Application of WIPI1 protein in myelin removal in peripheral nerve regeneration process

Abstract

The invention discloses an application of WIPI1 protein in myelin removal in a peripheral nerve regeneration process. The invention provides a new application of the WIPI1 protein, overexpression of the WIPI1 shows that myelin signal expression is gradually reduced during myelin sheath lipid specific staining, meanwhile, the myelin sheath related gene expression level is reduced, and neurological function recovery is enhanced.

Description

Technical Field

[0001] The invention relates to application of WIPI1 protein in myelin removal during peripheral nerve regeneration, and belongs to the technical field of biomedicine. Background Art

[0002] Peripheral nerves have a certain regenerative capacity after injury (PNI), but due to the slow growth rate and Wallerian degeneration of the distal end, it is difficult to complete functional innervation before the target muscle atrophies. Nerve injury repair undergoes biological processes such as myelin debris removal, axon growth, and myelination. If the myelin debris in the early stage of injury cannot be removed in time, axon regeneration will be hindered, thereby affecting the process of nerve repair and regeneration after injury. After peripheral nerve injury, the distal nerve fibers of the damaged nerve are disconnected from the neuronal stumps, and Wallerian degeneration occurs, causing the neurofilaments and axonal microtubules to disintegrate and break into granular amorphous fragments, accompanied by the disintegration of myelin to produce a large number of fragments. If the tissue fragments in the early stage of nerve injury cannot be removed in time, the resulting fragments will hinder axon regeneration. The removal of myelin fragments plays an important role in nerve repair and is a prerequisite for nerve regeneration.

[0003] After peripheral nerve injury, Schwann cells degrade and remove damaged axons and myelin fragments through autophagy, clearing obstacles for nerve regeneration. However, insufficient autophagic activity will form nerve scars that hinder nerve regeneration and induce persistent pain and inflammation, affecting the fate of peripheral nerve injury repair. These studies have shown that insufficient Schwann cell autophagic activity will affect the effect of nerve injury repair.

[0004] WIPI protein is a member of the mammalian PROPPIN family and is an effector molecule of the autophagy initiation signal phosphoinositide. It plays different roles at different stages of autophagosome biogenesis, recruits other factors to regulate the formation of autophagosomes, and promotes the formation of autophagic precursors, the growth, extension and closure of autophagosomes. Based on the prominent role of WIPI1 protein in autophagy, we reasonably infer that specific regulation of WIPI1 protein may be an effective method to regulate the autophagic effect of Schwann cells.

[0005] The main shortcomings are: 1) Research and clinical strategies for peripheral nerve regeneration mainly focus on interventions to promote axon and myelin regeneration after injury, but the process of myelin clearance is rarely paid attention to. 2) Schwann cell autophagy is a forerunner in the clearance of myelin debris and also has a regulatory effect on macrophages. It plays a leading role in the clearance of debris during Wallerian degeneration, but how it works is not completely clear.

[0006] In addition, the shortcomings of existing hemostatic dressings: Research and clinical strategies for peripheral nerve regeneration mainly focus on interventions to promote axon and myelin regeneration after injury, but the myelin removal process in Wallerian degeneration is not yet fully understood, and there is still controversy about the cell types involved in myelin removal and their biological processes. Summary of the invention

[0007] At least in view of a problem existing in the above-mentioned prior art, the present invention provides the use of WIPI1 protein in myelin clearance during peripheral nerve regeneration, that is, by increasing the expression of WIPI1 in peripheral nerves, thereby promoting the clearance of lipids (phospholipids) during peripheral nerve regeneration. WIPI1 was overexpressed in rats in vitro and in vivo by genetic engineering technology. Studies have found that overexpression of WIPI1, myelin lipid-specific staining observed a gradual decrease in myelin signal expression, while the expression level of myelin-related genes decreased, and nerve function recovery was enhanced, which can accelerate the clearance of myelin fragments after nerve injury, thereby playing a role in "clearing" the way for nerve regeneration after injury.

[0008] In order to achieve the above object, the present invention adopts the following technical solution: application of WIPI1 protein in myelin clearance during peripheral nerve regeneration.

[0009] The myelin clearance during the peripheral nerve regeneration process is promoted by reducing the expression level of lipids in the sciatic nerve.

[0010] The reduction of lipid expression level in the sciatic nerve is achieved by reducing the expression level of myelin in the distal nerve.

[0011] The reduction of the lipid expression level in the sciatic nerve is achieved by reducing the gene expression levels of MPZ and MBP at the distal end of the nerve injury.

[0012] Beneficial effects: In order to study the effect of WIPI1 on myelin clearance, AAV-WIPI1 was constructed and administered by intraperitoneal injection. After administration, sciatic nerve crush injury was treated; samples were taken on days 1, 4, 7, and 28 to observe the expression of lipid levels in the sciatic nerve. Comparison showed that overexpression of WIPI1 can cause the expression of myelin signals to gradually decrease; to further verify the experimental phenomenon, qRT-PCR detection was performed on the sciatic nerve, and the results showed that overexpression of WIPI1 caused the expression of myelin-related genes to decrease. We verified the effect of overexpression of WIPI1 on nerve regeneration after injury through gait experiments and electrophysiological detection function experiments. The results showed that compared with the control group, the motor ability of the nerve expressing WIPI1 recovered significantly faster, and the nerve electrical conduction function was significantly improved, indicating that the recovery effect was better and the nerve regeneration ability was further enhanced. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Schematic diagram of the sequence of the plasmid overexpressing WIPI1.

[0014] Figure 2 The fluorescence results of myelin clearance in distal nerves of nerve injury in the AVV-NC group, AVV-WIPI1 group, AVV-WIPI1+3-MA group, and 3-MA group; Figure 3 The expression results of myelin components MPZ and MBP were detected by quantitative PCR in the AVV-NC group, AVV-WIPI1 group, AVV-WIPI1+3-MA group and 3-MA group.

[0015] Figure 4 These are the functional recovery results of motor ability in nerve injury in the AVV-NC group, AVV-WIPI1 group, AVV-WIPI1+3-MA group, and 3-MA group.

[0016] Figure 5 These are the functional recovery results of nerve signal conduction and other related functions of nerve injury in the AVV-NC group, AVV-WIPI1 group, AVV-WIPI1+3-MA group, and 3-MA group.

[0017] In the figure: Control corresponds to the AVV-NC group, WIPI1 corresponds to the AVV-WIPI1 group, WIPI1+3-MA corresponds to the AVV-WIPI1+3-MA group, and 3-MA corresponds to the 3-MA group. DETAILED DESCRIPTION

[0018] The technical scheme in the implementation of the present invention is clearly and completely described below in conjunction with the accompanying drawings. The described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. If the specific conditions are not specified in the embodiments, they are carried out according to the conditions recommended by the normal conditions or the manufacturers. If the manufacturers are not specified in the reagents, instruments, and components used, they are all conventional products that can be purchased commercially.

[0019] Example 1. Construction of WIPI1 plasmid The construction of WIPI1 plasmid in this experiment was based on GenBank ID: NM_145940.2. The full length of Wipi1 gene is 1341 bp. The plasmid (AAV-WIPI1) overexpressing WIPI1 was constructed. The sequence of the plasmid overexpressing WIPI1 is as follows Figure 1 As shown, the control adeno-associated virus (AAV-GFP) was purchased directly from Heyuan Company to synthesize a recombinant plasmid with the correct sequence.

[0020] 2. Animal Model Construction and WIPI1 Treatment Specific pathogen-free ICR mice (male, SPF, 8 weeks old) were used in this experiment. The male ICR mice were randomly divided into 4 groups: adeno-associated virus negative control (AVV-NC) group (n=15), AVV-WIPI1 group (n=15), AVV-WIPI1+3-MA group (n=15), and 3-MA group (n=15).

[0021] AAV-NC and AAV-WIPI1 were constructed using OBIO (Shanghai, China). 2 μL AAV-NC and AAV-WIPI1 viruses were injected into the sciatic nerve of mice in the AAV-NC group and AAV-WIPI1 group, respectively. On the 14th day after AAV injection, mice in the AAV-WIPI1+3-MA group and the 3-MA group were intraperitoneally injected with 3-MA at a dose of 20 mg / kg, once a day, for 1 week.

[0022] One week after administration, the four groups of mice were treated for sciatic nerve crush injury. The compound anesthetic (30 mg / kg) was injected intraperitoneally, the surgical area was prepared, and disinfected as usual. A longitudinal skin incision was made along the sciatic nerve, and blunt separation was performed until the sciatic nerve was exposed. A stainless steel sterile gasket (about 5 mm wide) was used to support the exposed sciatic nerve. Nerve crushing was performed under a stereomicroscope. Carbon powder or ink was applied to a small hemostatic forceps to facilitate marking the compression site during crushing. The middle part of the femur was selected as the reference position, and the 2 mm wide position of the hemostatic forceps was used to fully squeeze the sciatic nerve for 30 s until the nerve tissue at the crushing site became transparent. The wound was sutured routinely after surgery, and all mice were raised as usual.

[0023] 3. Immunofluorescence observation of myelin clearance The longitudinal frozen sections of sciatic nerves from different groups stored at -20℃ were taken out, placed in a slice rack to warm up, and then dried. The sections were rinsed with 0.01 M PBS for 5 min×3 times; 10% goat serum was added and blocked at 37℃ for 45 min; excess liquid was aspirated, primary antibody FluoroMyelin Red™ (ThermoFisher) was added, and the sections were placed in a wet box and placed in a 4℃ refrigerator overnight; 0.01 M PBS was rinsed for 5 min×3 times; secondary antibody was added under light-proof conditions and incubated at 4℃ overnight; 0.01 M PBS was rinsed for 5 min×6 times under light-proof conditions; anti-fluorescence quencher was added under light-proof conditions to seal the sections, and the sections were observed under a fluorescence microscope, photographed and stored, and analyzed with Image J.

[0024] Based on the fact that most of myelin components are lipids, the effect of Wipi1 on myelin clearance after sciatic nerve crush injury in mice was studied by observing the expression of dense membrane structures of myelin distal to nerve injury. Figure 2 The staining results showed that as the time after nerve injury prolonged, the myelin fluorescence signal at the distal end of the injury in the AVV-Wipi1 group was significantly weakened compared with the control group, AVV-Wipi1-3MA group and 3MA group.

[0025] These results suggest that overexpression of Wipi1 promotes the clearance of myelin in distal nerves after nerve injury.

[0026] 4. Quantitative PCR detection of gene expression levels Total RNA from tissues was extracted using Trizol reagent (Invitrogen), and then transcribed into cDNA using cDNA synthesis kit (TaKaRa). Using this cDNA as a template, SYBR Green Supermix (Bio-Rad) was used to analyze gene expression levels. The detection instrument was iQ5 Multicolor Real-Time PCR Detection System (Bio-Rad). Results 2-ΔCt method was used to calculate mRNA levels. The 18S housekeeping gene was used to calibrate the mRNA level. The primer sequences used are as follows: 18S rRNA forward primer: 5′-AGTCCCTGCCCTTTGTACACA-3′; 18S rRNA negative primer: 5'-CGTTCCGAGGGCCTCACT-3'.

[0027] MBP forward primer: 5′-TCACAGCGATCCAAGTACCTG -3′; MBP negative primer: 5'TCACAGCGATCCAAGTACCTG -3'.

[0028] MPZ forward primer: 5′-CGGACAGGGAAATCTATGGTGC-3′; MPZ negative primer: 5′-GCGCCAGGTAAAAGAGATGTCA-3′.

[0029] The expression of myelin components MPZ and MBP was detected in real time to further study the clearance of myelin proteins distal to nerve injury by Wipi1. Figure 3 The results showed that the gene expression levels of MPZ and MBP in the distal part of nerve injury in the Wipi11 group of mice after injury were significantly lower than those in the other three groups of mice, and the difference was statistically significant.

[0030] Therefore, overexpression of Wipi1 can promote the clearance of distal nerve myelin proteins MPZ and MBP after sciatic nerve injury, thereby promoting myelin clearance after nerve injury.

[0031] 5. Behavioral evaluation of nerve injury repair Behavioral tests such as heat pain, rotarod, gait and electrophysiology were performed at corresponding time points after nerve crush injury.

[0032] 1) Gait analysis The sciatic function index (SFI) is a reliable method to evaluate the functional status of the sciatic nerve after injury and repair. At the corresponding time points after surgery, mice were placed on a glass platform to walk, and the CatWalk software was used to collect data. The corresponding parameters of each group of mice were recorded, including the maximum contact area, stride length, and swing speed. Finally, the average strength and sciatic nerve function index (SFI) were calculated according to the formula. The SFI value varies between -100 and 0, where the SFI is normally defined as 0 and -100 corresponds to complete loss of nerve function.

[0033] The recovery of nerve damage includes the recovery of motor function. Figure 4 Gait analysis showed that the overall functional recovery of the Wipi1 group was relatively faster and better. Under the reinnervation of nerves, the soles and toes could more effectively support the walking body. At the same time, the calculation and analysis of SFI showed that at each time point, the recovery of the Wipi1 group was significantly better than that of the control group; the inhibitor 3-MA could significantly prevent the recovery of SFI. After overexpressing Wipi1, the recovery speed of the neuromotor ability of mice was significantly faster and the recovery effect was better.

[0034] 2) Electrophysiological testing At the corresponding time points after surgery, the mice were subjected to electrophysiological testing at room temperature. Intraperitoneal anesthesia, hair shaving and skin preparation were performed, and iodine disinfection was performed to expose the sciatic nerve (including the bridge segment) on the surgical side. The nerves at both ends of the bridge segment were separated with a glass needle, and the compound muscle action potentials (CMAPs) were measured. The recording electrode was inserted into the gastrocnemius muscle, and then the distal and proximal ends of the sciatic nerve were electrically stimulated with 5.0 mA and 0.1 ms pulse width, respectively, and the CMAPs and latency were recorded, and the motor nerve conduction velocity (MCV) was calculated. The non-surgical side was also stimulated in the same way, and the data of the normal group were recorded.

[0035] The recovery of nerve damage function includes the recovery of related functions such as nerve signal conduction. Figure 5 Electrophysiological results showed that compared with the control group, the latency of the electromyogram in the Wipi1 group was shorter and the amplitude was larger. The average nerve conduction velocity of the Wipi1 group mice after nerve injury was significantly higher than that of the control group. That is, Wipi1 significantly promoted the effective transmission of electrical signals in regenerated nerves.

[0036] In summary, overexpression of Wipi1 can further enhance the ability of nerve regeneration by clearing the myelin sheath of distal nerves after injury.

[0037] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the present invention can be implemented in other specific forms without departing from the spirit and essential features of the present invention. Therefore, the embodiments should be considered exemplary and non-restrictive in all respects, and the scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims be included in the present invention.

[0038] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. Application of WIPI1 protein in myelin clearance during peripheral nerve regeneration.

2. The use of the WIPI1 protein in myelin removal during peripheral nerve regeneration according to claim 1, characterized in that: The myelin clearance during the peripheral nerve regeneration process is promoted by reducing the expression level of lipids in the sciatic nerve.

3. The use of the WIPI1 protein in myelin removal during peripheral nerve regeneration according to claim 2, characterized in that: The reduction of lipid expression level in the sciatic nerve is achieved by reducing the expression level of myelin in the distal nerve.

4. The use of the WIPI1 protein in myelin removal during peripheral nerve regeneration according to claim 3, characterized in that: The reduction of the lipid expression level in the sciatic nerve is achieved by reducing the gene expression levels of MPZ and MBP at the distal end of the nerve injury.

Images