Pigeon adenovirus type 1 strain YJ-NM and application thereof

Abstract

The invention discloses a pigeon adenovirus type 1 strain YJ-NM and application thereof, and belongs to the technical field of bioengineering. The pigeon adenovirus 1 type strain YJ-NM provided by the invention is preserved in China Center for Type Culture Collection, the preservation address is Wuhan University, Wuhan, China, the preservation date is August 29, 2024, and the preservation number is CCTCC NO: V202476. The strain has high virus titer and can be used for production and inspection of pigeon adenovirus vaccines, and the produced vaccines have good safety and efficacy for prevention of pigeon type 1 adenovirus infection.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to a pigeon adenovirus type 1 strain YJ-NM and an application thereof. Background Art

[0002] The genome of adenovirus is a linear double-stranded DNA virus without an envelope and presenting an icosahedral symmetrical structure; it is composed of 720 hexon subunits that together form the surface capsid of 240 trimer hexon virus particles and 12 pentons at the apex that together constitute the adenovirus. Two fiber proteins (Fiber) appear in the extension of the pentons, which are very important virulence genes of the virus and play a key role in the adhesion process when the virus infects host cells. Adenovirus Hexon is the main antibody recognition site carrying the virus and is the basis for distinguishing species in the family. Adenovirus is divided into three subgroups: I, II, and III according to different antigenic characteristics. Among them, avian adenovirus group I can be isolated from poultry chickens and pigeons. Pigeon adenovirus has been clearly classified in the avian adenovirus species classification, and the clinical symptoms after infection can be used as the classification standard: Pigeon adenovirus type 1 (PiAdV-1) mainly infects young pigeons and manifests clinical symptoms such as vomiting, diarrhea, and persistent weight loss; Pigeon adenovirus type 2 (PiAdV-2) can infect pigeons of different ages and is characterized by acute death and liver damage.

[0003] According to epidemiological surveys, classic adenovirus PiAdV-1 and PiAdV-2 infections have clear seasonality, with the peak period of infection from March to July each year. During the training of racing pigeons, various factors cause stress in the pigeons and immunosuppression, which leads to secondary infection of the disease. PiAdV is a contact-transmitted pathogen with a high incidence and wide spread. It can be transmitted vertically through pigeon breeding, and can also be transmitted horizontally in pigeons in the form of feces and mouth. The incubation period after PiAdV infection is 3 to 5 days, and the whole flock can be infected within 1 to 2 days after infection, and the transmission speed is extremely fast. After PiAdV infection, the clinical symptoms of pigeons are depression, unstable standing, messy feathers, watery or green stools, loss of appetite, and rapid weight loss in a short period of time to death from dehydration; the specific symptoms are crop food accumulation, palpation can touch a large amount of solid contents accumulated in the crop, frequent vomiting, granular vomitus with a sour smell, and sticky yellow-green or white liquid flowing out of the mouth. The clinical symptoms of PiAdV-1 and PiAdV-2 are slightly different. The clinical symptoms of PiAdV-1 infection are obvious, while those of PiAdV-2 infection are not obvious. Pigeons infected with PiAdV-2 will die quickly without showing any clinical symptoms or onset of disease. When pigeons are infected with PiAdV, the liver is the main target organ. At the same time, the virus also invades immune organs such as the spleen and thymus, causing severe damage to the immune system, thereby causing immunosuppression and secondary mixed infections, resulting in a large number of deaths.

[0004] The widespread spread of adenovirus has caused great trouble to pigeon breeding, and there is currently no vaccine to control pigeon adenovirus. Therefore, it is of great practical significance to isolate, identify and screen pigeon adenovirus to prepare corresponding antibodies and vaccines, and to provide prevention and treatment plans and clinical guidance methods for pigeon adenovirus type 1 disease. Summary of the invention

[0005] To meet the needs of the above-mentioned field, the present invention provides a pigeon adenovirus type 1 strain YJ-NM and applications thereof.

[0006] One of the purposes of the present invention is to provide a pigeon adenovirus type 1 strain YJ-NM (also known as pigeon adenovirus YJ-NM). The pigeon adenovirus type 1 strain YJ-NM is deposited in the China Center for Type Culture Collection, the deposit address is Wuhan University, Wuhan, China, the deposit date is August 29, 2024, and the deposit number is CCTCC NO: V202476.

[0007] The second object of the present invention is to provide the use of the above-mentioned pigeon adenovirus type 1 strain YJ-NM in the preparation of pigeon adenovirus vaccines.

[0008] The third object of the present invention is to provide the use of the above-mentioned pigeon adenovirus type 1 strain YJ-NM in the preparation of drugs for virus treatment.

[0009] Preferably, the drug for viral therapy is egg yolk antibody or antiserum.

[0010] A fourth object of the present invention is to provide the use of the above-mentioned pigeon adenovirus type 1 strain YJ-NM in the preparation of pigeon adenovirus diagnostic reagents.

[0011] A fifth object of the present invention is to provide a pigeon adenovirus vaccine, the active ingredient of which includes the inactivated pigeon adenovirus type 1 strain YJ-NM.

[0012] The sixth object of the present invention is to provide a method for preparing the above-mentioned pigeon adenovirus vaccine, comprising the following steps:

[0013] (1) Inoculating the pigeon adenovirus type 1 strain YJ-NM into duck embryo fibroblasts and culturing them, and harvesting the cell supernatant when the cell lesion rate after inoculation is higher than 80%, thereby obtaining the virus solution;

[0014] (2) inactivating the virus liquid in step (1) to prepare an aqueous phase, and then mixing and emulsifying the aqueous phase and the oil phase to prepare a pigeon adenovirus vaccine.

[0015] Preferably, the aqueous phase also contains sterilized Tween-80; the volume ratio of the sterilized Tween-80 to the inactivated pigeon adenovirus type 1 strain YJ-NM virus liquid is 3-5:95-97.

[0016] More preferably, the volume ratio of sterilized Tween-80 to the inactivated pigeon adenovirus type 1 strain YJ-NM virus liquid is 4:96.

[0017] Preferably, the volume ratio of the water phase to the oil phase is 0.5-1.5:1.5-2.5.

[0018] More preferably, the volume ratio of the water phase to the oil phase is 1:2.

[0019] The present invention has the following beneficial effects:

[0020] The pigeon adenovirus type 1 strain provided by the present invention is named as the YJ-NM strain. The strain was identified as pigeon adenovirus type 1 by homology comparison and genetic evolution tree analysis. The regression experiment of young pigeons showed that the challenge group excreted toxins at 3d, 5d, and 7d, and the excretion amount on the 5th day was high. The pigeon adenovirus type 1 strain YJ-NM has strong toxicity. The efficacy test results of the pigeon adenovirus type 1 strain YJ-NM showed that the neutralizing antibody titer of the immunized group pigeons was 1:256 to 1:512 28d after the first immunization; the neutralizing antibody titer of the control group was 1:2 to 1:4. The pigeon adenovirus type 1 strain YJ-NM inactivated vaccine prepared by the present invention can stimulate the body to produce high levels of antibodies. Therefore, the pigeon adenovirus type 1 strain YJ-NM of the present invention can be used as a production and test strain for pigeon adenovirus vaccines, and has good application prospects in the prevention of avian adenovirus infections. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the result of PCR test of diseased pigeons suspected of being infected with adenovirus; lane M is Marker1200; lane 1 is adenovirus sample nucleic acid; lane 2 is adenovirus positive control nucleic acid; lane 3 is adenovirus negative control nucleic acid;

[0022] Figure 2 This is a homology comparison diagram of isolated pigeon adenovirus strains;

[0023] Figure 3 This is a phylogenetic tree analysis diagram of isolated pigeon adenovirus strains;

[0024] Figure 4 The figure shows the pathological changes of virus-inoculated cells; A is the healthy control cell; B is the pathological cell 72 hours after virus inoculation;

[0025] Figure 5 The figure shows the PCR test results of pigeon detoxification at different times after virus infection; among them, lane M is Marker 1200; lane 1 is the nucleic acid of the healthy blank control mixed sample; lane 2 is the nucleic acid of the anal swab 7 days after virus infection; lane 3 is the nucleic acid of the anal swab 5 days after virus infection; lane 4 is the nucleic acid of the anal swab 3 days after virus infection; lane 5 is the adenovirus negative control nucleic acid; lane 6 is the adenovirus positive control nucleic acid. DETAILED DESCRIPTION

[0026] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention. Unless otherwise specified in the following embodiments, the technical means used are conventional means well known to those skilled in the art.

[0027] Example 1 Collection and processing of pigeon adenovirus type 1 strain YJ-NM

[0028] 1. Sample collection and processing

[0029] The biological materials were diseased pigeons suspected of being infected with adenovirus in Inner Mongolia Autonomous Region; duck embryo fibroblasts were prepared and preserved by Chongqing Yongjian Biotechnology Co., Ltd.;

[0030] The liver, kidney, spleen and other pathological tissues suspected of being infected with adenovirus were collected from pigeons, and after repeated freezing and thawing, 1% penicillin-streptomycin was added and mixed. After filtration and sterilization with a bacterial filter (0.22 μm), the mixture was divided into 1.5 mL sterile tubes and stored at -80°C for later use.

[0031] 2 Virus identification

[0032] The nucleic acid was extracted using a DNA / RNA extraction kit, and the product was amplified using a pair of specific primers for the adenovirus (FAdv) gene (Table 1) using PCR. The PCR reaction procedure was 1 μL of DNA template, 1 μL of upstream and downstream primers, 12.5 μL of TaKaRa Ex Taq, and ddH 2 O and then add 25 μL. PCR reaction program: pre-denaturation 94℃5min; denaturation 94℃30s, annealing 55℃30s, extension 72℃1min, 30 cycles; 72℃5min. After the reaction is completed, take 5 μL of the PCR product and run it on 1% agarose gel for gel electrophoresis imaging. The results are as follows Figure 1 As shown. Figure 1 It can be seen that the size of the amplified 599bp fragment is consistent with the amplification expectation, and it is preliminarily identified as pigeon adenovirus.

[0033] Table 1 Primers for identifying FAdv gene

[0034]

[0035] 3. Virus sample genome sequencing

[0036] The virus fluid was sent to Qingke Biotech for gene sequencing. The BLAST sequencing results were analyzed according to the NCBI database.

[0037] 4 Virus sequencing nucleotide sequence analysis

[0038] According to the gene sequencing sequence, the virus sequence downloaded from Genebank was compared with the DNA STAR software MegAlign software and MEGA X to compare the nucleotide sequence of the gene for homology and evolutionary tree; the Genebank record of the pigeon adenovirus strain is shown in Table 2. The results showed that the strain had a 99.9-100% homology with the pigeon adenovirus type 1 strain in the Genebank nucleotide sequence (see Figures 2-3 ). The isolated strain was named pigeon adenovirus type 1 strain YJ-NM, and the gene sequence of pigeon adenovirus type 1 strain YJ-NM is shown in SEQ ID NO.3.

[0039] Table 2 Accession numbers of strains used

[0040]

[0041] 5 Isolation and cultivation of virus strains

[0042] 5.1 Isolation of virus strains

[0043] The positive samples (pigeon adenovirus type 1 strain YJ-NM) were sterilized and inoculated into duck embryo fibroblasts at 5% and incubated at 37°C with 5% CO 2 After the virus was adsorbed in the incubator for 1 hour, the maintenance solution was added for culture and the culture conditions were observed at different time periods. The results were as follows: Figure 4 As shown. Figure 4 It can be seen that 72 hours after infection, the cells showed pathological changes such as aggregation and shrinkage. 120 hours after infection, when the cells had 80% pathological changes, the cell fluid was collected, frozen and thawed three times, and stored at -80℃ for aliquots.

[0044] 5.2 Determination of viral content

[0045] After duck embryo fibroblasts were evenly suspended, 100 μL (cell volume was 2-3×10 5 Cells were plated in 96-well plates and incubated at 37°C with 5% CO 2 Incubate incubator for 24 hours. Use cell culture medium DMEM to make virus gradient of 10 -6 , 10 -7 , 10 -8 and 10 -9 After 10-fold dilution, add 6 wells of cells cultured in a 96-well plate, and set up 6 wells of negative control; add 100 μL of DMEM medium containing 2% newborn calf serum as maintenance medium. Incubate at 37°C with 5% CO 2After 5-7 days of observation in the incubator, the virus-induced TCID was determined according to the Reed-Muench method. 50 , by TCID 50 Test to determine virus content, TCID 50 / mL is 10 -6 .

[0046] 6. Virus Purification

[0047] 6.1 Plaque purification

[0048] Duck embryo fibroblasts were added to a 6-well cell plate and cultured until the monolayer cells were 90-95% confluent; the virus was diluted 10-fold with DMEM culture medium. -6 Up to 10 -9 Four gradients were inoculated in 200 μL in 6-well plates, with 3 parallel controls in each well, and incubated at 37°C with 5% CO 2 Incubate the incubator for 2 hours to adsorb the virus, then aspirate the virus solution. Heat the commercial agarose to about 45°C and add it to the cell surface for 3-4 days. Add 1 mL of 1% crystal violet to each well and mix well for 5-12 hours. Pour out the agar and wash with ddH 2 O Rinse off the staining solution.

[0049] Plaques were selected, diluted with DMEM medium, and then inoculated on cells for propagation. Diseased cells were frozen and thawed, and the infection and plaque purification were determined using the same method.

[0050] 6.2 Determination of toxicity of virus clones

[0051] Plaque purification of pigeon adenovirus type 1 was performed to clone the strain. The cloned strain was inoculated into duck embryo fibroblasts and observed to have a cell lesion of about 90%. The virus solution was collected and the half-cell infection dose (TCID) of the virus was determined by the Reed-Muench method. 50 .

[0052] Plaque purification was used to purify the virus and clone the strain to determine the virus's half-cell infectious dose, TCID 50 / mL is 10 -6.5 The results showed that the virus can replicate and clone to proliferate virulence.

[0053] 7 Animal regression test

[0054] Fifteen healthy young pigeons were used, of which 9 were injected intramuscularly with 1 mL / pigeon into the leg, and 6 were used as healthy blank controls. The incidence and clinical conditions of the animals were observed continuously for 3 to 7 days. Swabs collected from the upper respiratory tract mucosa and digestive tract mucosa and anal swabs were used to measure the virus content in pigeons at 3, 5, and 7 days after the infection. The results are as follows: Figure 5shown.

[0055] Pigeons without challenge of pigeon adenovirus type 1 strain YJ-NM showed no obvious abnormal symptoms, while pigeons in the challenge group showed obvious symptoms such as lethargy and diarrhea on day 3. Anal swabs were used to measure the virus content in pigeons in the challenge group and the non-challenge group on days 3, 5, and 7. PCR results were tested. Figure 5 It can be seen that the non-challenged group did not excrete toxins; the attacked group excreted toxins on days 3, 5, and 7, with the highest excretion on day 5.

[0056] Example 2 Preparation and Application of Pigeon Adenovirus Vaccine

[0057] 1. Virus proliferation

[0058] The virus solution was inoculated at a ratio of 2% on confluent duck embryo fibroblasts and cultured at 37°C with 5% CO 2 The virus was adsorbed in the incubator for 2 hours, and 2% newborn calf serum DMEM culture medium was added as the maintenance medium; when the cell pathological rate reached 80% after infection, the virus cell fluid was collected and stored.

[0059] 2Semi-finished product inspection

[0060] 2.1 Sterility test

[0061] The inspection should be carried out according to the inspection technical guidance in the "Chinese Veterinary Pharmacopoeia" and the results should be judged as sterile growth.

[0062] 2.2 Determination of viral content

[0063] After duck embryo fibroblasts are evenly suspended, 100 μL (cell volume is 2-3×10 5 Cells were plated in 96-well plates at 37°C with 5% CO 2 Incubator for 24 hours; use cell culture medium DMEM to make virus gradient of 10 -6 , 10 -7 , 10 -8 and 10 -9 After 10-fold dilution, add 6 wells of cells cultured in a 96-well plate, and set up 6 wells of negative control; add 100 μL of DMEM medium containing 2% newborn fetal bovine serum as maintenance medium; incubate at 37°C with 5% CO 2 After 5-7 days of observation in the incubator, the virus-induced TCID was determined according to the Reed-Muench method. 50 .

[0064] Adjust the virus content of the virus solution for seedling preparation to 10 -6 TCID 50 / mL, and pass the sterility test for later use.

[0065] 3. Virus inactivation and testing

[0066] 3.1 Virus inactivation

[0067] The qualified virus solution was inactivated with 0.1% formaldehyde at 37°C for 48h and stored at 2-8°C.

[0068] 3.2 Virus inactivation test

[0069] Inoculate 2 mL of inactivated virus solution onto the confluent monolayer of cells and incubate at 37°C with 5% CO. 2 The cells were cultured in an incubator and observed for 3 days; the cells were blindly propagated for 3 generations and the cytopathic effects were observed.

[0070] The results showed that there was no cytopathic effect in the three blind generations of cells inoculated with the virus solution used for vaccine production, and the inactivation test was qualified.

[0071] 4 Vaccine preparation

[0072] 4.1 Oil phase preparation

[0073] After white oil and Span-80 are fully mixed in a ratio of 94:6, 2% aluminum stearate is added and stirred until a light yellow, clear and transparent state is obtained, and the mixture is sterilized by high-pressure steam at 116°C for later use.

[0074] 4.2 Preparation of aqueous phase

[0075] The completely inactivated antigen solution and sterilized Tween-80 were shaken and mixed at a volume ratio of 96:4 until the Tween-80 was completely dissolved.

[0076] 4.3 Emulsification

[0077] According to the volume ratio of 2:1, first take 2 parts of the oil phase and stir evenly. At the same time, add 1 part of the water phase and stir until the oil phase and the water phase are fully mixed.

[0078] 5. Finished product inspection

[0079] 5.1 Dosage form inspection

[0080] Drop the vaccine on the surface of clean cold water, observe the diffusion of the vaccine after dripping, and determine the dosage form. Drop the vaccine on the surface of clean cold water, the results show that the vaccine does not spread, and the dosage form is determined to be oil-in-water.

[0081] 5.2 Centrifugal stability test

[0082] 10 mL of inactivated seedlings were placed in a centrifuge tube and centrifuged at 3000 r / min for 15 min to observe whether there was stratification or demulsification. The results showed that the inactivated seedlings did not demulsify after centrifugation and had good centrifugal stability.

[0083] 5.3 Sterility test

[0084] The vaccine was inoculated in 10 tubes of sulfur glycolate fluid medium (TG) and casein agar medium slant (GA), each with 0.5 mL. Five tubes of each medium were cultured at 37°C, and the other five were cultured at 25°C. Another 0.5 mL was inoculated in a small tube of tryptic soy casein liquid medium (TSB), placed at 25°C, cultured for 7 days, and observed for bacterial growth. The results showed that no bacteria grew after the vaccine was inoculated in the culture medium, and the sterility test was qualified.

[0085] 5.4 Safety Inspection

[0086] Ten healthy young pigeons were injected with inactivated vaccine through the leg muscles, with an inoculation volume of 1.0 mL per pigeon. The mental state of the animals in each group was observed every day after vaccination, as well as whether local inflammatory reactions such as redness, swelling, heat and pain occurred at the injection site. The cumulative observation was 14 days. The results showed that all 10 experimental pigeons were alive and well after being injected with 1.0 mL of vaccine, with no local or systemic adverse reactions, and the vaccine was safe.

[0087] 5.5 Effectiveness test

[0088] 5.5.1 Serological methods

[0089] Ten healthy young pigeons were taken, of which five were set as the immunization group. The immunization group was vaccinated with 0.5 mL / pigeon in the leg muscle, and the other five were not injected with any substance as the control group. Blood was collected from all test pigeons 28 days after immunization in the immunization group, and the serum was separated. After treatment, the adenovirus neutralizing antibody titer was determined. The results are shown in Table 3. The neutralizing antibody titer of the young healthy pigeons in the immunization group was 1:256 to 1:512 28 days after immunization, and the neutralizing antibody titer of the serum was separated, which was not higher than 1:4. The young pigeon immunization experiment in the present invention shows that the prepared pigeon adenovirus type 1 strain YJ-NM inactivated vaccine can stimulate the body to produce high levels of antibodies.

[0090] Table 3 Serological test results

[0091]

[0092]

[0093] 5.5.2 Immunotherapy

[0094] Fifteen healthy young pigeons were selected, of which 10 were set as the immunization group. The immunization group was inoculated with 0.5 mL of the vaccine in the leg muscle, and the other 5 were not injected with any substance as the control group. 28 days after immunization, all test pigeons were inoculated with 1.0 mL of pigeon adenovirus fluid (the virus content per mL was ≥10 6 TCID 50). The clinical symptoms of the test pigeons were observed every day after the virus attack. The results are shown in Table 4. None of the 10 pigeons in the immunization group became ill, and only 5 pigeons in the control group had obvious typical clinical symptoms of poor spirits and loss of appetite, indicating that the inactivated vaccine can provide good protection against the attack of pigeon adenovirus.

[0095] Table 4 Effect test results

[0096] Group Quantity / pcs Immune pathway Immunization dose / mL Attack route Challenge dose / mL mortality rate Immunization group 10 Leg muscles 0.5 Leg muscles 1.0 0 / 10 Control group 5 - - Leg muscles 1.0 1 / 5

[0097] SEQ ID NO.3:

[0098] atggccgcgc tcacgcccga cttgaccacc gccactccgc ggctgcagta ctttcacatc 60

[0099] gccggcccgg gcacccgcga atacctctcg gaggacctcc agcagttcat cgccgccacc120ggcagctact tcgagttgcg caacaagttc cgacagaccg tggtcgcgcc cacccgcaac180gtcaccacag acaaggcgca gcggctgcag atccgcttct accccacgca aacggatgac240accaccaacg cgtatcgcgt gcgcttcagc atcaatgtgg gcgacagctg ggtgctggac300atgggcgcca cctacttcga catcaagggc gtcctggacc gcggtccctc cttcaaaccc360tacggcggca cggcctacaa ccccctggcg ccccgcgagt ccactttccc caactggcgg420gaggtgactc cctctacggg aggagccgcc aacaattaca tcacggcaca gctgagcaac480gtctacgcga acaagaccgg tcaagaaccg gcgaaaacgg gggcacagct gcaggccttt540agcgccacgg tgcccaatcc caatgcggga ccgaccctta ccaacaccgg tgtcaacaac600gccgccaaca agaacgagat cggcttcacc gggaagatcg ctaaggtgac aggcaccggc660ctgacctacg gcgcctacgt gccaccggtg aacaaccaag gcggacaagc ggtgacgcag720acgggatact tcttgatgga ctcgacaggc gcaaattacg agggcgcggt gtctgtggag780gactacagca ccacgatcgt ctaccccgac tccatctacc tgcctccttc taacgacgag840aacaccctct tcaacgccgg cgtcaacaag ggcatgcgac ccaactacat cggcttccgg900gacaacttca tcaatctcct ctaccacgac tccggcgtttgttccggcac gctcaactcg960gagcggtcgg gcatgaacgt ggtggtagag ttgcaggaca gaaacacgga actgagttac1020cagtacatgt tggccgacat gatgagccgg caccactact tcgccctctg gaatcaggcg1080gtagactcct acgaccccga cgtcagggtt ttctccaacg acggttacga ggagggcgta1140cccacctacg ccttctcgcc cgacggcggc gtcagtcagt atccctccat gcccagcttg1200tccgccctga cgctctacag cgccaacaca gcagctacac ctccccagaa acagacccag1260gtcaacaacg ccaccttgtc tctcggcgcg ggcagcacgg ccgccaccga aatcaacctg1320ggagcggcca tgcggcgcaa cttcatcatg accaacatcg ccgagtacct gcccgacaag1380tacaagttca acatcgcggg cttcgatccc tccacgaacc ccgtccccgc cacctcctac1440gtctacatga accagcggat tccgctggtc aacgtggtgg acctcttcac caacatcgga1500ggacggtggt cggtggacca gatggacaac gtcaacccct tcaaccatca ccgcaactgg1560gggctcaagt accgctccca gctgctgggc aacagtcgct actgccagtt ccacatccag1620gtgccccaaa agttcttcgc cataaaaaac ctgctgctcc tctcgggcac ctacacttac1680gagtgggtgc tgcgcaaaga ccccaacatg atcctccaat cctcgctggg caacgacttg1740cggctggacg gcgcctcggt ggccttcacc gaggtgaacc tgatgtgcaa ctttatgccc1800atggatcacaacaccagcaa ccagctggag ctgatgatgc gcaacgccac caacgaccag1860acgttcgccg actatctggg cgccaagaac gccctgtacg ccgtgcccgc caacgccacc1920gccctcacca tcaacatccc ggcccgcacc tgggagggca tgcgaggctg gtcctttacg1980cgtctcaagg cctccgaaac gccccagcaa ggcgcccaat acgacaccaa cttccagtac2040tcgggctcca tcccctacct ggacggcacc ttctacctga accacacttt ccgcaacatg2100agcgtcctct tcgacaccag catcaactgg ccgggcaacg accggttgct gacgcccaac2160gtgttcgaaa tcaagcggag tccagacgtg gaccccgagg gctacgccat gagccagagc2220accatcacca aggactggta cctgatccag atggccacca actacaacta cgtctacaac2280ggctaccggt tctggcccga ccggcactat ttccattacg actttttgcg caacctggac2340gtgatgaaca tccagggtcc caatttcgcc accaccggca ccaaccagct gtacaatctg2400gtcagtctga cgcccgacac agccgacacc gaggccgacc aaacgagcca agactcggtg2460cggaacaact cgggcttcgt ggcgccccgg gcgcagcccg cctggaacgc ccgccagggt2520cagccctggc cggccaactg gccctacccg ctgatcgggc agaacagcat cgcgcccacc2580tccatcctca tgtaccgcaa attcctctgc gacaactacc tctggacggt gcctttcagc 2640

[0100] tccgacttta tgtacatggg ggagctcacc gacctgggcc agaaccccat gtacaccaac2700aactcccaca gcatggtgat caacttcgag ctcgatccca tggacgaaaa cacctacgtg2760tacatgctct acggggtctt cgacaccgtg cgcgtcaacc agcccgagcg gaacgtcctc2820tccatggcct acttccgcac acccttcgcc acgggtaacg ccgtctaa 2868

[0101] The present invention has been described according to the above embodiments. It should be understood that the above embodiments do not limit the present invention in any form. Any technical solutions obtained by equivalent replacement or equivalent transformation shall fall within the scope of the present invention.

Claims

1. A pigeon adenovirus type 1 strain YJ-NM, characterized in that: The pigeon adenovirus type 1 strain YJ-NM is deposited in the China Center for Type Culture Collection, the deposit address is Wuhan University, Wuhan, China, the deposit date is August 29, 2024, and the deposit number is CCTCC NO: V202476.

2. Use of the pigeon adenovirus type 1 strain YJ-NM according to claim 1 in preparing pigeon adenovirus vaccines.

3. Use of the pigeon adenovirus type 1 strain YJ-NM according to claim 1 in the preparation of drugs for virus therapy.

4. The use according to claim 3, characterized in that The drug for virus treatment is egg yolk antibody or antiserum.

5. Use of the pigeon adenovirus type 1 strain YJ-NM according to claim 1 in the preparation of pigeon adenovirus diagnostic reagents.

6. A pigeon adenovirus vaccine, characterized in that: The active ingredient of the pigeon adenovirus vaccine comprises the inactivated pigeon adenovirus type 1 strain YJ-NM according to claim 1.

7. The method for preparing the pigeon adenovirus vaccine according to claim 6, characterized in that: The following steps are involved: (1) Inoculating the pigeon adenovirus type 1 strain YJ-NM into duck embryo fibroblasts and culturing them, and harvesting the cell supernatant when the cell lesion rate after inoculation is higher than 80%, thereby obtaining the virus solution; (2) inactivating the virus liquid described in step (1) to prepare an aqueous phase, and then mixing the aqueous phase with the oil phase for emulsification to prepare a pigeon adenovirus vaccine.

8. The method for preparing a pigeon adenovirus vaccine according to claim 7, characterized in that: The aqueous phase also contains sterilized Tween-80; the volume ratio of the sterilized Tween-80 to the inactivated pigeon adenovirus type 1 strain YJ-NM virus liquid is 3-5:95-97.

9. The method for preparing a pigeon adenovirus vaccine according to claim 7, characterized in that: The volume ratio of the water phase to the oil phase is 0.5-1.5:1.5-2.5.

Images