Application of Atp6ap2 in preparation of medicine for treating heart failure

Abstract

The invention relates to application of Atp6ap2 in preparation of a medicine for treating heart failure. Experiments prove that when the recombinant adeno-associated virus expressing the Atp6ap2 protein acts on a mouse individual in an intravenous injection mode, myocardial fibrosis caused by acute myocardial infarction can be improved, the heart function is effectively recovered, and the purpose of treating or improving heart failure caused by acute myocardial infarction is achieved; and a new direction is provided for research and development of heart failure medicines.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and particularly relates to the application of Atp6ap2 in preparing medicine for treating heart failure. Background Art

[0002] Heart failure (HF) is a complex progressive disease characterized by high morbidity and mortality and variable duration of symptom stability. Heart failure is caused by damage to the structure or function of the heart, which impairs the ability of the ventricles to fill or eject blood, and is accompanied by the consequences of myocardial cell loss, vascular disintegration, and extracellular matrix disorder, which seriously threatens human life and health. Among them, acute myocardial infarction (AMI) is one of the main causes of death. At present, drug treatments for heart failure include small molecule drugs targeting G protein-coupled receptors (GPCRs), especially β-adrenergic receptors and angiotensin II type 1 (AT1) receptor antagonists, but the prognosis of patients is poor. Therefore, it is of great significance to find new therapies to prevent or treat heart failure.

[0003] In recent years, gene therapy has shown broad potential. The field of gene therapy has also made significant progress in clinical applications, including many diseases that affect the cardiovascular system. Adeno-associated virus (AAV) is one of the most actively studied gene therapy vectors. Due to its good delivery effect, lack of pathogenicity, low immunogenicity, high safety, and long-term expression in different tissues, AAV has become a key delivery tool in clinical gene therapy for cardiovascular diseases. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide an application of Atp6ap2 in the preparation of a drug for treating heart failure. The drug prepared using Atp6ap2 can treat or improve heart failure, especially has a good therapeutic effect on heart failure caused by acute myocardial infarction.

[0005] The present invention provides the use of Atp6ap2 gene or the protein encoded by it in preparing medicine for treating heart failure.

[0006] Furthermore, the nucleotide sequence of Atp6ap2 is shown in SEQ ID NO.1.

[0007] Furthermore, the heart failure includes heart failure caused by acute myocardial infarction.

[0008] Furthermore, the drug contains an Atp6ap2 gene expression promoter.

[0009] Furthermore, the promoter includes a viral vector or a non-viral vector that highly expresses Atp6ap2.

[0010] Preferably, the viral vector includes one or more of an adeno-associated viral vector, a lentiviral vector, a retroviral vector, and an adenoviral vector.

[0011] Preferably, the adeno-associated virus vector includes one or more of AAV9, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV-DJ.

[0012] Furthermore, the adeno-associated virus vector is adeno-associated virus type 9.

[0013] Furthermore, the adeno-associated virus vector has a myocardium-specific promoter cTNT.

[0014] Most preferably, the adeno-associated virus vector is AAV9-cTNT-Atp6ap2.

[0015] Preferably, the non-viral vector includes one or more of a cationic polymer vector, a liposome vector, a nanoparticle vector, and an extracellular vesicle.

[0016] Preferably, the medicament comprises pharmaceutically acceptable excipients.

[0017] Preferably, the drug is in the form of an intravenous injection.

[0018] Beneficial Effects

[0019] The present invention proves through experiments that the recombinant adeno-associated virus expressing Atp6ap2 protein can improve myocardial fibrosis caused by acute myocardial infarction and effectively restore cardiac function by intravenous injection into individual mice, thereby achieving the purpose of treating or improving acute myocardial infarction, and providing a new direction for the research and development of heart failure drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a diagram of the AAV9-cTNT-Atp6ap2 vector of an embodiment of the present invention.

[0021] Figure 2 A schematic diagram of constructing a mouse acute myocardial infarction model in an embodiment of the present invention, and injecting AAV9-cTNT-Atp6ap2 adeno-associated virus into the tail vein.

[0022] Figure 3This is a graph showing the results of real-time fluorescence quantitative PCR detection of the expression of Atp6ap2 in the myocardial tissue of mice after the AAV9-cTNT-Atp6ap2 adeno-associated virus was injected into the mouse via the tail vein in an embodiment of the present invention; n=3; ns, no statistical significance; *, p<0.05; **, p<0.01.

[0023] Figure 4 This is a graph showing the results of echocardiography detection of left ventricular ejection fraction (LVEF) and left ventricular fractional shortening (LVFS) in mice after intravenous injection of AAV9-cTNT-Atp6ap2 adeno-associated virus after acute myocardial infarction according to an embodiment of the present invention; n=7:5:7:7; ns, no statistical significance; *, p<0.05; **, p<0.01.

[0024] Figure 5 This is a graph showing the results of an example of the present invention showing that intravenous injection of AAV9-cTNT-Atp6ap2 adeno-associated virus significantly improves inflammation caused by acute myocardial infarction.

[0025] Figure 6 This is a graph showing the result of an example of the present invention showing that intravenous injection of AAV9-cTNT-Atp6ap2 adeno-associated virus significantly improves myocardial fibrosis caused by acute myocardial infarction. DETAILED DESCRIPTION

[0026] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, it should be understood that after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall within the scope limited by the appended claims of the application equally.

[0027] Example 1

[0028] like Figure 1 As shown, Shanghai Jiman Biotechnology Co., Ltd. was commissioned to use the AAV9 overexpression vector to construct an expression vector of Atp6ap2, and the recombinant virus was named AAV9-cTNT-Atp6ap2. The nucleotide sequence of the Atp6ap2 gene is shown in SEQ ID NO.1.

[0029] Example 2

[0030] like Figure 2 As shown, an acute myocardial infarction model was established in mice, and AAV9-cTNT-Atp6ap2 adeno-associated virus was injected intravenously.

[0031] 1. Experimental Methods

[0032] Construction of acute myocardial infarction model in mice: Before surgery, depilatory cream was used to remove hair from the neck and abdomen of the mice. After anesthesia with 2.0% isoflurane and ventilation, the mice were fixed on a constant temperature pad at about 37°C with medical tape. Under a microscope, the skin was cut straight along the neck and the muscle tissue covering the neck was separated. After exposing the trachea, a small hole was cut and a tracheal tube was inserted for mechanical ventilation. The surgical area in front of the left chest was disinfected with alcohol, and a transverse incision was made at the fourth and fifth intercostal positions on the left edge of the mouse sternum using small scissors. The chest wall muscles and intercostal muscles were bluntly separated layer by layer to expose the heart and ligate the left anterior descending artery. After suturing the surgical wound, the mice were placed back in the cage from the constant temperature pad until they woke up. 48 hours after modeling, the drug treatment was carried out for 8 weeks, and then the mice were killed and the heart tissue was taken.

[0033] The operation of the sham group was similar to the above steps, with the only difference being that the ligation part of the above steps was not performed.

[0034] Intravenous injection of AAV9-cTNT-Atp6ap2: 5×10 11 The dose of Vg was injected into the mice by tail vein injection, where vg represents vector genome. This experiment was divided into 4 groups, and the specific grouping information is as follows: the first group was the sham operation group; the second group was the AMI operation group; the third group was the AMI operation group + injection of control virus (AAV9-cTNT-control); the fourth group was the AMI operation group + injection of Atp6ap2 overexpression virus (AAV9-cTNT-Atp6ap2).

[0035] Example 3

[0036] Real-time fluorescence quantitative PCR was used to detect the expression of Atp6ap2 in myocardial tissue injected with AAV9-cTNT-Atp6ap2.

[0037] 1. Experimental Methods

[0038] Real-time fluorescence quantitative PCR (qPCR): Heart tissue was lysed using RNA lysis solution Trizol. Total RNA was extracted from tissue samples using the chloroform-isopropanol RNA extraction method. The RNA concentration and purity of the samples were determined using an ultra-micro spectrophotometer. cDNA was synthesized using the Takara reverse transcription kit. Fluorescence quantitative PCR reaction conditions: 95°C 30s; 95°C 5s and 60°C 30s (40 cycles); 95°C 15s; 60°C 1min; 95°C 15s. Finally, 2 -ΔCT The expression of Atp6ap2 was calculated and analyzed by the method.

[0039] The primer sequences used in the qPCR reactions are as follows:

[0040] Upstream primer F (SEQ ID NO.2): CCAGTTTGTTGTCTCGTCATAAGC

[0041] Downstream primer R (SEQ ID NO.3): GCGTTCCCACCATAGAGACTG

[0042] 18S as internal reference gene:

[0043] Upstream primer F (SEQ ID NO.4): TCAAGAACGAAAGTCGGAGG

[0044] Upstream primer R (SEQ ID NO.5): GGACATCTAAGGGCATCAC

[0045] 2. Experimental results

[0046] Real-time fluorescence quantitative PCR was used to detect the expression level of Atp6ap2 in myocardial tissue after intravenous injection of AAV9-cTNT-Atp6ap2. Figure 3 As shown: the expression of Atp6ap2 in the myocardial tissue of AMI group mice was downregulated, and there was no significant difference in the expression of Atp6ap2 in the AMI+AAV9-cTNT-control group compared with the AMI group mice; after intravenous injection of AAV9-cTNT-Atp6ap2, the expression of Atp6ap2 in the myocardial tissue was significantly upregulated, so AAV9-cTNT-Atp6ap2 was successfully overexpressed in the myocardial tissue.

[0047] Example 4

[0048] Effects of intravenous injection of AAV9-cTNT-Atp6ap2 adeno-associated virus on left ventricular ejection fraction and fractional shortening in mice with acute myocardial infarction.

[0049] 1. Experimental Methods

[0050] After depilating the mouse chest, the mouse was anesthetized with isoflurane, and the mouse limbs were fixed to the ultrasound plate with medical tape, and an appropriate amount of ultrasound gel was applied to the mouse heart. When the heart rate stabilized at about 400 bpm, the mouse heart was found with a probe for B-mode and M-mode echocardiography, and the left ventricular ejection fraction and shortening fraction, which were related indicators of cardiac function, were measured and calculated.

[0051] 2. Experimental results

[0052] Echocardiography results Figure 4As shown: Compared with the mice in the sham operation group, the left ventricular ejection fraction and shortening fraction indices of the mice in the AMI group were reduced; compared with the mice in the AMI group, there was no significant difference in the cardiac function indices of the mice in the AMI+AAV9-cTNT-control group; compared with the AMI+AAV9-cTNT-control group, the left ventricular ejection fraction and shortening fraction indices of the mice were significantly improved after AAV9-cTNT-Atp6ap2 adeno-associated virus treatment.

[0053] Example 5

[0054] Effects of intravenous injection of AAV9-cTNT-Atp6ap2 adeno-associated virus on inflammation and myocardial fibrosis in mice with acute myocardial infarction.

[0055] 1. Experimental Methods

[0056] Hematoxylin-eosin (HE) staining: The removed tissue is fixed in 4% paraformaldehyde, then gradually dehydrated and embedded, and 5μm paraffin sections are cut out by a paraffin slicer; then dewaxed and hydrated in xylene in sequence, each for 10 minutes. Soak in 95% alcohol, 75% alcohol, and 50% alcohol in sequence, each for 2 minutes. Rinse with running water for 10 minutes. Add hematoxylin staining solution to the tissue section and stain for about 5 minutes, and rinse with running water for 3-5 seconds. Shake off excess water, stain with eosin staining solution for 10-30 seconds, and rinse with running water for 3-5 seconds. After wiping off excess water on the section, seal the section with neutral gum.

[0057] Masson staining: Soak the dewaxed and hydrated tissue paraffin sections in potassium dichromate overnight. Prepare hematoxylin A and B solutions in a 1:1 ratio according to the instructions in the Masson staining kit. Drop the mixture on the sliced ​​tissue and rinse off the floating color with clean water after 2 minutes; dye the sliced ​​tissue with Ponceau red solution for 2 minutes and then rinse off the floating color with clean water; dye the sliced ​​tissue with phosphomolybdic acid for 2 minutes and then directly shake off the dye; finally, drop the aniline blue dye on the sliced ​​tissue for 1 minute and then rinse off the floating color with clean water; wipe off the excess water on the slice and seal the slice with neutral gum.

[0058] 2. Experimental results

[0059] The results are as follows Figure 5 As shown: Compared with the mice in the sham operation group, the infiltration of inflammatory cells in the myocardial tissue of the mice in the AMI group was increased; compared with the mice in the AMI group, there was no significant difference in the infiltration of inflammatory cells in the AMI+AAV9-cTNT-control group; compared with the AMI+AAV9-cTNT-control group, the infiltration of inflammatory cells in the myocardial tissue of the mice was significantly reduced after AAV9-cTNT-Atp6ap2 adeno-associated virus treatment.

[0060] The results are as follows Figure 6 As shown: Compared with the mice in the sham operation group, the area of ​​fibrosis in the myocardial tissue of the AMI group mice was increased; compared with the mice in the AMI group, there was no significant difference in the degree of fibrosis in the AMI+AAV9-cTNT-control group; compared with the AMI+AAV9-cTNT-control group, the area of ​​fibrosis in the myocardial tissue of the mice was significantly reduced after AAV9-cTNT-Atp6ap2 adeno-associated virus treatment.

Claims

1. Use of the Atp6ap2 gene or the protein encoded by it in the preparation of drugs for treating heart failure.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the Atp6ap2 gene is shown in SEQ ID NO.

1.

3. The use according to claim 1, characterized in that: The heart failure includes heart failure caused by acute myocardial infarction.

4. The use according to claim 1, characterized in that: The medicine comprises an Atp6ap2 gene expression promoter.

5. The use according to claim 4, characterized in that: The promoter includes a viral vector or a non-viral vector that highly expresses Atp6ap2.

6. The use according to claim 5, characterized in that: The viral vector includes one or more of an adeno-associated viral vector, a lentiviral vector, a retroviral vector, and an adenoviral vector.

7. The use according to claim 6, characterized in that: The adeno-associated virus vector includes one or more of AAV9, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV-DJ.

8. The use according to claim 5, characterized in that: The non-viral vector includes one or more of a cationic polymer vector, a liposome vector, a nanoparticle vector, and an extracellular vesicle.

9. The use according to claim 1, characterized in that: The drug includes pharmaceutically acceptable excipients.

10. The use according to claim 1, characterized in that: The dosage form of the drug is intravenous injection.

Images