Application of GluN3B inhibitor in preparation of medicine for preventing or treating obesity and related metabolic syndromes

Abstract

The invention provides an application of a GluN3B inhibitor in preparation of drugs for preventing or treating obesity and related metabolic syndromes. The invention provides application of a GluN3B inhibitor in prevention and treatment of obesity. A food-induced obesity model rich in fat (the proportion is 45%) is taken as a research object, and the GluN3B gene knockout or knockdown can effectively inhibit the weight gain of mice. In-vivo animal experiments show that the knockout or knockdown of the GluN3B gene can activate brown adipose tissues to remarkably promote energy consumption of mice, which is an important reason for causing slow weight growth of the mice.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to the use of an NMDA receptor GluN3B subunit specific inhibitor in obesity and related metabolic syndrome by promoting body energy consumption, and specifically relates to the use of a GluN3B inhibitor in the preparation of a drug for preventing or treating obesity and related metabolic syndrome. Background Art

[0002] Obesity, as a complex and widespread health problem, is scientifically defined as an abnormal increase in fat tissue in the body, resulting in a body weight exceeding the normal range, usually measured by the body mass index (BMI). When the BMI value exceeds 30, it is considered to be obese. The formation of this condition is the result of a combination of factors, including genetic susceptibility, poor eating habits, lack of physical activity, environmental factors, and certain endocrine or metabolic disorders.

[0003] Obesity is not just a matter of appearance, it also profoundly affects the physiological functions and health of the human body. In the obese state, the accumulation of adipose tissue, especially visceral fat, in the body will promote the release of a variety of inflammatory factors and metabolites, interfere with the normal function of insulin, lead to insulin resistance, and increase the risk of type 2 diabetes. At the same time, obesity is also an important risk factor for cardiovascular disease, which increases the incidence of cardiovascular events such as heart disease and stroke by promoting the occurrence and development of hypertension, hypercholesterolemia and atherosclerosis. In addition, obesity also has adverse effects on multiple systems such as the respiratory system, skeletal system and reproductive system. The increased burden on the respiratory system can easily lead to sleep apnea syndrome and affect sleep quality; the skeletal system accelerates wear due to long-term excessive pressure, increasing the risk of degenerative diseases such as osteoarthritis; for the reproductive system, obesity may interfere with the balance of sex hormones and affect the fertility of men and women. More seriously, obesity is also closely related to the occurrence and development of a variety of cancers. Scientific research shows that the chronic inflammatory environment and metabolic disorders in the obese state provide favorable conditions for the growth of tumor cells, thereby increasing the risk of a variety of cancers such as breast cancer, colorectal cancer, and endometrial cancer.

[0004] Therefore, it is crucial to develop effective prevention and intervention strategies for obesity and other related metabolic syndromes. Weight regulation is a complex process involving multiple metabolic pathways in the central nervous system (CNS) and peripheral tissues. Maintaining normal body weight (BMI ≤ 25 kg / m 2) requires a balance between energy intake and energy expenditure. The treatment of obesity and subsequent maintenance of body weight have proven to be very challenging due to the multiple biological mechanisms that influence the regulation of energy homeostasis. Behavioral changes that promote healthy eating habits and encourage more exercise are first-line therapies for obesity, but these therapies often fail to produce sustained weight loss due to the adaptations that occur to prevent the starvation state (e.g., reduced energy expenditure and increased appetite). In addition, bariatric surgery can reduce the risk of obesity-related complications, but its high cost and significant risks have severely limited its widespread use. Over the past decade, pharmacological treatments for weight loss have developed rapidly. In particular, the recent emergence of glucagon-like peptide-1 (GLP-1) agonists, such as exenatide, liraglutide, dulaglutide, and semaglutide, have shown great potential in the treatment of obesity and diabetes. However, many patients experience severe side effects, such as nausea, vomiting, and diarrhea, and the development of additional adjunctive pharmacological treatment strategies would be of great benefit. NMDA receptors are the targets of many natural and synthetic drugs. At the same time, a small number of studies have shown that the effects of different subunits of NMDA receptors on body weight and energy homeostasis are inconsistent, which fully demonstrates that it is feasible to develop agonists or antagonists targeting different subunits of NMDA receptors as anti-obesity treatments. Summary of the invention

[0005] The purpose of the present invention is to overcome at least one disadvantage of the above-mentioned prior art and to provide a novel therapeutic target and the application possibility of related inhibitors in preventing and treating obesity and related metabolic syndrome.

[0006] In order to solve the above technical problems, the present invention provides a use of a GluN3B inhibitor in the preparation of a drug for preventing or treating obesity and related metabolic syndrome.

[0007] Preferably, the GluN3B inhibitor is a protein molecule, a nucleic acid molecule, a small molecule compound, a virus particle, or any combination of two or more of the foregoing, which inhibits the activity of GluN3B or reduces the expression level of GluN3B. The technical means for knocking out, knocking down or silencing the Grin3b gene include but are not limited to various miRNAs, siRNAs, shRNAs and their modifications targeting GluN3B, as well as siRNAs or shRNA fragments of GluN3B carried by various vectors, or other technical means for knocking down or knocking out GluN3B using genetic engineering.

[0008] Preferably, the GluN3B inhibitor is a CRISPR / Cas9 gene editing system for knocking out, knocking down or silencing the Grin3b gene.

[0009] Preferably, the GluN3B inhibitor is selected from one or more of the following compounds:

[0010]

[0011] Preferably, the obesity and related metabolic syndrome are selected from one or more of simple obesity caused by genetic factors, overeating, and lack of exercise.

[0012] Preferably, the drug comprises an active ingredient and a pharmaceutically acceptable carrier, and the active ingredient is a GluN3B inhibitor.

[0013] The present invention provides the use of GluN3B inhibitors in preventing and treating obesity. By using a fat-rich (45%) food-induced obesity model as the research object, it was found that GluN3B gene knockout or knockdown can effectively inhibit the weight gain of mice. In vivo animal experiments show that GluN3B gene knockout or knockdown can activate brown adipose tissue and significantly promote the energy consumption of mice, which is an important reason for the slow weight gain of mice. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 A to 1M are graphs showing the effect of Grin3b gene knockout on mouse weight gain and energy expenditure in Example 1.

[0015] Figure 2 A to 2L are graphs showing the effect of knockdown of the Grin3b gene in brown adipose tissue (BAT) on weight gain and energy expenditure in mice in Example 2. DETAILED DESCRIPTION

[0016] In order to make the technical means, creative features, objectives and effects achieved by the present invention easy to understand, the present invention is further described below in conjunction with specific embodiments.

[0017] The present invention first discovered GluN3B (the gene encoding it in mice is Grin3b, the latest discovered NMDA receptor subunit), which is an important molecule for regulating body weight and energy consumption. NMDA receptor GluN3B subunit inhibitors can inhibit weight gain under physiological or pathological conditions. Grin3b gene knockout or local tissue knockdown of Grin3b gene expression levels can promote a significant increase in energy consumption in mice and significantly inhibit weight gain in mice under normal diet or high-fat conditions. The above fully illustrates the application prospects of GluN3B inhibitors in preventing and treating obesity and related metabolic syndromes.

[0018] The present invention comprehensively verifies the importance of Grin3b gene for maintaining body weight and energy homeostasis through overall knockout, tissue-specific knockout and knockdown experiments of Grin3b gene (coding protein GluN3B). A series of compounds that inhibit GluN3B activity have application value in preventing and treating obesity or related metabolic syndrome. Known GluN3B inhibitors are the following compounds:

[0019]

[0020] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents or consumables involved can be obtained through commercial channels unless otherwise specified.

[0021] Example 1 Effects of Grin3b gene knockout on weight gain and energy expenditure in mice

[0022] Material:

[0023] Healthy female SPF wild-type and Grin3b knockout C57BL / 6J mice, metabolic cages (Oxymax / CLAMS, Columbus Instruments), Topscan behavioral analysis system (CleverSys).

[0024] method:

[0025] Grin3b knockout mice were constructed using CRISPR / Cas9 gene editing technology: double-strand breaks (DSBs) were introduced into the target gene by CRISPR-Cas9, and cells repaired the breaks through the non-homologous end joining (NHEJ) repair mechanism. In the process, insertion or deletion (indels) mutations may be introduced, resulting in loss of function of the target gene; knockout Grin3b sequence primers (CAGGTCAGGAAGCAGGGGTCATTGT, amplicon 636bp) and wild-type Grin3b site primers (AGCCACTCAGTGTTGGTGCTAGGAA, amplicon 531bp) were used to identify their genotypes. The wild-type controls of the same litter were used as the research objects, and the weight of mice was continuously tested. Metabolic cages were used to monitor the energy consumption level and food intake of mice, and the open field test (OFT) was used to detect changes in the motor ability of mice. The specific methods are as follows:

[0026] (1) Core body temperature and weight measurement

[0027] The core temperature of mice was measured between 9:00 and 10:00 a.m. using a rectal probe thermometer (ALC-ET03, Shanghai Alcott Biotechnology Co., Ltd., China). The body weight of mice was measured between 9:00 and 10:00 a.m. using an electronic scale.

[0028] (2) Metabolic cage experiment to monitor indicators such as energy consumption of mice

[0029] The metabolic cage experiment is a commonly used technique in biological and medical research. It is mainly used to monitor and evaluate the physiological metabolic parameters of experimental animals, such as food intake, O2 consumption, CO2 production, energy consumption and other indicators. Under the premise of ensuring that the laboratory environment meets the requirements for the use of metabolic cages (including appropriate temperature, humidity and lighting conditions), check whether the components of the metabolic cage are complete, including cages, food and water supply systems, sensors and recorders, etc., assemble the metabolic cage correctly according to the instructions, and ensure that the components are tightly connected and leak-free. 8-10w SPF control group and experimental treatment group C57BL / 6J mice were used as research subjects. The experimental animals were placed in metabolic cages for 1-2 days in advance to adapt to the new environment, and observe whether their urine volume under free drinking water conditions was stable. The recorder was used to monitor and record the mice's O2 consumption and CO2 production within the next 48 hours to calculate the mice's calorie consumption and respiratory entropy (RER).

[0030] (3) Open Field Test (OFT) to detect the autonomous movement ability of mice

[0031] The Open Field Test (OFT) is a commonly used behavioral experimental method, which is mainly used to monitor and evaluate the autonomous movement ability, exploration behavior of novel environments, and anxiety of mice. The following are the detailed steps for monitoring the autonomous movement of mice in the open field test:

[0032] Experimental equipment: A square open area with high borders was used to prevent mice from escaping. The size of the mouse test box was 40 cm in diameter, 40 cm in diameter, and 30 cm in height. A camera system was used to record the activities of mice in the open field. The movement trajectory of mice and data analysis were tracked by Topscan video recording and analysis software to evaluate the effect of the Grin3b gene on the autonomous movement ability of mice.

[0033] (4) Analysis of cell diameter by HE staining of brown adipose tissue (BAT)

[0034] BAT from the interscapular region of mice was taken and fixed overnight in 4% PFA. According to the standard protocol of Wuhan Service Biotechnology Co., Ltd. (China), 3-5 μm thick paraffin sections were prepared and stained with hematoxylin and eosin (H&E). Images were acquired using an Olympus VS200 slide scanner (Olympus, Japan) and the cell diameters in each image were analyzed.

[0035] (5) Protein extraction and immunoblotting

[0036] After adding M-PER mammalian protein extraction reagent (Thermo Fisher Scientific, 78501, USA) containing a mixture of protease and phosphatase inhibitors (Sigma-Aldrich, A32959, UK) to BAT tissue, it was ground and lysed using a tissue homogenizer (Servicebio, KZ-II, China), and then centrifuged at 13200g for 10 minutes at 4°C. The protein concentration of each sample was determined using a bicinchoninic acid (BCA) protein assay kit (Thermo Fisher Scientific, 23225, USA). For immunoblotting, 15-20 μg of protein samples were separated using 4%-12% / 15% SDS-PAGE gels. Protein signals were imaged and analyzed using the Bio-Rad ChemiDoc system. The antibodies used were as follows: TH (Cell Signaling Technology, 13106, 1:2000, USA), UCP1 (Abcam, ab10983, 1:3000, USA), β-actin (Bioworld technology, AP0060, 1:5000, China).

[0037] The results are as follows Figure 1 A to Figure 1 M, specifically, Figure 1 As shown in A, Grin3b knockout in mice significantly inhibited body weight gain and food intake (as Figure 1 B) and movement (as Figure 1 C) has no obvious change. Figure 1 As shown in D and 1E, basal heat production was increased in Grin3b-KO mice. Figure 1 H and Figure 1 As shown in I, histological analysis showed that smaller lipid droplets were present in BAT adipocytes of Grin3b-KO mice. Figure 1 J to Figure 1 As shown in L, the expression of UCP1 and TH proteins responsible for thermogenesis in BAT of Grin3b-KO mice was significantly increased.

[0038] It can be seen that after Grin3b gene knockout, the weight gain of mice showed a significant slowing trend, while the food intake and exercise levels of mice did not change significantly. Furthermore, metabolic cage data showed that after Grin3b gene knockout, the energy consumption of mice was significantly enhanced, accompanied by increased core body temperature, decreased average cell size of BAT, and increased expression of TH and UCP1 in BAT.

[0039] In order to further confirm the role of Grin3b gene deletion in the high-fat diet-induced obesity model, the following experiment was conducted: 8 wild-type mice and 8 Grin3b-KO mice were prepared, and after being fed a normal diet in the same breeding environment for eight weeks, they were fed a 45% high-fat (Jiangsu Collaborative Pharmaceutical Bioengineering, XTHF45) diet. The high-fat diet was changed twice a week, and body weight was measured at 10 am every Tuesday.

[0040] When mice were fed a 45% high-fat diet, Figure 1 As shown in Figure 2, the weight gain of Grin3b-KO mice was significantly reduced compared with wild-type mice. Under a high-fat diet, it was found that the weight gain of Grin3b knockout mice was significantly slowed down. The above fully demonstrates that GluN3B molecular inhibitors have great potential in treating diseases such as obesity.

[0041] This Example 1 demonstrates that whole-body knockout of Grin3b in mice significantly inhibits weight gain and changes the metabolism and thermogenesis of brown adipose tissue.

[0042] Example 2

[0043] Knockdown of Grin3b gene in brown adipose tissue (BAT) inhibits weight gain in mice and promotes energy consumption in mice. The experimental design diagram of Example 2 is shown in the figure below. Figure 2 As shown in A.

[0044] Material:

[0045] Healthy female SPF-grade C57BL / 6J mice, metabolic cages (Oxymax / CLAMS, Columbus Instruments), Topscan behavioral analysis system (CleverSys).

[0046] method:

[0047] AAV2 / 8 serotype virus was used to locally knock down the Grin3b gene in BAT to reduce the expression level of the Grin3b gene in BAT, specifically: eight-week-old mice were divided into a control group and an experimental group, and AAV2 / 8 serotype virus was injected into the BAT on both sides of the mice, and a high-fat diet was fed after one week of recovery after surgery, and the high-fat food was changed twice a week, and the body weight was measured at the same time every week. As in the method in Example 1, metabolic cages were used to monitor indicators such as the energy consumption level and food intake of mice, and the open field test (OFT) was used to detect changes in the motor ability of mice.

[0048] The results are as follows Figure 2 As shown in B to 2L, with the knockdown of Grin3b in mouse BAT (as Figure 2 B), the weight gain of mice was significantly slowed down (as shown in Figure 2 C), food intake (as Figure 2 D) and movement (as Figure 2 E) showed no significant changes. Grin3b knockdown mice showed a significant increase in basal heat production during the active period (as shown in Figure 2 F), there was no significant change in rectal temperature (as shown in Figure 2 G). Histological analysis showed that smaller lipid droplets were present in BAT adipocytes of Grin3b knockdown mice (Fig. Figure 2 H and Figure 2 I), accompanied by increased expression of UCP1 and TH proteins (as shown in Figure 2 J to 2K).

[0049] It can be seen that after local knockdown of the Grin3b gene in BAT, accompanied by a significant decrease in the expression level of Grin3b mRNA in the tissue, the weight gain of mice showed a significantly slowed trend, while the food intake and exercise levels of mice did not change significantly. Furthermore, metabolic cage data showed that after the Grin3b gene was knocked out, the energy consumption of the mouse body was significantly enhanced, accompanied by an increase in core body temperature, a decrease in the average cell size of BAT, and an increase in the expression of TH and UCP1 in BAT.

[0050] In order to further confirm the effect of Grin3b gene deletion in the high-fat diet-induced obesity model, the steps were the same as those in Example 1. When mice were given a 45% high-fat diet, the weight gain of Grin3b knockdown mice in BAT under the high-fat diet was significantly reduced compared with the control mice (e.g. Figure 2 L). It was found that after local knockdown of Grin3b gene in BAT, the weight gain of mice was significantly slowed down. The above fully demonstrates that peripheral inhibition of GluN3B molecular function can effectively suppress the weight gain of mice.

[0051] This Example 2 demonstrates that knockdown of Grin3b in BAT significantly inhibits weight gain in mice, promotes metabolism and thermogenesis of adipose tissue, and functional sympathetic innervation.

[0052] In summary, overweight and obesity are important public health issues in developed countries, leading to a large amount of mortality and morbidity. The invention of GluN3b-specific inhibitors provides new possibilities for clinical applications in patients with obesity and metabolic disorders. GluN3b provides a new target for the treatment of obesity and other related metabolic disorders by regulating the mechanism of brown adipose tissue function and energy consumption.

[0053] In this specification, the present invention has been described with reference to specific embodiments thereof. However, it is apparent that various modifications and variations may be made without departing from the spirit and scope of the present invention. Therefore, the description should be regarded as illustrative rather than restrictive.

Claims

1. Use of GluN3B inhibitors in the preparation of drugs for preventing or treating obesity and related metabolic syndrome.

2. The use according to claim 1, characterized in that: The GluN3B inhibitor is a protein molecule, a nucleic acid molecule, a small molecule compound, a virus particle or any combination of two or more of the foregoing, which inhibits the activity of GluN3B or reduces the expression level of GluN3B.

3. The use according to claim 1, characterized in that: The GluN3B inhibitor is a CRISPR / Cas9 gene editing system for knocking out, knocking down or silencing the Grin3b gene.

4. The use according to claim 1, characterized in that: The GluN3B inhibitor is selected from one or more of the following compounds:

5. The use according to claim 1, characterized in that: The obesity and related metabolic syndrome are selected from simple obesity caused by one or more factors including heredity, overeating and lack of exercise.

6. The use according to claim 1, characterized in that: The medicine comprises an active ingredient and a pharmaceutically acceptable carrier, and the active ingredient is a GluN3B inhibitor.

Images