQ ID NO.5) and downstream homology arm primer (shown in SEQ ID NO.6) represent the pET28a homology arms, and the uppercase letters represent the primer sequences for amplifying the ApCGT67 gene of the Drosophila spp.

[0053] (3) Construction and identification of gene recombination vectors

[0054] A schematic diagram of homologous recombination is shown in Figure 2. First, the vector pET28a was linearized, and the linearized vector was obtained by single enzyme digestion with BamH I enzyme. During homologous recombination, the assembly was carried out according to the operating instructions of the homologous recombination enzyme, and then the concentrations of the pET28a homologous arms represented by the inserted vector homologous arms, the capital letters represent the amplified Jiujielong carbon glycosyltransferase ApCGT67 gene fragment and the pET28a vector were calculated, and the amount of each component was calculated according to the recombination instructions; finally, each component was added to the PCR reaction tube on ice, and the pET28a homologous arms represented the pET28a homologous arms, the capital letters represent the amplified Jiujielong carbon glycosyltransferase ApCGT67 gene and the pET28a vector were homologously recombined to obtain a recombinant plasmid, named pET28a-ApCGT67. After assembly, the results were tested and sent to the company for sequencing. The electrophoresis test results after assembly are shown in Figure 3 , indicating that the assembly is successful. Reassemble the operation according to the following process:

[0055] Table 1 Candidate gene recombination reaction system

[0056]

[0057]

[0058] Among them, X = (0.02×pET28a base pair number) ng / linearized pET28a concentration ng / μL; Y = (0.02×pET28a base pair number) ng / Jiujielong carbon glycosyltransferase ApCGT67 recovery concentration ng / μL, and the inserted gene fragment is the Jiujielong carbon glycosyltransferase ApCGT67 gene fragment inserted with the vector homology arm.

[0059] (4) SDS-PAGE protein electrophoresis detection

[0060] After a small protein expression test, the protein induction conditions of ApCGT67 were determined to be: 18°C, 0.1mM IPTG, 220r / min, induction for 12h; then shake vigorously, collect bacteria, break the cell wall, obtain protein supernatant after high-speed centrifugation (12000r / min), and then use SDS-PAGE protein electrophoresis and detection. The test results are shown in Figure 4 , Figure 4 It shows that ApCGT67 protein can be eluted and purified in 250mmol / L imidazole elution buffer.

[0061] (5) Enzyme activity reaction

[0062] The enzymatic activity of the ApCGT67 gene of the nine-section dragon carbon glycosyltransferase was determined by the glycosylation reaction to synthesize bergenin in a 1.5mL centrifuge tube. The mixture in the experimental sample reaction system contained: 2 microliters of 100mM uridine diphosphate glucose, 2 microliters of 100mM 4-methoxygallic acid, 40μg of purified nine-section dragon carbon glycosyltransferase ApCGT67 protein, and 50mM Tris-HCl buffer (pH 8.0) was added to a total volume of 100μL, and the total volume of the reaction system was 100μL. After incubation at 32℃ for 2 hours, an equal volume of 1M hydrochloric acid was terminated, and the supernatant was taken after brief centrifugation at 12000r / min (about 15min). Finally, the reaction product was detected by HPLC and LC-MS / MS analysis.

[0063] Control group (CK) reaction system: 2 μL of 100 mM 4-methoxygallic acid, 2 μL of 100 mM uridine diphosphate glucose, 40 μg of inactivated purified 9-section dragon carbon glycosyltransferase ApCGT67 protein, 50 mM Tris-HCl buffer (pH 8.0) was added to a total volume of 100 μL, and the total volume of the reaction system was 100 μL.

[0064] Standard products: 50 μl of 10 mM 4-methoxygallic acid, 50 μl of 10 mM bergenin.

[0065] (6) Product testing

[0066] HPLC detection conditions are as follows:

[0067] The instrument used for HPLC detection is Agilent 1290 ultra-high performance liquid chromatograph. The chromatographic column is XBridge ShieldRP18 (4.6mm×250mm, 5μm), column temperature: 30°C; the mobile phase for the determination of bergenin is 0.01% v / v formic acid aqueous solution (A)-acetonitrile (B), gradient elution: 0-8min, 1%-5% B; 8-13min, 5%-10% B; 13-20min, 10%-20% B; 20-25min, 20%-45% B; 25-35min, 45%-90% B; 35-38min, 90%-90% B; 38-45min, 90%-100% B; elution time: 45min; injection volume: 10 microliters; flow rate: 0.6ml / min; detection wavelength 270nm. The test results are shown in Figure 5 , indicating that the experimental samples produced bergenin under the catalysis of Jiujielong carbon glycosyltransferase ApCGT67.

[0068] LC-MS / MS detection conditions are as follows:

[0069] In order to further confirm the reaction products detected by HPLC, Agilent 1290UPLC / 6540Q-TOF liquid chromatography-mass spectrometry (LC / MS / MS) was used for detection: Mass spectrometry conditions: the ion source used was negative ion mode, voltage: 3500 V; fragmentation voltage: 135 V; cone voltage: 60 V; radio frequency voltage: 750 V, scanning range: 100-1000 m / z, scanning mode: SRM. Chromatographic conditions: the chromatographic column is XBridge Shield RP18 (4.6mm, × 250mm, 5μm), the column temperature is 32°C, the mobile phase for determining bergenin is 0.01% v / v formic acid aqueous solution (A)-acetonitrile (B), gradient elution: 0-8min, 1%-5% B; 8-13min, 5%-10% B; 13-20min, 10%-20% B; 20-25min, 20%-45% B; 25-35min, 45%-90% B; 35-38min, 90%-90% B; 38-45min, 90%-100% B; elution time: 45min; injection volume: 10 μL; flow rate: 0.6ml / min; detection wavelength is 270nm, and the detector is a diode array detector.

[0070] Test results see Figure 6 to Figure 9 From the results, it can be seen that the peak time and characteristic fragmentation ions of the product are consistent with those of the standard substance bergenin, confirming that the reaction product is bergenin. Finally, it was concluded that carbon glycosyltransferase ApCGT67 has the ability to catalyze the glycosylation of 4-oxymethyl gallic acid to produce bergenin.

[0071] The above shows and describes the basic principles, main features and advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A glycosyltransferase from Jiujielong ApCGT67 A gene characterized by Jiujielong carbonyl transferase ApCGT67 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The nine-section dragon carbon glycosyltransferase according to claim 1 ApCGT67 The gene encodes a protein characterized in that The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. Containing the Jiujielong carbon glycosyltransferase according to claim 1 ApCGT67 Recombinant plasmid of gene.

4. The method according to claim 3 containing the amino acid glycosyltransferase ApCGT67 A recombinant plasmid of a gene, characterized in that Glucosyltransferase ApCGT67 The gene was homologously recombined with the pET28a vector to obtain pET28a - ApCGT67 Heavy Plasmid .

5. A genetically modified bacteria, characterized in that: Containing the recombinant plasmid according to claim 3 or 4, or the genome of the genetically engineered bacteria is integrated with the exogenous nine-section dragon carbon glycosyltransferase according to claim 1 ApCGT67 Gene.

6. The genetically modified bacteria according to claim 5, characterized in that: The transgenic engineering bacteria are Escherichia coli BL21 (DE3) strains.

7. The nine-section dragon carbon glycosyltransferase according to claim 1 ApCGT67 Application of genes in the preparation of bergenin.

8. The nine-section dragon carbon glycosyltransferase according to claim 7 ApCGT67 The application of the gene in the preparation of bergenin is characterized in that: Using 4-methoxygallic acid as substrate and UDP-glucose as glycosyl donor, the above-mentioned 9-section dragon carbonyl transferase ApCGT67 Under the catalysis of the genetically encoded glycosyltransferase, a glycosylation reaction occurs at the C-2 position of 4-methoxygallic acid to produce bergenin.

Images