Application of SlMYB65 gene expression promoters and tomato breeding methods and kits

Abstract

This application relates to the field of plant genetic engineering technology, and in particular to the application of a promoter for SlMYB65 gene expression, as well as tomato breeding methods and kits. This application identifies the SlMYB65 gene as an important factor regulating the flowering time of tomatoes. By using molecular biological breeding experimental methods to regulate the expression of this gene, the results show that enhancing SlMYB65 gene expression can advance tomato flowering, providing a candidate gene for breeding early-maturing tomato varieties. Therefore, this promoter for SlMYB65 gene expression can be used to regulate tomato flowering time, providing an important tool for tomato breeding technology.

Description

Technical Field

[0001] This application belongs to the field of plant genetic engineering technology, and in particular relates to the application of a promoter for SlMYB65 gene expression, as well as tomato breeding methods and kits. Background Technology

[0002] Tomato (Solanum lycopersicum L.) is an important and nutritious vegetable crop closely related to human life and is widely cultivated worldwide. Due to its advantages such as a complete genome sequence, clear genetic map, closed-flower pollination, and short growth cycle, it has also become one of the commonly used model plants in basic and applied research fields.

[0003] Flowering time in tomatoes is one of the important agronomic traits affecting crop growth period and yield. By studying and regulating the flowering time of tomatoes, the growth cycle can be shortened, thereby increasing tomato yield. Since tomatoes are a commonly used model plant for studying plant growth and development, research on the mechanism of flowering time regulation also helps to elucidate the flowering and development processes of other crops. Summary of the Invention

[0004] The purpose of this application is to provide an application of a promoter for SlMYB65 gene expression, as well as a tomato breeding method and kit, aiming to solve the technical problem of how to induce tomatoes to flower earlier in order to better cultivate tomatoes.

[0005] To achieve the above-mentioned objectives, the technical solution adopted in this application is as follows:

[0006] In one aspect, this application provides the application of a promoter of SlMYB65 gene expression in regulating tomato flowering time.

[0007] In some embodiments, the coding region nucleotide sequence of the SlMYB65 gene is shown in SEQ ID No. 1;

[0008] And / or, the amino acid sequence of the protein encoded by the SlMYB65 gene is shown in SEQ ID No. 2.

[0009] In some embodiments, the promoter comprises a recombinant vector expressing the SlMYB65 gene.

[0010] In some embodiments, the recombinant vector includes the plant expression vector pROKII-GFP, and the plant expression vector pROKII-GFP has the CDS sequence of the SlMYB65 gene inserted into it.

[0011] Secondly, this application provides a tomato breeding method, including: promoting the expression of the SlMYB65 gene in tomatoes to induce earlier flowering.

[0012] In some embodiments, the step of promoting the expression of the SlMYB65 gene in tomatoes to induce earlier flowering includes:

[0013] Construct a recombinant vector that promotes the expression of the SlMYB65 gene;

[0014] The recombinant vector was transferred into a tomato receptor and cultured.

[0015] In some embodiments, the step of constructing a recombinant vector that promotes the expression of the SlMYB65 gene includes:

[0016] The plant expression vector pROKII-GFP was digested with restriction endonucleases BamHI and KpnHI, and then recombined with the CDS sequence of the SlMYB65 gene to obtain the recombinant vector.

[0017] In some embodiments, the tomato receptor comprises the cotyledons 7-10 days after the germination of wild-type tomato seeds.

[0018] Thirdly, this application provides a kit for advancing flowering of tomatoes, including a promoter for expressing the SlMYB65 gene in tomatoes.

[0019] In some embodiments, the promoter includes a recombinant vector expressing the SlMYB65 gene, the recombinant vector including the plant expression vector pROKII-GFP, wherein the plant expression vector pROKII-GFP has an inserted CDS sequence of the SlMYB65 gene.

[0020] The first aspect of this application is based on the discovery that the SlMYB65 gene is an important factor regulating the flowering time of tomatoes. By using molecular biological breeding techniques to regulate the expression of this gene, the results showed that enhancing SlMYB65 gene expression can advance tomato flowering, providing a candidate gene for breeding early-maturing tomato varieties. Therefore, this promoter of SlMYB65 gene expression can be used to regulate tomato flowering time, providing an important tool for tomato breeding technology.

[0021] The tomato breeding method provided in the second aspect of this application includes promoting the expression of the SlMYB65 gene in tomatoes to induce earlier flowering. Since overexpression of the SlMYB65 gene can cause tomatoes to flower earlier, the tomato breeding method provided in this application can obtain early-maturing tomato varieties by enhancing the expression of the SlMYB65 gene.

[0022] A third aspect of this application provides a kit containing a promoter that induces the expression of the SlMYB65 gene in tomatoes; therefore, the kit provided by this application can induce tomatoes to flower earlier and can be used for tomato breeding. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of this application, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 These are PCR electrophoresis verification images of three tomato tissue culture regenerated seedlings obtained by transgenic cloning in this application; where 1, 2, and 3 correspond to the electrophoresis lanes of the three tomato plants, respectively.

[0025] Figure 2 This is a graph showing the relative expression level of the SlMYB65 gene in three tomato tissue culture regenerated seedlings obtained by transgenic cloning in this application; where WT represents wild-type tomato; OE1, OE2, and OE3 represent three tomato plants obtained by transgenic cloning, respectively.

[0026] Figure 3 This is a phenotypic comparison diagram of tomato tissue culture regenerated seedlings obtained by transgenic cloning in the embodiments of this application and wild-type tomatoes; wherein, WT represents wild-type tomatoes; 35S:SlMYB65 represents tomatoes obtained by transgenic cloning;

[0027] Figure 4 This is a comparison chart of the flowering time of three tomato tissue culture regenerated seedlings obtained by transgenic cloning in this application and wild-type tomatoes; where WT represents wild-type tomatoes; OE1, OE2, and OE3 represent three tomato seedlings obtained by transgenic cloning; * indicates significant difference, and ** indicates extremely significant difference. Detailed Implementation

[0028] To make the technical problems, technical solutions, and beneficial effects of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.

[0029] In this application, the term "and / or" describes the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can represent: A existing alone, A and B existing simultaneously, or B existing alone. A and B can be singular or plural. The character " / " generally indicates that the preceding and following related objects have an "or" relationship.

[0030] In this application, "at least one" means one or more, and "more than one" means two or more. "At least one of the following" or similar expressions refer to any combination of these items, including any combination of a single item or a plurality of items.

[0031] It should be understood that in the various embodiments of this application, the order of the above processes does not imply the order of execution. Some or all steps may be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application.

[0032] The terminology used in the embodiments of this application is for the purpose of describing particular embodiments only and is not intended to be limiting of this application. The singular forms “a,” “the,” and “the” used in the embodiments of this application and the appended claims are also intended to include the plural forms unless the context clearly indicates otherwise.

[0033] The weights of the relevant components mentioned in the embodiments of this application can refer not only to the specific content of each component, but also to the proportional relationship between the weights of the components. Therefore, any scaling up or down of the content of the relevant components according to the embodiments of this application is within the scope disclosed in the embodiments of this application. Specifically, the mass described in the embodiments of this application can be a mass unit known in the chemical industry, such as μg, mg, g, or kg.

[0034] The terms "first" and "second" are used for descriptive purposes only, to distinguish objects, such as substances, from one another, and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. For example, without departing from the scope of the embodiments of this application, "first XX" may also be referred to as "second XX," and similarly, "second XX" may also be referred to as "first XX." Thus, features defined with "first" and "second" may explicitly or implicitly include one or more of that feature.

[0035] R2R3MYB transcription factors play a crucial regulatory role in the development of floral organs and the regulation of flowering time in horticultural crops. In our study of the function of R2R3MYB transcription factors in tomato, we discovered that the SlMYB65 gene is a key factor regulating tomato flowering time. Overexpression of the SlMYB65 gene significantly shortened the tomato flowering time, providing a candidate gene for altering crop flowering time. Since regulating tomato flowering time can better meet market demand, breeding early-maturing tomato varieties could allow for earlier supply of tomatoes in early spring, satisfying the market demand for fresh tomatoes.

[0036] Specifically, the SlMYB65 gene information is as follows:

[0037] Gene ID: Solyc01g009070;

[0038] Gene name: MYB transcription factor65;

[0039] Basic information: SlMYB65 is a nuclear gene located on tomato chromosome 1 at positions 3075589-3080069. The gene is 4480 bp in length and contains a 3' uncoding region; the DNA coding sequence is 4671 bp in length, with 3 exons and 2 introns. The mature mRNA encodes 537 amino acid residues. The SlMYB65 protein has a typical R2R3MYB protein domain and belongs to the R2R3MYB transcription factor gene family.

[0040] SlMYB65 gene sequence:

[0041] 3' Non-coding area:

[0042] CAGTTTTGAAGTTTTGGTAACATCTTTCGATACAACAGGTTGTTATCTAATGACACT GAGCATGTAATATGAAAACACTTCTGGATTTTCCTGTGTGCTTCGGTTTAAGGCAATTTA GAGACAAACAATGAAACTTTTTTTAATGTGGGATCAAATTGGAC;

[0043] DNA coding region (exons are underlined), SEQ ID No. 1:

[0044]

[0045]

[0046]

[0047] The amino acid sequence of the protein encoded by the SlMYB65 gene, SEQ ID No. 2:

[0048] In one aspect, embodiments of this application provide the application of a promoter of SlMYB65 gene expression in regulating tomato flowering time.

[0049] The promoter described in this application refers to a reagent or substance that can promote the expression of the SlMYB65 gene in tomatoes relative to the wild type. Since the SlMYB65 gene is an important factor regulating the flowering time of tomatoes, experiments using molecular biological breeding techniques to regulate its expression have shown that enhancing SlMYB65 gene expression can advance tomato flowering, providing a candidate gene for breeding early-maturing tomato varieties. Therefore, this promoter of SlMYB65 gene expression can be used to regulate tomato flowering time, providing an important tool for tomato breeding technology.

[0050] In some embodiments, the coding region nucleotide sequence of the SlMYB65 gene is shown in SEQ ID No. 1. The amino acid sequence of the protein encoded by the SlMYB65 gene is shown in SEQ ID No. 2.

[0051] In some embodiments, the promoter includes a recombinant vector expressing the SlMYB65 gene. The recombinant vector is used in transgenic technology to obtain transgenic tomatoes overexpressing the SlMYB65 gene.

[0052] In some embodiments, the recombinant vector comprises the plant expression vector pROKII-GFP, wherein the plant expression vector pROKII-GFP contains the CDS sequence of the SlMYB65 gene (i.e., the gene sequence encoding the protein product). This recombinant vector can be well transformed into Agrobacterium and further transgenic tomato plants can be obtained.

[0053] Secondly, embodiments of this application provide a tomato breeding method, including: promoting the expression of the SlMYB65 gene in tomatoes to induce earlier flowering. Since overexpression of the SlMYB65 gene can induce earlier flowering in tomatoes, the tomato breeding method provided in this application can obtain early-maturing tomato varieties by enhancing the expression of the SlMYB65 gene.

[0054] In some embodiments, the steps of promoting the expression of the SlMYB65 gene in tomatoes to induce earlier flowering include: constructing a recombinant vector that promotes the expression of the SlMYB65 gene; and transferring the recombinant vector into a tomato recipient for culture.

[0055] In some embodiments, the steps of constructing a recombinant vector that promotes the expression of the SlMYB65 gene include: digesting the plant expression vector pROKII-GFP with restriction endonucleases BamHI and KpnI, and then recombinating it with the CDS sequence of the SlMYB65 gene to obtain the recombinant vector.

[0056] In some embodiments, the tomato receptor includes the cotyledons 7-10 days after the germination of wild-type tomato seeds.

[0057] Thirdly, embodiments of this application provide a kit for advancing tomato flowering, comprising a promoter for the expression of the SlMYB65 gene in tomatoes. The kit provided in this application can induce earlier flowering in tomatoes and can be used in tomato breeding.

[0058] In some embodiments, the promoter includes a recombinant vector expressing the SlMYB65 gene, the recombinant vector including the plant expression vector pROKII-GFP, and the plant expression vector pROKII-GFP having an inserted CDS sequence of the SlMYB65 gene.

[0059] In this embodiment, the SlMYB65 gene is used as a tool gene for early flowering. Plant transgenic technology is used to overexpress this tool gene in the target crop, generating new crop germplasm that flowers earlier. After phenotypic screening, lines that meet the expected traits are retained. Subsequently, these lines can be crossed with lines possessing other desirable traits (such as disease resistance) to gradually cultivate new crop varieties with superior traits.

[0060] In addition, the SlMYB65 gene has a very high similarity to the protein sequences in solanaceous crops such as eggplant, pepper and potato. Its application in early flowering of tomatoes can also provide new breeding ideas for early flowering and increased yield of other solanaceous crops.

[0061] The following description is based on specific embodiments. The experimental materials used in the embodiments of this application are as follows:

[0062] (1) Plant materials: wild-type tomato (Solanum lycopersicum L.), Micro-Tom. Wild-type tomatoes were cultured in a plant growth chamber with temperature, light and periodic conditions of 18℃-8h at night and 24℃-16h during the day.

[0063] (2) Engineered bacterial strains: Escherichia coli DH5α and Agrobacterium tumefaciens LBA4404.

[0064] (3) Vector material: plant expression vector pROKII-GFP, binary vector with kanamycin resistance.

[0065] (4) Culture medium:

[0066] 1 / 2 MS medium (per 1 L): MS (without agar and sucrose) 2.37 g, sucrose 15 g, agar 7 g, pH 5.8–5.85.

[0067] Pre-medium (per 1L): MS (without agar and sucrose) 4.74g, sucrose 30g, agar 7g, zeatin (ZT) solution 1mL, pH 5.8-5.85; after sterilization (121℃, 15-20min), add auxin (IAA) solution 1mL.

[0068] Co-culture medium (per 1L): MS (without agar and sucrose) 4.74g, sucrose 30g, agar 7g, zeatin (ZT) solution 1mL, pH 5.8-5.85; after sterilization (121℃, 15-20min), add auxin (IAA) solution 1mL and acetylsuccinone (AS) solution 5-10mL.

[0069] Differentiation medium (per 1L): MS (without agar and sucrose) 4.74g, sucrose 30g, agar 7g, zeatin (ZT) solution 1mL, pH 5.8-5.85; after sterilization (121℃, 15-20min), add auxin (IAA) solution 1mL, carbenicillin sodium (CB) solution 2mL, and kanamycin solution 1mL or 0.5mL.

[0070] Rooting medium (per 1L): MS (without agar and sucrose) 4.74g, sucrose 30g, agar 7g, pH 5.8-5.85; after sterilization (121℃, 15-20min), add 200μL of auxin (IAA) solution and 2mL of carbenicillin sodium (CB) solution.

[0071] In the various culture media prepared above, the ZT concentration in the zeatin solution was 2 mg / mL, the IAA concentration in the auxin solution was 0.5 mg / mL, the AS concentration in the acetylsuccione solution was 1.96 mg / mL, the Kanamycin concentration in the kanamycin solution was 100 mg / mL, and the CB concentration in the carbenicillin sodium solution was 200 mg / mL.

[0072] LB liquid culture medium components (in 1L): 10g tryptone, 5g yeast extract, 10g sodium chloride.

[0073] MS (agar and sucrose-free) components: purchased from Haibo Bio-MS medium (agar and sucrose-free), catalog number HB8469-5.

[0074] Example 1 Construction of plant expression recombinant vector

[0075] 1. Total RNA extraction. 0.5 g of wild-type tomato leaves were ground with liquid nitrogen, and total RNA was extracted using Trizol reagent. The integrity of the obtained total RNA was detected by agarose gel electrophoresis, and the RNA concentration was determined using a nucleic acid spectrophotometer.

[0076] 2. Obtain cDNA. Use the PrimeScript kit. TM The RT reagent kit with gDNA Eraser first removes genomic DNA from total RNA, and then uses this as a template to obtain cDNA products through reverse transcription.

[0077] 3. Cloning the SlMYB65 gene. Using 1 μl of cDNA as a template, clone the full-length CDS sequence of the SlMYB65 gene using the following specific primers.

[0078] SlMYB65-BamHI-F, SEQ ID No.3:

[0079] 5'-acgggggactctagaggatccATGAGCATCAAAAGTGAAACCGA-3'.

[0080] SlMYB65-KpnI-R, SEQ ID No.4:

[0081] 5'-gcccttgctcaccatggtaccTCATAATCTCATTCTTCCTGTTGCTT-3'.

[0082] The PCR reaction system is shown in Table 1 below:

[0083] Table 1

[0084]

[0085] The PCR results were detected by agarose gel electrophoresis. If the band size was appropriate, the cloned target DNA fragment was recovered using an agarose gel recovery kit and stored for later use.

[0086] 4. Construction of plant expression recombinant vector. The plant expression vector pROKII-GFP was linearized using restriction endonucleases BamHI and KpnI (1 μl BamHI and 1 μl KpnI, 100 μg empty vector, 4 μl buffer, water added to 40 μl, incubated at 37°C for 10 minutes). The vector was detected by agarose gel electrophoresis, and the linearized vector was recovered using an agarose gel extraction kit. 1 μl of the linearized vector, 4 μl of the DNA insert (i.e., the full-length CDS sequence of the cloned SlMYB65 gene), and 5 μl of homologous recombinase reagent were added, for a total of 10 μl; the mixture was incubated at 50°C for 20 minutes. After the reaction, the reaction solution was added to 50 μl of thawed *E. coli* competent cells, pre-cooled on ice for 20 minutes, and then heat-shocked in a 42°C water bath for 45 seconds. 1 ml of sterile LB broth was added to the workbench, and the mixture was shaken at 37°C for 30 minutes. Centrifuge and discard most of the supernatant. Resuspend the bacterial cells and spread them on kanamycin (50 mg / kg) solid medium. Incubate at 37°C upside down for 10 hours. Select positive bacterial cells and verify true positive clones by bacterial culture PCR. Send the clones to a sequencing company for sequencing to confirm the absence of base mismatches. Extract the correctly sequenced plant expression recombinant vector using a plasmid miniprep kit and store it for later use.

[0087] Example 2: Transgenic Plant Breeding of Tomatoes

[0088] 1. Transformation of Agrobacterium with plant expression vector.

[0089] Mix 5 μl of the above plant expression recombinant vector with 20 μl of Agrobacterium competent cells, incubate on ice for 5 minutes, heat shock at 37°C for 4 minutes, and maintain on ice for 5 minutes; add 1 ml of LB liquid medium, and shake at 28°C for 1 hour; centrifuge, discard most of the supernatant, and resuspend the bacterial cells on resistant (kanamycin 50 mg / kg, rifampin 50 mg / kg) solid medium. Incubate upside down at 28°C for 2 days, and use positive clones to verify true positive bacteria by bacterial PCR, and store for later use.

[0090] 2. Obtaining transgenic plants.

[0091] Tomato seeds were placed in 50ml Erlenmeyer flasks and sterilized with 1% sodium hypochlorite for 15 minutes. The seeds were then rinsed three times with sterile water and sown onto 1 / 2 MS medium, placed in a light incubator (24℃-16h, 18℃-8h). Approximately 7-10 days after germination, when the cotyledons were fully expanded, the hypocotyl and the middle portion of the cotyledons near the cotyledons were cut off with a scalpel and placed in a pre-culture medium, incubated in the dark at 28℃ for 1 day. The pre-cultured explants were then immersed in Agrobacterium infection solution (OD=0.6) containing the target plasmid for 15 minutes, shaking 3-4 times during this period to ensure complete infection. The explants were blotted dry with sterile filter paper using forceps and transferred to a co-culture medium, incubated in the dark at 28℃ for 2 days. Afterward, the explants were transferred to differentiation medium and incubated in a light incubator (24℃-16h, 18℃-8h) to induce differentiation, changing the differentiation culture plate every 10-15 days. The differentiated regenerated seedlings were transferred to rooting medium and cultured in a light incubator (24℃-16h, 18℃-8h) to induce rooting. The rooted seedlings were then transplanted and placed in a plant room for further cultivation (24℃-16h, 18℃-8h).

[0092] Total DNA was extracted from leaves of T0 generation seedlings using the CTAB method (2% CTAB, 1% PVP K30, 1.4M NaCl, 100mM Tris-HCl, 20mM EDTA-Na2). T0 generation transgenic plants were screened by PCR amplification using the specific primers listed in Table 2, and the expression of the SlMYB65 gene was simultaneously detected. Homozygous T2 generation transgenic seeds were then selected for further research.

[0093] 35S-F, SEQ ID No.5: 5'-GACCAAAGGGCAATTGAGAC-3';

[0094] SlMYB65-R, SEQ ID No. 6: 5'-AACCAAAAGGATCTTTCGAAGC-3'.

[0095] Table 2

[0096]

[0097] 3. Statistics on flowering time.

[0098] Photos were taken of the first inflorescence of wild-type tomatoes and three transgenic tomato plants when they bloomed, the blooming time was recorded, and the data was plotted using GraphPad Prism 9.0.

[0099] Figure 1 The PCR verification results for the T0 generation transgenic seedlings demonstrate that the target DNA band can be cloned from the three transgenic tomato tissue culture regenerated seedlings. Figure 2 The expression level of the SlMYB65 gene was detected in three tissue culture regenerated seedlings of transgenic tomatoes, indicating that transgenic tomatoes overexpress the SlMYB65 gene. Figure 3 and Figure 4 The results showed that after overexpressing the SlMYB65 gene in tomatoes, the flowering time of the three transgenic lines (i.e., the number of days from seed germination to flowering of the tomato plant) was significantly earlier than that of the wild type, indicating that overexpression of the SlMYB65 gene has a biological function of promoting early flowering in tomato plants.

[0100] Given the biological function of overexpression of the tomato SlMYB65 gene in regulating flowering time, molecular biological breeding techniques can be used to enhance the expression of the SlMYB65 gene in target crops during crop genetic improvement and the breeding of new varieties and germplasm. This will cause the offspring to flower earlier, providing a new breeding strategy for breeding early-maturing crop varieties.

[0101] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A kind SlMYB65 The application of gene expression promoters in promoting early flowering in tomatoes; SlMYB65 The coding region nucleotide sequence of the gene is shown in SEQ ID No. 1, and the promoter is for expressing the gene. SlMYB65 Gene recombination vectors.

2. The application as described in claim 1, characterized in that, The SlMYB65 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No.

2.

3. The application as described in claim 1 or 2, characterized in that, The recombinant vector includes plant expression vectors. pROKII- GFP And the plant expression vector pROKII-GFP Insertion has the above SlMYB65 CDS sequence of the gene.

4. A tomato breeding method, characterized in that, include: Promote the growth of tomatoes SlMYB65 Gene expression causes tomatoes to flower earlier; The promotion of tomatoes SlMYB65 The steps involved in gene expression that cause tomatoes to flower earlier include: Constructing to promote the SlMYB65 Recombinant vectors for gene expression, the SlMYB65 The nucleotide sequence of the coding region of the gene is shown in SEQ ID No. 1; The recombinant vector was transferred into a tomato receptor and cultured.

5. The tomato breeding method as described in claim 4, characterized in that, The SlMYB65 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No.

2.

6. The tomato breeding method as described in claim 4, characterized in that, Constructing to promote the SlMYB65 The steps involved in creating a recombinant vector for gene expression include: Plant expression vectors were processed using restriction endonucleases BamHⅠ and KpnⅠ. pROKII-GFP Perform enzymatic digestion, and then with the above. SlMYB65 The CDS sequence of the gene is recombined and ligated to obtain the recombinant vector.

7. The tomato breeding method according to any one of claims 4-6, characterized in that, The tomato receptor includes the cotyledons 7-10 days after the germination of wild-type tomato seeds.

Images