A SNP molecular marker and its application in improving honeybee germplasm resources
By screening for C/T polymorphic SNP molecular markers at position 3613559 on honeybee chromosome 11, the inaccuracy of tarsal length identification in honeybee was solved, thus improving honeybee germplasm resources and increasing breeding efficiency.
Patent Information
- Application Number
- CN202411402560.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-09
- Publication Date
- 2025-10-31
- Estimated Expiration
- 2044-10-09
AI Technical Summary
In existing technologies, the SNP sites related to the tarsal length trait of the Chinese honeybee are not clearly defined, which leads to inaccuracies and operational complexities in the use of morphological markers for honeybee identification and breeding, making it difficult to achieve efficient germplasm resource improvement.
A molecular marker with SNP polymorphism C/T, located at position 3613559 on chromosome 11 of honeybees, was obtained through genome-wide association analysis and amplified by specific primer pairs to achieve accurate identification of the tarsal length trait in honeybees.
This technology enables precise identification of the tarsal length trait in bees, supports the improvement of bee germplasm resources, and enhances breeding efficiency and accuracy.
Smart Images

Figure CN119144731B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bee breeding technology, and in particular to an SNP molecular marker and its application in improving bee germplasm resources. Background Technology
[0002] Chinese honeybee ( Apis cerana cerana The Chinese honeybee (Apis cerana) is a subspecies of the Eastern honeybee, adapted to various climates including temperate and subtropical zones. While its honey production is generally lower than that of the Western honeybee, its honeybees have higher nutritional value. In different geographical environments, the Chinese honeybee exhibits different morphological characteristics. Effectively evaluating the morphological traits of the Chinese honeybee is an important means of discovering, protecting, identifying, and utilizing bee resources.
[0003] Existing technologies often employ morphological markers for bee species identification and performance evaluation. While morphological markers offer advantages such as low cost and ease of operation, they also have inherent drawbacks and are not suitable for use with Chinese honeybees. Firstly, morphological markers are directly related to the individual development of bees and are easily affected by external interference factors such as nutritional conditions during development. Secondly, morphological measurements of Chinese honeybees are highly precise, requiring strict standards for instrument accuracy and the morphological anatomy skills of the personnel involved. Furthermore, the sheer volume of work involved in bee morphological measurements makes them less practical. Finally, the lack of standardized morphological measurement criteria for Chinese honeybees leads to human error among measurement personnel, significantly impacting result interpretation. Tarsus length is an important morphological trait in bees, a crucial indicator of hind legs, and it influences bees' crawling ability and pollen-collecting capacity to a certain extent. Developing molecular markers related to tarsus length is beneficial for breeding superior bee species.
[0004] The SNP sites associated with tarsal length in honeybees are currently unclear, making it impossible to identify the tarsal length trait in honeybees through simple first-generation sequencing. Summary of the Invention
[0005] To address the problems existing in the prior art, this invention provides an SNP molecular marker and its application in improving bee germplasm resources.
[0006] In a first aspect, the present invention provides an SNP molecular marker based on genomic version PRJNA738447, located at position 3613559 on chromosome 11 of honeybee, with a polymorphism of C / T.
[0007] Furthermore, the SNP molecular marker comprises the nucleotide sequence shown below:
[0008] TCGCTTCAGAACTGTCAACGTTGAGAGAAAATAACAACTTTATTATTCGAAAGTTGTACAGTTTCTTCGCTTCAATCAGGCATCTACTTATCATCACAATTGTCAAAACATTCTTATTATTTAACAGAGCGATCAGAATTCATCGACAAAAGGAGCGGCAAT GTAGCACAGAAACTGTATTCAGATTTATAAATTTCGGTTACATTTCCTCTTTCAGCATCTCTCTCATTCTCTCTCTCGCTAACAAAATCATCACAATTAAGTAATTGATCACGTCACAATCGATTAAATTTAACCCCGTGACATTCTCGCGTAACAAA;
[0009] The nucleotide sequence contains a polymorphic site at position 169, with a polymorphism of C / T.
[0010] Secondly, the present invention provides primer pairs for amplifying the SNP molecular marker, comprising the following nucleotide sequences:
[0011] F: 5'-TCGCTTCAGAACTGTCAACG-3',
[0012] R: 5'-TTTGTTACGCGAGAATGTCAC-3'.
[0013] Thirdly, the present invention provides a kit comprising the SNP marker or the primer pair described herein.
[0014] Fourthly, the present invention provides the application of the SNP molecular marker, the primer pair, or the kit in the identification of bee tarsal length.
[0015] The present invention further provides the application of the SNP molecular marker, or the primer pair, or the kit in any of the following:
[0016] i) Breeding genetically modified honeybees;
[0017] ii) Molecular marker-assisted breeding of honeybees;
[0018] iii) Improve high-quality bee germplasm resources.
[0019] Furthermore, the bee is an Oriental honeybee; preferably a Chinese honeybee.
[0020] Fifthly, the present invention provides a method for detecting the length of the hind tarsi of a bee, comprising:
[0021] Obtain the genomic DNA of the bee to be tested; use the genomic DNA as a template and amplify it using the primer pair, and determine the tarsal length of the bee to be tested based on the amplification results.
[0022] Further, based on a total system volume of 25 μL, the amplified system comprises:
[0023] Template DNA 1-2 μL, upstream primer 1-2 μL, downstream primer 1-2 μL, Dntp mix 1-2 μL, 10×Taq Buffer 2-4 μL, Taq enzyme 0.2-0.4 μL, the remainder is water;
[0024] The amplification procedure includes:
[0025] Pre-denaturation at 95℃ for 5-10 minutes;
[0026] The process involves denaturation at 92-96℃ for 30-90 seconds, annealing at 62-65℃ for 30-90 seconds, and extension at 70-75℃ for 30-90 seconds, repeated 10-15 times, with the annealing temperature decreasing by 0.4-0.6℃ each time.
[0027] Denaturation at 92~96℃ for 30~90s, annealing at 56~60℃ for 30~90s, extension at 70~75℃ for 30~90s, cycle 24~36 times;
[0028] Repair and extend the treatment at 70~74℃ for 10~20 minutes.
[0029] Furthermore, determining the tarsal length of the bee under test based on the amplification results includes:
[0030] In the amplification results, the primer pair identified that the tarsal length of the C / C genotype honeybee was significantly smaller than that of the C / T genotype honeybee.
[0031] The present invention has the following beneficial effects:
[0032] This invention identified a single-nucleotide polymorphism (SNP) marker associated with tarsal length in honeybees through genome-wide association analysis. The marker is located at position 3613559 on chromosome 11 and exhibits a C / T polymorphism. The genotype detection results of this SNP marker can reflect the tarsal length trait in honeybees. The SNP marker provided by this invention can be applied to improve honeybee germplasm resources, which is of significant importance in the field of honeybee breeding. Attached Figure Description
[0033] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0034] Figure 1 This is a comparison diagram of tarsal lengths of individuals with different genotypes at the Chr11_3613559 locus in honeybees provided in Example 2 of this invention.
[0035] Figure 2 This is a gel electrophoresis image of the amplification results of the primer pair provided in Example 3 of the present invention (targeting site 3613559 on chromosome 11 of honeybee); the left band is the marker and the three right bands are the amplification products. Detailed Implementation
[0036] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0037] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.
[0038] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.
[0039] Example 1
[0040] This invention provides a method for screening SNP molecular markers associated with bee tarsal length based on genome-wide association analysis, the specific process of which is as follows:
[0041] 1. The analytical sample for this invention consisted of 110 colonies of *Honeysuckle simonii*. One worker bee from each colony was selected to measure its protarsal length. Genomic DNA was extracted from the thoracic tissue of the dissected worker bees, and library construction was performed using the Trussq Nano DNA HT kit (Illumina, USA). The DNA was randomly fragmented into 350 bp fragments, and after end repair, addition of polyA tails, addition of sequencing adapters, amplification, and purification, a DNA library was obtained. The insert size of the library was quality checked using an Agilent 2100, and the effective concentration of the library was accurately quantified using qPCR. Once the quality met the standards, the DNA library construction was complete.
[0042] 2. Genome Sequencing, Alignment, and SNP Identification: After successful library construction, genome sequencing was performed on the Illumina Hiseq PE150 platform (Illumina, USA). Low-quality reads were removed during sequencing to ensure result quality [quality control standards: remove reads containing more than 10% unknown nucleotides, remove reads containing adapter sequences, remove reads with low-quality (phred quality < 5) bases exceeding 50% in length]. Finally, each bee sample generated over 4.5G of high-quality, clean reads with paired ends, with Q20 and Q30 values exceeding 90% and 85%, respectively.
[0043] 3. The high-quality paired-end clean reads obtained were aligned to the reference genome Apis cerana (Genbank accession number: PRJNA738447) using BWA 0.7.8 software. The alignment results were then deduplicated using SAMTOOLS 1.15 software. The average alignment rate for the population sample was maintained above 95%, and the average sequencing depth of the genome was above 20X.
[0044] 4. SNPs were detected using a Bayesian model in SAMTOOLS 1.15 software. High-quality SNPs were selected based on quality control criteria: SNPs with a sequencing error rate >1% (Q20 quality control) were deleted; SNPs with a gap of <5 bases between adjacent SNP sites were deleted; and SNPs with a coverage depth exceeding 1 / 3 to 5 times the average depth were deleted. The detected SNPs were annotated using ANNOVAR 20130520 software to identify exon regions, intron regions, alternative splicing sites, upstream and downstream gene regions, and intergenic regions, distinguishing between synonymous and non-synonymous SNPs.
[0045] 5. Genome-wide association studies (GWAS): Genome-wide association studies (GWAS) were conducted using mrMLM 1.3 software to clarify the association between tarsal length traits and SNP loci. The quality control standard for SNPs was based on MAF > 5%, and a multi-locus randomized mixed linear model was selected.
[0046] Based on the above method, this invention ultimately screened and obtained a SNP molecular marker Chr11_3613559 related to the tarsal length of bees. This SNP molecular marker is located at position 3613559 on bee chromosome 11 and has a polymorphism of C / T. Based on the polymorphism detection of this SNP molecular marker, the tarsal length trait of bees can be identified and applied to the improvement of bee germplasm resources.
[0047] Example 2
[0048] This invention selected 106 samples of Chinese honeybees for verification. Verification Example 1 involved the application of SNP molecular markers in honeybee trait identification. Specifically, sequencing was performed on these 106 Chinese honeybees, and the tarsal length of the 106 honeybees was measured using a microscopic measurement system to obtain tarsal length data and SNP data for the 106 honeybees.
[0049] This invention groups genotypes based on SNP molecular markers and further uses SPSS 16.0 software to perform a significant difference analysis on the tarsal length data of different groups in order to compare whether there are differences in tarsal length among different genotypes.
[0050] Ultimately, 66 Chinese honeybees exhibited the C / C genotype, and 40 exhibited the C / T genotype. Independent samples t-test analysis yielded the following results: Figure 1 As shown: The C / C genotype and the C / T genotype showed significant differences ( P <0.05), the tarsal length of the C / C genotype honeybee is significantly smaller than that of the C / T genotype honeybee.
[0051] Table 1. Comparison of tarsal length among different SNP molecular marker genotypes in Honeybee (Apis cerana)
[0052]
[0053] Example 3
[0054] This invention uses three samples of Chinese honeybees to amplify the SNP molecular markers involved in Example 1 via PCR, specifically including the following process:
[0055] 1. Use the following primer pairs:
[0056] Upstream primer: 5'-TCGCTTCAGAACTGTCAACG-3',
[0057] Downstream primer: 5'-TTTGTTACGCGAGAATGTCAC-3'.
[0058] 2. The PCR system is as follows:
[0059]
[0060] The PCR procedure is as follows:
[0061]
[0062] 3. Test Results
[0063] The final result is as follows Figure 2 As shown in the amplification results, the electrophoretic bands of the amplified products are clear, bright, and free of impurities. This demonstrates that the primers, amplification system, and program provided by this invention have high specificity and can achieve the purpose of detecting target SNP molecular markers. Subsequent sequencing can also be used to detect the polymorphism of specific SNP molecular markers, and further applied to the detection of bee tarsal length and germplasm resource improvement.
[0064] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. Application of primer pairs in the identification of tarsal length traits in Chinese honeybee; The primer pair comprises the following nucleotide sequences: F: 5'-TCGCTTCAGAACTGTCAACG-3', R: 5'-TTTGTTACGCGAGAATGTCAC-3'.
2. A method for detecting the length of the hind tarsi of bees, characterized in that, include: Obtain the genomic DNA of the bees to be tested; Using the genomic DNA as a template, amplification was performed using the primer pair described in claim 1, and the tarsal length of the bee under test was determined based on the amplification results. The determination of the tarsal length of the bee under test based on the amplification results includes: In the amplification results, the primer pair identified that the tarsal length of the C / C genotype honeybee was significantly smaller than that of the C / T genotype honeybee.
3. The method according to claim 2, characterized in that, Based on a total volume of 25 μL, the amplified system comprises: Template DNA 1-2 μL, upstream primer 1-2 μL, downstream primer 1-2 μL, Dntp mix 1-2 μL, 10×Taq Buffer 2-4 μL, Taq enzyme 0.2-0.4 μL, the remainder is water; The amplification procedure includes: Pre-denaturation at 95℃ for 5-10 minutes; The process involves denaturation at 92-96℃ for 30-90 seconds, annealing at 62-65℃ for 30-90 seconds, and extension at 70-75℃ for 30-90 seconds, repeated 10-15 times, with the annealing temperature decreasing by 0.4-0.6℃ each time. Denaturation at 92~96℃ for 30~90s, annealing at 56~60℃ for 30~90s, extension at 70~75℃ for 30~90s, cycle 24~36 times; Repair and extend the treatment at 70~74℃ for 10~20 minutes.
Citation Information
Patent Citations
Method for identifying cysticercosis resistance character of bee colony by utilizing SNP marker KZ288474.1_322717
CN112430675A
SNP marker for identifying variety of Chinese bees in Changbai Mountain and identification
CN113186297A