Double-transgene three-target adeno-associated virus vector and application thereof

Abstract

The invention relates to a variant glial cell-derived neurotrophic factor (GDNF), a recombinant adeno-associated virus vector carrying a coding gene of the variant glial cell-derived neurotrophic factor (GDNF), and application of the variant glial cell-derived neurotrophic factor (GDNF) in treatment of neurodegenerative diseases. The variant glial cell-derived neurotrophic factor (GDNF) can up-regulate the expression quantity of a Nurr1 transcription factor in a target cell tissue, and the recombinant adeno-associated virus vector carries double transgenes and can play a role in three targets, so that the progress of neurodegenerative diseases is inhibited, the damage of nerve cells is reversed, and the disease recovery is promoted.

Description

Technical Field

[0001] The present invention relates to the fields of medical biotechnology and gene therapy, and in particular to a triple-target double-transgenic therapeutic vector based on, for example, a recombinant AAV virus vector and uses thereof. Background Art

[0002] With the increasing aging of human society, the number of patients with neurodegenerative diseases has increased year by year. Such diseases are disease states in which neurons in the brain and spinal cord are lost, including 11 major categories such as Parkinson's disease, Tau protein disease, and motor neuron disease. Neurodegenerative diseases are chronic and common diseases that seriously threaten human health and quality of life. Among them, Parkinson's disease (PD) is one of the most common neurodegenerative diseases, and its clinical symptoms are the loss of dopaminergic neurons in the substantia nigra and the appearance of movement disorders. Because the pathogenesis of PD is not yet fully understood, it remains a focus of attention for many researchers.

[0003] Studies of human genetics and animal models have shown that lysosomal disorders play an important role in the pathogenesis of PD. Analysis of related genes showed that GBA1 has the greatest association with PD. The GBA1 gene encodes β-glucocerebrosidase GCase, a lysosomal enzyme involved in sphingolipid metabolism that can hydrolyze glucosylceramide and glucosylsphingosine. Lack of this enzyme causes accumulation of its substrates glucosylceramide and glucosylsphingosine, which are toxic to nerve cells and lead to inflammation, such as Gaucher disease. Moreover, statistics show that GBA1 gene defects are an important risk factor for the development of PD.

[0004] The accumulation of Lewy bodies in synapses in the substantia nigra and striatum is a typical hallmark of PD. Lewy bodies are composed of nearly 40 proteins, the core of which is α-synuclein (α-syn). In neurons containing α-synuclein inclusions, Nurr1 expression is reduced. Nurr1 is required for the acquisition and maintenance of the dopaminergic phenotype of nigrostriatal neurons. Studies have shown that it protects dopaminergic neurons in the substantia nigra from neuroinflammation-induced death by inhibiting the expression of neurotoxic proinflammatory genes, and Nurr1 expression is significantly reduced in the brains of elderly and sporadic PD patients.

[0005] Glial cell line-derived neurotrophic factor (GDNF) is a small protein that effectively promotes the survival and regeneration of a variety of neurons.

[0006] This field still needs in-depth research on the mechanism of PD in order to obtain effective treatment methods. SUMMARY OF THE INVENTION

[0008] The inventors unexpectedly discovered a GDNF variant that promotes the expression of Nurr1 and ultimately reverses the inhibitory effect of α-syn on the expression of Nurr1. On this basis, the present invention further provides a gene therapy vector for treating Gaucher disease or PD.

[0009] In a first aspect, the present invention provides a variant GDNF protein comprising a T154S amino acid mutation. Preferably, the variant GDNF protein has an amino acid sequence as shown in SEQ ID NO:1.

[0010] In a second aspect, the present invention accordingly provides a gene of the variant GDNF protein. In a preferred embodiment, the gene comprises:

[0011] (1) the sequence shown in SEQ ID NO: 2;

[0012] (2) a nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO: 1; or

[0013] (3) A nucleic acid sequence that encodes the same variant GDNF protein as the nucleic acid sequence of (1) or (2), but is different from (1) or (2) due to the degeneracy of the genetic code.

[0014] In the third aspect, the present invention provides a variant GDNF gene expression cassette, which comprises the variant GDNF gene of the previous aspect. Specifically, the gene expression cassette comprises a gene sequence encoding the variant GDNF and one or more regulatory sequences, wherein the variant GDNF is GDNF T154S.

[0015] In a specific embodiment, the variant GDNF gene comprises: (1) a sequence as shown in SEQ ID NO:2; (2) a nucleic acid sequence encoding an amino acid sequence as shown in SEQ ID NO:1; or (3) a nucleic acid sequence that encodes the same variant GDNF protein as the nucleic acid sequence of (1) or (2), but is different from the nucleic acid sequence of (1) or (2) due to the degeneracy of the genetic code.

[0016] In a specific embodiment, the one or more regulatory sequences are located at the 5' end and / or the 3' end of the variant GDNF gene.

[0017] In some more specific embodiments, the gene expression cassette further comprises a polynucleotide sequence encoding human GCase (i.e., GBA1 gene). Therefore, in some embodiments of the present invention, a double transgenic expression cassette of variant GDNF×GBA1 is provided. Specifically, it comprises a gene sequence encoding a variant GDNF protein of the present invention, and a GBA1 gene sequence.

[0018] In some preferred embodiments, the gene expression cassette comprises a first promoter, for example, which is located at the 5' side of the GDNF gene sequence and the GBA1 gene sequence. In some preferred embodiments, the first promoter is selected from hSyn promoter, CAG promoter, MBP promoter, CMV promoter, CBA promoter and other tissue-specific or pan-promoters; in some more preferred embodiments, the first promoter is CBA promoter.

[0019] In some preferred embodiments, the variant GDNF gene sequence is located at the 5' end of the GBA1 gene sequence.

[0020] In some preferred embodiments, the variant GDNF gene sequence is located at the 3' end of the GBA1 gene sequence.

[0021] In some preferred embodiments, the variant GDNF gene sequence and the GBA1 gene sequence are connected by a connecting sequence. In some more preferred embodiments, the connecting sequence allows the variant GDNF and GCase to be expressed as independent proteins. In some more preferred embodiments, the connecting sequence is a second promoter (same or different from the first promoter), IRES or a self-cleaving peptide (e.g., a 2A peptide, such as P2A, T2A, E2A or F2A). In some embodiments, the second promoter is selected from tissue-specific or pan-promoters such as hSyn promoter, CAG promoter, MBP promoter, CMV promoter, CBA promoter, etc. In some preferred embodiments, the connecting sequence is P2A, T2A, E2A, F2A or IRES. In a most preferred embodiment, the connecting sequence is T2A.

[0022] In some more preferred embodiments, there is no other regulatory sequence between the variant GDNF gene sequence and the GBA1 gene sequence except the linker sequence.

[0023] In some preferred embodiments, the gene expression cassette comprises a Kozak sequence.

[0024] In some preferred embodiments, the gene expression cassette comprises a polyA signal sequence, including but not limited to SV40 polyA, hGH polyA, bGH polyA or rbGlob polyA, preferably bGH polyA.

[0025] In yet another aspect, the present invention provides an expression vector comprising the gene expression cassette of the present invention.

[0026] In some embodiments, the vector is a plasmid vector.

[0027] In some embodiments, the vector is a viral vector. In some specific embodiments, the viral vector is a retroviral vector. In some more specific embodiments, the viral vector is an adeno-associated viral vector. In some more specific embodiments, the adeno-associated viral vector comprises a gene expression cassette of the present invention.

[0028] In some embodiments, the viral vector of the present invention is a recombinant adeno-associated virus vector rAAV. In some embodiments, the serotype of the rAAV includes but is not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAVrh.10, or any combination thereof, or any variant thereof, or any variant combination thereof. In some preferred embodiments, the rAAV is a recombinant AAV9, AAV2, AAV8, AAV5 vector. In some more preferred embodiments, the serotype of the rAAV is AAV9 or any combination comprising AAV9.

[0029] In some preferred embodiments, the viral vector of the present invention is a rAAV9 viral vector.

[0030] In some embodiments, the genome of the viral vector of the present invention can self-complement to form a double-stranded DNA molecule.

[0031] In some preferred embodiments, the gene expression cassette / vector of the present invention may further comprise a linker (e.g., the aforementioned linker sequence), a transition sequence, an enzyme cleavage site, a homologous recombination site (e.g., a homology arm sequence, a loxP site, etc.), or any combination thereof between the various elements. For example, due to the desired cloning operation, the gene expression cassette / vector may further comprise a 5' and / or 3' homology arm sequence.

[0032] In some preferred embodiments, the two ends of the gene expression cassette of the present invention are respectively connected to the adeno-associated virus reverse terminal repeat (ITR) sequence, for example, in the expression vector as described above, the two ends of the gene expression cassette are connected to the ITR sequence. In some embodiments, the ITR sequence has the same serotype as the rAAV vector. In some embodiments, the ITR sequence has a different serotype from the rAAV vector. In some embodiments, the ITR sequence is natural. In some embodiments, the ITR sequence is modified relative to the natural sequence. In some embodiments, the ITR sequence is artificially synthesized.

[0033] In a more specific embodiment, the present invention provides a gene expression cassette comprising the following elements arranged in sequence from 5' to 3':

[0034] (a) CBA promoter;

[0035] (b) an optional Kozak sequence;

[0036] (c) GBA1 gene;

[0037] (d) T2A coding sequence;

[0038] (e) variant GDNF gene sequences;

[0039] (f) polyA signal sequence.

[0040] In a more specific embodiment, the present invention provides a gene expression cassette comprising the following elements arranged in sequence from 5' to 3':

[0041] (a) a CBA promoter, the sequence of which is as shown in SEQ ID NO:5 or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:5;

[0042] (b) an optional Kozak sequence, the Kozak sequence being the sequence shown in SEQ ID NO:7, or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:7;

[0043] (c) a GBA1 gene, whose sequence is the sequence shown in SEQ ID NO:4, or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with SEQ ID NO:4 and encoding the same amino acid sequence;

[0044] (d) a T2A coding sequence, the sequence of which is as shown in SEQ ID NO:9 or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:9 and encoding the same amino acid sequence;

[0045] (e) a variant GDNF gene sequence, the sequence of which is:

[0046] (1) the sequence shown in SEQ ID NO: 2;

[0047] (2) a nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO: 1; or

[0048] (3) A variant GDNF protein encoding the same nucleic acid sequence as (1) or (2), but differs from (1) due to the degeneracy of the genetic code.

[0049] or (2) a nucleic acid sequence that is different from the nucleic acid sequence;

[0050] (f) a polyA signal sequence whose sequence is as shown in SEQ ID NO:6 or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:6;

[0051] In a specific embodiment, the present invention provides a gene expression cassette comprising a sequence as shown in any one of SEQ ID NOs: 13-18.

[0052] In a specific embodiment, the present invention provides a recombinant viral vector comprising the gene expression cassette of the present invention. Preferably, the recombinant viral vector comprises a sequence as shown in any one of SEQ ID NOs: 13-18.

[0053] In some embodiments, the present invention provides a recombinant virus particle, which comprises the aforementioned virus vector of the present invention and a capsid.

[0054] In another aspect, the present invention provides a host cell comprising a polynucleotide, a gene expression cassette and / or a vector of the present invention. In some preferred embodiments, the cell is selected from the group consisting of HeLa, SH-SY5Y, Sf9, HEK293, HEK293F, HEK293T, HT22 cells, or a combination thereof. In some more preferred embodiments, the cell is a HEK293 cell.

[0055] In some embodiments, the host cell of the present invention has the polynucleotide or gene expression cassette of the present invention integrated into its chromosome.

[0056] In another aspect, the present invention provides a gene medicine for treating a neurodegenerative disease, comprising a variant GDNF protein encoding nucleic acid of the present invention, a gene expression cassette of the present invention (e.g., a double transgenic expression cassette of the present invention), an expression vector of the present invention (e.g., a viral vector) and / or a viral particle of the present invention.

[0057] In another aspect, the use of a variant GDNF protein of the present invention or a nucleic acid encoding the same, a gene expression cassette of the present invention (e.g., a double transgenic expression cassette of the present invention), and / or an expression vector of the present invention in the preparation of a drug for treating a neurodegenerative disease is provided. In a preferred embodiment, the neurodegenerative disease exhibits a decrease in Nurr1 and / or an increase in α-syn. In a preferred embodiment, the neurodegenerative disease is Gaucher disease, Parkinson's disease, or Parkinson's syndrome, preferably Gaucher disease or GBA1-related Parkinson's disease. In a preferred embodiment, the drug is a gene therapy drug. In a preferred embodiment, the drug is a recombinant viral vector drug.

[0058] In another aspect, the present invention provides a pharmaceutical composition comprising a variant GDNF protein of the present invention or a nucleic acid encoding it, a gene expression cassette of the present invention (e.g., a double transgenic expression cassette of the present invention), an expression vector of the present invention and / or a gene drug of the present invention, and optionally comprising a pharmaceutically acceptable carrier and / or excipient.

[0059] In some embodiments, the administration of the preventive and / or therapeutic drugs of the present invention includes but is not limited to oral, single or multiple intravenous administration, medullary cisterna magna administration, intrathecal administration, intraventricular administration, intraparenchymal administration, intramuscular administration, or convection enhanced (CED) administration, preferably single or multiple intraventricular administration or intraparenchymal administration.

[0060] In some embodiments, the viral vector of the present invention is administered orally, single or multiple intravenous administration, medullary cisterna magna administration, intrathecal administration, intraventricular administration, intraparenchymal administration, intramuscular administration, or convection enhanced (CED) administration, preferably single or multiple intraventricular administration or intraparenchymal administration, more preferably single administration, which reduces the pain of repeated administration of drugs to patients. In some more preferred embodiments, the viral vector of the present invention is administered by dual modes of intraventricular injection and intraparenchymal injection, for example, a one-time administration.

[0061] In some embodiments, the viral vector of the present invention can stably and continuously express GCase and variant GDNF in cells after entering the body. In some embodiments, the viral vector of the present invention can stably and continuously express GCase and variant GDNF in cells after entering the body, and significantly increase the content of Nurr1 in cells. In some preferred embodiments, the viral vector of the present invention can stably and continuously express GCase and variant GDNF in cells after entering the body, and significantly increase the content of Nurr1 in cells, thereby enhancing the activity of GCase, GDNF and / or Nurr1 in cells. In some preferred embodiments, the viral vector of the present invention can stably and continuously express GCase and variant GDNF in cells after entering the body, and significantly increase the content of Nurr1 in cells, thereby enhancing the activity of GCase, GDNF and / or Nurr1 in cells, and alleviate or eliminate disease symptoms, preferably, the disease is a neurodegenerative disease, preferably Gaucher disease, Parkinson's disease or Parkinson's syndrome, more preferably Gaucher disease or GBA1-related Parkinson's disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Combined with the following Figure 1When reading together, the preferred embodiments of the present invention described in detail below will be better understood. For the purpose of illustrating the present invention, the drawings show the currently preferred embodiments. However, it should be understood that the present invention is not limited to the precise arrangement and means of the embodiments shown in the drawings.

[0064] Figure 1 It shows the effects of neurotrophic factors in cells in vitro, the effects of neurotrophic factors overexpressed by CBE and AAV on the morphology of SH-SY5Y cells. The left picture (marked NC) is the negative control group of normal SH-SY5Y cells, the middle picture (marked CBE) is the model group, and the right picture (marked GDNF) is the CBE-treated model group cells overexpressing GDNF.

[0065] Figure 2 The figure shows the design of the composition of the expression element of the recombinant vector of the present invention.

[0066] Figure 3 The graph shows the expression of GBA1, GDNF, Nurr1 and syn in SH-SY5Y cells infected with AAV-GBA1-GDNF containing wild-type or variant GDNF gene, respectively, and then compared by Western blot.

[0067] Figure 4 The results show that after AAV-GBA1-GDNF containing wild-type or variant GDNF gene was used to infect SH-SY5Y cells overexpressing syn in the examples of the present invention, the expressions of GBA1, GDNF, Nurr1 and syn in the cells were detected by Western blot for comparison.

[0068] Figure 5 The preparation, purification and identification of the triple-target dual-purpose gene AAV vector of the present invention are shown.

[0069] Figure 6 The comparison of GCase and GDNF expression in the brain of mice treated with the variant rAAV9-CBA-Kozak-hGBA1-T2A-hGDNF-polyA virus in vivo is shown. CKO = GBA1 knockout mice, FLOX = wild mice, AAV9-GBA1-GDNF = GBA1 knockout mice treated with the variant recombinant virus of the present invention.

[0070] Figure 7 The comparison of brain GCase activity in mice treated with variant rAAV9-CBA-Kozak-hGBA1-T2A-hGDNF-polyA virus in vivo is shown. CKO = GBA1 knockout mice, FLOX = wild-type mice, AAV9-GBA1-GDNF = GBA1 knockout mice treated with the variant recombinant virus of the present invention.

[0071] Figure 8 The comparison of brain syn accumulation after mice were treated with variant rAAV9-CBA-Kozak-hGBA1-T2A-hGDNF-polyA virus in vivo is shown. CKO = GBA1 knockout mice, FLOX = wild-type mice, AAV9-GBA1-GDNF = GBA1 knockout mice treated with the variant recombinant virus of the present invention.

[0072] Fig. 9 The comparison of Nurr1 expression in the brain of mice treated with the variant rAAV9-CBA-Kozak-hGBA1-T2A-hGDNF-polyA virus in vivo is shown. CKO = GBA1 knockout mice, FLOX = wild-type mice, AAV9-GBA1-GDNF = GBA1 knockout mice treated with the variant recombinant virus of the present invention.

[0073] Fig.10 The figure shows the morphological comparison of brain neurons in mice treated with the variant rAAV9-CBA-Kozak-hGBA1-T2A-hGDNF-polyA virus in vivo. CKO = GBA1 knockout mice, FLOX = wild mice, AAV9-GBA1-GDNF = GBA1 knockout mice treated with the variant recombinant virus of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0075] Unless defined otherwise hereinafter, all technical and scientific terms used in this specification have the same meaning as those of ordinary skill in the art to which the present invention belongs. All publications, patent applications, patents and other references mentioned herein are fully incorporated by reference. In addition, the materials, methods and examples described herein are only illustrative and are not intended to be restrictive. Other features, purposes and advantages of the present invention will be apparent from this specification and the accompanying drawings and from the appended claims.

[0076] I. Definitions

[0077] The term "about" when used in conjunction with a numerical value is meant to encompass the numerical value within a range having a lower limit that is 5% less than the specified numerical value and an upper limit that is 5% greater than the specified numerical value.

[0078] As used herein, the terms "comprising" or "including" are meant to include stated elements, integers or steps, but not to exclude any other elements, integers or steps.

[0079] The term "encoding" refers to the intrinsic property of a specific nucleotide sequence in a nucleic acid, which serves as a template for synthesizing other polymers and macromolecules having a defined nucleotide sequence (e.g., mRNA and shRNA) or a defined amino acid sequence and biological properties derived therefrom in a biological process. Thus, if the gene is transcribed to produce mRNA and translated in a cell or other biological system to produce a protein, the gene, cDNA or RNA can be referred to as encoding the RNA or protein. Both the coding strand (whose nucleotide sequence is identical to the mRNA sequence and is generally provided in a sequence listing) and the non-coding strand (which serves as a transcription template for a gene or cDNA) can be referred to as encoding the RNA or protein or other product of the gene or cDNA. In this article, when referring to the same expression product (protein, such as a target protein), "gene sequence" and "coding sequence" have substantially the same meaning and can be used interchangeably. In this article, "gene sequence encoding variant GDNF protein", "variant GDNF gene sequence", "variant GDNF encoding gene sequence", "variant GDNF coding sequence", "variant GDNF nucleic acid sequence", "nucleic acid sequence encoding variant GDNF protein" have substantially the same meaning and can be used interchangeably. “GBA1 gene”, “(h)GCase coding sequence”, “(h)GCase encoding nucleic acid”, “(h)GCase encoding gene”, “nucleic acid sequence encoding (h)GCase” have substantially the same meaning and can be used interchangeably.

[0080] The terms "protein" and "polypeptide" are used interchangeably herein to refer to a polymer sequence comprising amino acid residues. Unless otherwise specified, the single-letter and three-letter codes for amino acids defined in accordance with the IUPAC-IUB Joint Commission on Biochemical Nomenclature (JCBN) are used herein. The single letter X refers to any of the twenty amino acids. It should also be understood that due to the degeneracy of the genetic code, a polypeptide may be encoded by more than one different nucleotide sequence.

[0081] The term "expression" refers to the transcription and / or translation of a specific nucleotide sequence driven by a promoter.

[0082] The term "N-terminus" refers to the last amino acid at the N-terminus, and the term "C-terminus" refers to the last amino acid at the C-terminus.

[0083] The terms "operably linked" or "operably linked" have similar meanings, meaning that the specified components are connected or adjacent and in a relationship that allows them to function in the intended manner. For example, but not limited to, a promoter is operably linked to a coding sequence if the promoter affects the transcriptional expression of the coding sequence, or a signal peptide sequence operably linked to an amino acid sequence of interest enables the amino acid sequence of interest to be secreted or translocated across a membrane.

[0084] The term "exogenous" when used to describe a nucleic acid or protein refers to a nucleic acid or protein that is not naturally present in the chromosome or host cell in which it is present. An exogenous nucleic acid sequence also refers to a sequence derived from and inserted into the same host cell or subject but present in a non-natural state, for example, a different copy number, or under the control of different regulatory elements.

[0085] The term "vector" as used herein is a nucleic acid molecule used to transport genetic material into a cell, which can be replicated and / or expressed in the cell. Any vector known to those skilled in the art in accordance with the present disclosure can be used. Examples of vectors include, but are not limited to, plasmids, viral vectors (bacteriophages, animal viruses, and plant viruses), cosmids, and artificial chromosomes (e.g., YACs). Preferably, the vector is a DNA plasmid. Preferably, the vector is a recombinant viral vector. One of ordinary skill in the art can construct the vector of the present application by standard recombinant techniques in accordance with the present disclosure.

[0086] A non-naturally occurring nucleic acid molecule or vector may comprise one or more expression cassettes. An "expression cassette" is a nucleic acid molecule, such as a double-stranded DNA molecule. As part of a longer nucleic acid molecule or vector, the expression cassette is responsible for directing the cell factory to express and prepare the target RNA / protein. The expression cassette may comprise one or more of the following elements: one or more promoter sequences, one or more (transgenic) open reading frames, 3'-untranslated regions (UTRs), the 3'-UTRs optionally comprising polyadenylation signals, and the like. An open reading frame (ORF) is a reading frame comprising the coding sequence of the target protein (e.g., GCase or variant GDNF) from the start codon to the stop codon. The regulatory elements / regulatory sequences of the expression cassette may be operably linked to a polynucleotide sequence encoding the target protein. The present invention provides a gene expression cassette comprising a variant GDNF gene sequence, for example, a double transgenic expression cassette comprising a variant GDNF gene sequence and a GBA1 gene sequence.

[0087] As used herein, the term "PCR" refers to polymerase chain reaction. The term "real-time quantitative PCR" generally refers to a PCR technique known as real-time quantitative polymerase chain reaction, quantitative polymerase chain reaction, or kinetic polymerase chain reaction, and is often referred to in the art as "fluorescent quantitative PCR", "Real-time PCR", "quantitative PCR" or "qPCR", etc. This technology uses PCR to simultaneously amplify and quantitatively measure target nucleic acids, most of the time with the help of embedded fluorescent dyes or sequence-specific probes, wherein the sequence-specific probes contain fluorescent reporter molecules that can only be detected when hybridized with target nucleic acids. The terms "dual real-time fluorescent quantitative PCR", "dual qPCR" and the like herein refer to real-time fluorescent quantitative PCR reactions that simultaneously amplify and detect two targets in the same tube reaction system. Although its reaction principle, reaction reagents and operation process are the same as those of single-plex qPCR, due to the use of more primers and probe combinations at the same time, it is necessary to fully consider the annealing temperature matching and sequence complementarity of oligonucleotide molecules (primers, probes), as well as the matching and use of different fluorescent molecules when designing the experiment, so its reaction system and reaction conditions are subject to much higher constraints than single-plex PCR reactions. Real-time fluorescence quantitative PCR should be understood to include any amplification technology that can track the progress of the amplification reaction in real time, that is, a detection method that is equivalent to real-time fluorescence quantitative PCR in terms of effectiveness.

[0088] The term "primer" as used herein refers to an oligonucleotide DNA capable of acting as an initiator of a DNA replication reaction in a qPCR reaction, which can hybridize to a template nucleic acid molecule under stringent conditions.

[0089] As used herein, the term "gene synthesis" refers to a method of synthesizing nucleotide molecules in vitro according to the sequence information of the desired gene by a biochemical method, for example, by adding bases one by one. Those skilled in the art can usually easily obtain nucleic acid molecules of the desired sequence using the technical services of gene synthesis in a commercially available manner.

[0090] The calculation of sequence identity between sequences is performed as follows: To determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., spaces can be introduced in one or both of the first and second amino acid sequences or nucleic acid sequences for optimal comparison or non-homologous sequences can be discarded for comparison purposes). In a preferred embodiment, for comparison purposes, the length of the reference sequence compared is at least 30%, preferably at least 40%, more preferably at least 50%, 60%, and even more preferably at least 70%, 80%, 90%, 100% of the length of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide at the corresponding position in the second sequence, the molecules are identical at this position.

[0091] Mathematical algorithms can be used to compare sequences and calculate percent identity between two sequences. In a preferred embodiment, the Needlema and Wunsch ((1970) J. Mol. Biol. 48: 444-453) algorithm (available at http: / / www.gcg.com) that has been integrated into the GAP program of the GCG software package is used, using a Blossum62 matrix or a PAM250 matrix and a gap weight of 16, 14, 12, 10, 8, 6 or 4 and a length weight of 1, 2, 3, 4, 5 or 6 to determine the percent identity between two amino acid sequences. In another preferred embodiment, the GAP program in the GCG software package is used (available at http: / / www.gcg.com) to determine the percent identity between two nucleotide sequences using the NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70 or 80 and a length weight of 1, 2, 3, 4, 5 or 6. A particularly preferred parameter set (and the one that should be used unless otherwise stated) is the Blossum62 scoring matrix with a gap penalty of 12, a gap extension penalty of 4, and a frameshift gap penalty of 5.

[0092] The percent identity between two amino acid or nucleotide sequences can also be determined using the algorithm of E. Meyers and W. Miller, ((1989) CABIOS, 4: 11-17), which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weighted remainder table, a gap length penalty of 12, and a gap penalty of 4.

[0093] Additionally or alternatively, one can further use the nucleic acid sequences and protein sequences described herein as a "query sequence" to perform a search against public databases to, for example, identify other family member sequences or related sequences.

[0094] In one or more embodiments of the present invention, PCR amplification is performed using a mutation construction primer pair containing a point mutation in the nucleic acid sequence to introduce a designed nucleotide substitution into the coding region of the obtained GDNF gene sequence, thereby expressing a GDNF variant containing a point mutation in the amino acid sequence by translating the mutated codon, for example, GDNF containing T154S.

[0095] "Codon optimization" is a technology for improving the expression level of target protein. The original guiding idea is that codons are degenerate, but the abundance of tRNA corresponding to multiple synonymous codons in cells is different. Therefore, by replacing synonymous codons to better avoid rare codons and using preferred codons, the effect of improving translation efficiency and thus expression level can be achieved. In the optimization process, in addition to seeking to use tRNA with higher abundance, factors such as simplifying the secondary structure of mRNA, optimizing repetitive sequences, eliminating restriction sites, and adjusting GC content should also be considered as much as possible to comprehensively redesign the gene coding sequence. Although codon optimization technology is more likely to be used when expressing coding sequences from other species in host cells, this strategy is actually beneficial to most genetic engineering. In a preferred embodiment of the present invention, the GCase encoding gene (i.e., GBA1 gene) has a codon-optimized sequence.

[0096] There are a variety of assays to measure the expression and activity levels of GCase by conventional means.

[0097] The term "exogenous" when used to describe a nucleic acid or protein refers to a nucleic acid or protein that is not naturally present in the chromosome or host cell in which it is present. An exogenous nucleic acid sequence also refers to a sequence derived from and inserted into the same host cell or subject but present in a non-natural state, for example, a different copy number, or under the control of different regulatory elements.

[0098] As used herein, the term "adeno-associated virus (AAV)" is named after the adenovirus preparations found in it. AAV is a member of the Parvovirus family, including multiple serotypes, and its genome is single-stranded DNA.

[0099] AAV is a dependent virus that requires other viruses such as adenovirus, herpes simplex virus, human papillomavirus, or auxiliary factors to provide auxiliary functional proteins for replication.

[0100] AAV9 is the most commonly used recombinant AAV serotype for gene delivery to the nervous system. Its genome has "inverted terminal repeat" (ITR) sequences at both ends, presenting a palindromic-hairpin structure. There are two large open reading frames (ORFs) in the genome, encoding the Rep and Cap genes respectively.

[0101] ITR is a cis-acting element of the AAV vector genome, and plays an important role in the integration, rescue, replication and genome packaging of the AAV virus. The ITR sequence contains a Rep protein binding site (RBS) and a terminal resolution site (TRS), which can be recognized by the Rep protein and produce a nick at the TRS. The ITR sequence can also form a unique "T" letter-shaped secondary structure, which plays an important role in the life cycle of the AAV virus. Any ITR sequence that can play its function as known in the art is suitable for the present invention.

[0102] The rest of the AAV9 genome can be divided into two functional regions, the Rep gene region and the Cap gene region.

[0103] As used herein, the term "AAV vector" refers to an efficient exogenous gene transfer tool, i.e., an AAV vector, that is transformed from wild-type AAV virus as people understand the life cycle of the AAV virus and its related molecular biological mechanisms. The modified AAV vector genome only contains the ITR sequence of the AAV virus and the exogenous gene expression frame to be transported; and when producing the AAV virus, the Rep and Cap proteins required for virus packaging, and other necessary components, will be provided in trans by other exogenous plasmids, thereby reducing the harm that may be caused by the packaging of Rep and Cap genes into the AAV vector, giving the recombinant vector extremely high safety, suitable for medical use. Therefore, the recombinant AAV virus vector itself is not pathogenic, which makes it one of the most recognized safe viral vectors. In addition, the physical and chemical properties of the AAV vector are stable, and it has strong tolerance to acid, alkali and high temperature (Gruntman AM et al., Hum Gene Ther Methods. 2015; 26 (2): 71-76), which makes it easy to develop biological products with high stability.

[0104] The prior art has relatively mature packaging systems for AAV vectors (eg, two-plasmid system, three-plasmid system), which facilitates large-scale production of AAV vectors.

[0105] Since the rAAV vector carrying the transgene has a different density than the empty vector and other impurities, the AAV virus produced is usually purified using density gradient ultracentrifugation (DGC). The principle of the latter is: a certain medium is used to form a continuous or discontinuous density gradient in a centrifuge tube, and then the liquid to be purified is placed on the top of the medium, and each component is allowed to enter a different density gradient through gravity or the action of a preferred centrifugal field to achieve stratification and separation. The density of the particles is the only factor that affects the final position, and the separation of different components can be expected as long as the density difference is greater than 1%. Thanks to the high density characteristics of its solution, the cesium chloride solution can form a continuous density gradient with gradually increasing density from top to bottom in the centrifuge tube, and the density of the virus particles is located in the middle of its density gradient, so the cesium chloride density gradient centrifugation is suitable for the purification of rAAV vectors (e.g., the rAAV vector of the present invention). The method of implementing cesium chloride density gradient centrifugation is well known in the art, for example, see Ayuso E et al. High AAV vector purity results inserotype-and tissue-independent enhancement of transduction efficiency [J]. Gene therapy, 2010, 17(4): 503-510.

[0106] In a preferred embodiment of the present invention, cesium chloride density gradient centrifugation is used to purify the dual-target gene rAAV vector of the present invention.

[0107] The term "vector genome (vg)" refers to a nucleic acid sequence packaged in an rAAV capsid to form an rAAV vector. In one embodiment, the vector genome comprises at least 5' to 3' AAV9 5'ITR, a nucleic acid sequence encoding a double transgene, and AAV9 3'ITR. ITRs from different sources of AAV other than AAV9 can also be selected. In addition, the vector genome may contain regulatory sequences that direct the expression of target gene variants GDNF and GBA1.

[0108] The expression cassette of the present invention can be a polycistronic expression cassette. A polycistronic expression construct comprising a polycistronic expression cassette can simultaneously express two or more different proteins from the same mRNA, regulated by the same promoter but not fused, such as the variant hGDNF and GCase of the present invention. Suitable strategies for polycistronic expression of proteins include, for example, the use of 2A peptides and / or the use of internal ribosome entry sites (IRES) as connecting sequences. For example, the encoding nucleic acid sequences of different proteins can be separated by an intervening internal ribosome entry site (IRES) or an intervening 2A peptide coding sequence. In some embodiments, such a polycistronic vector can use one or more internal ribosome entry sites (IRES) to allow translation of another protein from the internal region of the mRNA. In other embodiments, such a polycistronic vector can use one or more tandem 2A peptides as connecting sequences.

[0109] 2A peptides are small "self-cleaving" peptides, usually 18 to 22 amino acids in length, and multiple proteins are produced at equimolar levels by the same mRNA. "Self-cleavage" mediated by 2A peptides is a common phenomenon in all eukaryotic cells. 2A peptides that can be used for gene cloning have been found from small RNA viruses, insect viruses and type C rotaviruses. See, for example, Szymczak et al., (2005) Expert Opin Biol Ther 5:627-638 (the entire contents of which are incorporated herein by reference). Examples of commonly used 2A peptides include Thosea asigna virus 2A (T2A); porcineteschovirus -1 2A (P2A); equine rhinitis A virus (ERAV) 2A (E2A) and FMDV2A (F2A). For such 2A peptides, it is preferred that a GSG residue be added to the N-terminus to improve the cleavage efficiency.

[0110] The term "pharmaceutical excipient" refers to a diluent, adjuvant, excipient, carrier or stabilizer, etc., which is administered together with an active substance.

[0111] The term "pharmaceutical composition" refers to a composition that is in a form that permits the active ingredient contained therein to be effective for biological activity, and that contains no additional ingredients that are unacceptably toxic to a subject to which the composition would be administered.

[0112] The term "drug combination" refers to a non-fixed combination product or a fixed combination product, including but not limited to a medicine box, a pharmaceutical composition. The term "non-fixed combination" means that the active ingredients (e.g., (i) the recombinant viral vector of the present invention and (ii) other therapeutic agents) are applied to the patient in sequence as separate entities simultaneously, without specific time restrictions or at the same or different time intervals, wherein such administration provides two or more active ingredients at effective levels of prevention or treatment in the patient. In some embodiments, the recombinant viral vector of the present invention and other therapeutic agents used in the drug combination are applied at a level not exceeding that when they are used alone. The term "fixed combination" means that two or more active ingredients are applied to the patient simultaneously in the form of a single entity. It is preferred that the dosage and / or time interval of two or more active ingredients are selected so that the combined use of each part can produce an effect greater than that achieved by using any one ingredient alone when treating a disease or condition. Each ingredient can be in a separate formulation form, and its formulation form can be the same or different.

[0113] The term "combination therapy" refers to the administration of two or more therapeutic agents or treatments (e.g., radiotherapy or surgery) to treat diseases described herein. Such administration includes co-administration of these therapeutic agents in a substantially simultaneous manner, or such administration includes co-administration of each active ingredient in a plurality of or separate containers or doses. If the therapeutic agent is in powder and / or liquid form, it can be reconstituted or diluted to the desired dose before administration. In addition, such administration also includes using each type of therapeutic agent or treatment in a sequential manner at approximately the same time or at different times. In either case, the treatment regimen will provide a beneficial effect of combination therapy in treating a disorder or condition described herein.

[0114] The term "treatment" refers to a clinical intervention intended to change the natural course of a disease in an individual being treated, and may refer to slowing, interrupting, blocking, alleviating, stopping, reducing, or reversing the progression or severity of an existing symptom, disorder, condition, or disease. In general, the desired therapeutic effect includes, but is not limited to, preventing the occurrence or recurrence of the disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, reducing the rate of progression of the disease, improving or alleviating the disease state, and alleviating or improving prognosis. For central nervous system diseases, especially neurodegenerative diseases, treatment can be embodied in a variety of ways detectable or undetectable effects, such as generalized anxiety disorder, cognitive impairment, learning and memory deficits and dysfunctions, attention deficit and hyperactivity disorder, tremor, reduction / reduction / alleviation of paralysis, and / or abnormal (local or global) levels of Lewy bodies, synuclein, amyloid, neurotransmitters, and neuromodulators, etc.

[0115] As used herein, "prevention" includes the inhibition of the occurrence or development of a disease or disorder or a symptom of a specific disease or disorder. In some embodiments, subjects with a family history of central nervous system diseases (e.g., neurodegenerative diseases) are candidates for preventive regimens. Typically, in the context of central nervous system diseases, the term "prevention" refers to the administration of drugs before the signs or symptoms of such diseases occur, particularly in subjects with associated risks.

[0116] II. Variant GDNF

[0117] Glial cell line derived neurotrophic factor (GDNF) is a small protein that can effectively promote the survival and regeneration of a variety of neurons. An exemplary variant GDNF of the present invention comprises a T154S mutation. An exemplary sequence of wild-type human GDNF is shown in Uniprot P39905. Any amino acid site of GDNF mentioned in the present invention is numbered with reference to the corresponding position number after alignment with the sequence provided by Uniprot P39905. The wild-type human GDNF coding sequence is shown in the mRNA sequence shown in NCBI Genbank Accession ID NM_000514.4, position 562-1197 (CDS).

[0118] In one aspect, the present invention provides a variant GDNF protein comprising a T154S amino acid mutation. When expressed in target cells (e.g., neurons), it promotes the expression of Nurr1. In particular, when expressed in neurons with α-syn accumulation, it can reverse the inhibitory effect of α-syn on Nurr1 expression and reduce the accumulation of α-syn.

[0119] In some embodiments, the variant GDNF protein has the amino acid sequence shown in SEQ ID NO:1.

[0120] In some embodiments, the present invention provides the gene sequence of the variant GDNF protein accordingly. In a preferred embodiment, the gene sequence comprises:

[0121] (1) the sequence shown in SEQ ID NO: 2;

[0122] (2) a nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO: 1; or

[0123] (3) A nucleic acid sequence that encodes the same variant GDNF protein as the nucleic acid sequence of (1) or (2), but is different from the nucleic acid sequence of (1) or (2) due to the degeneracy of the genetic code.

[0124] III. Expression Frame

[0125] In one aspect, the present invention provides an expression cassette of a variant GDNF, which comprises a nucleotide sequence encoding the variant GDNF protein of the present invention, and a regulatory sequence directing its expression, such as an upstream regulatory sequence and a downstream regulatory sequence.

[0126] In some more specific embodiments, the gene expression cassette further comprises a GBA1 gene sequence encoding human GCase. Therefore, in some embodiments of the present invention, a double transgenic expression cassette of a variant GDNF×GBA1 is provided. Specifically, it comprises a gene sequence encoding a variant GDNF protein of the present invention and a GBA1 gene sequence.

[0127] In some preferred embodiments, the GBA1 gene sequence is codon-optimized relative to the wild-type sequence. In some preferred embodiments, compared to the wild-type sequence, the codon-optimized GBA1 gene sequence increases the expression of GCase protein produced by the vector containing the GBA1 gene sequence after transfection / infection of the host cell by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 150%, at least 200%.

[0128] In some preferred embodiments, the gene expression cassette comprises a first promoter, for example, which is located at the 5' side of the GDNF gene sequence and the GBA1 gene sequence.

[0129] In some preferred embodiments, the variant GDNF gene sequence is located at the 5' end of the GBA1 gene sequence. In some preferred embodiments, the variant GDNF gene sequence is located at the 3' end of the GBA1 gene sequence. In some preferred embodiments, the variant GDNF gene sequence and the GBA1 gene sequence are connected by a linker sequence. In some more preferred embodiments, the linker sequence allows the variant GDNF and GCase to be expressed as independent proteins. In some more preferred embodiments, the linker sequence is a second promoter (same or different from the first promoter), IRES or a self-cleaving peptide (e.g., a 2A peptide, such as T2A, P2A). In a most preferred embodiment, the linker sequence is T2A. In some more preferred embodiments, there are no other regulatory sequences between the variant GDNF gene sequence and the GBA1 gene sequence except for the linker sequence.

[0130] In some preferred embodiments, the gene expression cassette comprises a Kozak sequence.

[0131] In some preferred embodiments, the gene expression cassette comprises a polyA signal sequence.

[0132] In some preferred embodiments, the gene expression cassette / vector of the present invention may further comprise a linker (e.g., the aforementioned linker sequence), a transition sequence, an enzyme cleavage site, a homologous recombination site (e.g., a homology arm sequence, a loxP site, etc.), or any combination thereof between the various elements. For example, due to the desired cloning operation, the gene expression cassette / vector may further comprise a 5' and / or 3' homology arm sequence.

[0133] In a more specific embodiment, the present invention provides a gene expression cassette comprising the following elements arranged in sequence from 5' to 3':

[0134] (a) CBA promoter;

[0135] (b) an optional Kozak sequence;

[0136] (c) GBA1 gene;

[0137] (d) T2A coding sequence;

[0138] (e) variant GDNF gene sequences;

[0139] (f) polyA signal sequence.

[0140] In a more specific embodiment, the present invention provides a gene expression cassette comprising the following elements arranged in sequence from 5' to 3':

[0141] (a) a CBA promoter, the sequence of which is as shown in SEQ ID NO:5 or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:5;

[0142] (b) an optional Kozak sequence, the Kozak sequence being the sequence shown in SEQ ID NO:7, or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:7;

[0143] (c) a GBA1 gene, whose sequence is the sequence shown in SEQ ID NO:4, or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with SEQ ID NO:4 and encoding the same amino acid sequence;

[0144] (d) a T2A coding sequence, the sequence of which is as shown in SEQ ID NO:9 or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:9;

[0145] (e) a variant GDNF gene sequence, the sequence of which is:

[0146] (1) the sequence shown in SEQ ID NO: 2;

[0147] (2) a nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO: 1; or

[0148] (3) A variant GDNF protein encoding the same nucleic acid sequence as (1) or (2), but differs from (1) due to the degeneracy of the genetic code.

[0149] or (2) a nucleic acid sequence that is different from the nucleic acid sequence;

[0150] (f) a polyA signal sequence having a sequence as shown in SEQ ID NO:6 or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0151] In a specific embodiment, the expression cassette of the present invention comprises: GBA1 gene sequence-T2A coding sequence-variant GDNF gene sequence, for example, as shown in SEQ ID NO:13.

[0152] In a specific embodiment, the expression cassette of the present invention comprises: GBA1 gene sequence-P2A coding sequence-variant GDNF gene sequence, for example, as shown in SEQ ID NO:14.

[0153] In a specific embodiment, the expression cassette of the present invention comprises: GBA1 gene sequence-E2A coding sequence-variant GDNF gene sequence, for example, as shown in SEQ ID NO:15.

[0154] In a specific embodiment, the expression cassette of the present invention comprises: GBA1 gene sequence-F2A coding sequence-variant GDNF gene sequence, for example, as shown in SEQ ID NO:16.

[0155] In a specific embodiment, the expression cassette of the present invention comprises: GBA1 gene sequence-IRES sequence-variant GDNF gene sequence, for example, as shown in SEQ ID NO:17.

[0156] In a specific embodiment, the expression cassette of the present invention comprises: CBA-Kozak-hGBA1-T2A-variant hGDNF-polyA, for example as shown in SEQ ID NO:18.

[0157] In some preferred embodiments, in the expression frame of the present invention, when at least two of the above elements are connected in sequence, there is also a spacer sequence between the sequences of the elements. These sequences are added for the purpose of facilitating cloning construction and subsequent identification, improving gene transcription and translation efficiency, etc., such as Kozak sequences, restriction endonuclease action sites, universal primer sequences, batch labels, etc., as long as they do not interfere with or inhibit the expression effect of the expression frame and do not affect the synergistic effect between the various elements, such spacer sequences are considered to be within the scope of protection of the technical solution of the present invention, and do not need to be deliberately removed. Those skilled in the art can know and use such spacer sequences based on conventional techniques and common knowledge.

[0158] IV. Viral Vectors

[0159] In yet another aspect, the present invention provides a viral vector, wherein a replication-defective viral genomic sequence comprising an expression cassette encoding a functional GCase and a variant GDNF is packaged in a viral capsid or envelope, such that the recombinant viral particle cannot produce progeny virions but retains the ability to infect target cells.

[0160] In one embodiment, the genomic sequence of the viral vector does not contain genes encoding enzymes required for viral replication, and therefore, the use of viral vectors in gene therapy is considered safe because in the absence of enzymes required for viral replication, replication and infection of progeny virions cannot occur.

[0161] The recombinant viral vector of the present invention can preferably be a recombinant adeno-associated virus (AAV), but can also be a common vector that is equally effective in delivering genes, such as adenovirus, Bocavirus, AAV / Bocavirus hybrid, herpes simplex virus or lentivirus.

[0162] The packaging cell line for producing a recombinant viral vector (e.g., a recombinant AAV vector) can be a prokaryotic cell or a eukaryotic cell (e.g., a human cell, an insect cell, or a yeast cell) containing exogenous DNA introduced into the cell by any means (e.g., electroporation, calcium phosphate precipitation, microinjection, transformation, viral infection, transfection, and protoplast fusion). Packaging cell line cells include, but are not limited to, E. coli cells, yeast cells, human cells, non-human cells, mammalian cells, non-mammalian cells, insect cells, HEK293 cells, hepatocytes, kidney cells, glial cells, tumor cells, or stem cells.

[0163] As used herein, the term "target cell" refers to a target cell in which expression of functional GCase and variant GDNF is desired. Examples of target cells include, but are not limited to, various neural cells, glial cells, etc. in the central nervous system. In some embodiments, the vector is delivered to the target cell in vivo.

[0164] In a preferred embodiment, the viral vector is a recombinant adeno-associated virus (rAAV) vector, which comprises an AAV capsid and a vector genome packaged therein. The vector genome comprises an AAV 5' inverted terminal repeat (ITR), a nucleic acid sequence encoding a functional GCase and variant GDNF, a regulatory sequence for instructing expression in target cells, an AAV 3'ITR, and optionally other regulatory sequences. ITR is a genetic element responsible for the replication and packaging of the genome during vector production, and is the only viral cis element required for the production of rAAV. ITRs from AAVs of different sources can be selected. In one embodiment, ITRs are from AAVs that are different from the capsids of viral particles.

[0165] In a preferred embodiment, when the viral vector comprises the double transgenic gene expression cassette of the present invention, both ends of the expression cassette are respectively connected to an ITR sequence.

[0166] Unless otherwise indicated, the AAV capsids, ITRs and other AAV components described herein can be easily selected from any AAV, including but not limited to AAVs of serotypes generally identified as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAVrh.10, or combinations thereof, or variants thereof, or combinations thereof. In one embodiment, the AAV capsid is an AAV9 capsid or a variant thereof. In one embodiment, the AAV capsid is an AAV2 capsid or a variant thereof. In one embodiment, the AAV capsid is an AAV8 capsid or a variant thereof. In one embodiment, the AAV capsid is an AAV5 capsid or a variant thereof. In certain embodiments, the capsid protein is specified by a number or a combination of numbers and letters following the term "AAV" in the name of the rAAV vector.

[0167] In one or more embodiments of the present invention, the recombinant viral vector of the present invention comprises the double transgenic expression cassette of the present invention, which comprises the coding sequences of functional GCase and variant GDNF.

[0168] In one embodiment, a rAAV is provided, comprising a capsid selected from AAV serotype 9 (AAV9), serotype 2 (AAV2), serotype 8 (AAV8), serotype 5 (AAV5) or serotype 1 (AAV1), or any combination thereof, or any variant thereof, or any combination of variants thereof; and comprising in its genome a sequence having at least about 90% identity to any one of SEQ ID NOs: 13-17, more preferably a sequence having at least about 90% identity to SEQ ID NO: 18, for example a sequence comprising SEQ ID NO: 18.

[0169] In one or more embodiments of the present invention, the recombinant viral vector of the present invention expresses functional GCase and variant GDNF after infecting host cells / target cells.

[0170] As used herein, AAV "variants" refer to any AAV sequence derived from a known AAV sequence, including those AAV sequences with conservative amino acid substitutions, and sequences having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% or greater sequence identity with the amino acid or nucleic acid sequence of AAV. In another embodiment, the AAV capsid includes a variant that may contain up to about 10% variation compared to any described or known AAV capsid sequence. That is, the AAV capsid has about 90% identity to about 99.9% identity, about 95% to about 99% identity, or about 97% to about 98% identity with the AAV capsid provided herein and / or known in the art. In one embodiment, the AAV capsid has at least 95%, 96%, 97%, 98%, 99% or higher identity with the AAV capsid variant. When determining the percent identity of an AAV capsid, any variant protein (eg, VP1, VP2, or VP3) can be compared.

[0171] The present invention also provides a virus particle, which comprises the virus vector of the present invention and a capsid.

[0172] V. Methods for preparing viral vectors

[0173] The recombinant adeno-associated virus (AAV) vector of the present invention can be produced using known techniques. Such methods involve culturing packaging cells, which contain a nucleic acid sequence encoding an AAV capsid; a functional Rep gene; an expression cassette as described herein, which is flanked by AAV inverted terminal repeats (ITRs); and sufficient helper functions to allow the expression cassette to be packaged into the AAV capsid protein.

[0174] Also provided herein are packaging cells comprising a nucleic acid sequence encoding an AAV capsid; a functional Rep gene; an expression cassette as described herein, flanked by AAV inverted terminal repeats (ITRs); and sufficient helper functions to allow packaging of the expression cassette into AAV capsid proteins.

[0175] Other methods known in the art for producing rAAV may be utilized. Suitable methods may include, but are not limited to, baculovirus expression systems or production by yeast.

[0176] VI. Use of expression cassettes / viral vectors

[0177] The inventor unexpectedly discovered a GDNF variant that promotes the expression of Nurr1 and ultimately reverses the inhibitory effect of α-syn on Nurr1 expression. The inventor further discovered that the combination of this GDNF variant with the coding gene of GCase as a triple-target (upregulating GDNF, GCase and Nurr1) gene medicine has a therapeutic effect on central nervous system degenerative diseases related to these three molecules. α-syn is closely related to various neurodegenerative diseases such as Parkinson's disease (especially GBA1 gene abnormalities leading to low or no expression of GCase), while Nurr1 and GCase have beneficial effects in such diseases, and the unexpectedly discovered GDNF variant provides a positive effect on the Nurr1 target and its own activity, thereby realizing the double transgenic triple-target gene therapy expression frame / vector of the present invention, thereby achieving the therapeutic purpose that is superior to the prior art.

[0178] The expression cassette / viral vector of the present invention, as a gene drug, can be administered orally, single or multiple times intravenously, cisterna magna, intrathecally, intraventricularly, intraparenchymal, intramuscularly, or by convection-enhanced (CED) administration, preferably single or multiple times intraventricularly or intraparenchymal administration, to efficiently, continuously, and specifically express functional GCase and variant GDNF for preventing and / or treating neurodegenerative diseases in the whole body, especially in the central nervous system, wherein the variant GDNF upregulates the expression of Nurr1, and can inhibit the inhibition of Nurr1 by α-syn, and reduce the accumulation of α-syn. Preferably, the neurodegenerative disease shows a decrease in Nurr1 and / or an increase in α-syn, and more preferably, the neurodegenerative disease is Gaucher disease, Parkinson's disease, or Parkinson's syndrome, preferably Gaucher disease or GBA1-related Parkinson's disease.

[0179] The expression cassette / viral vector of the present invention is injected into a subject orally, administered intravenously, intramedullary cisternae, intrathecally, intraventricularly, intraparenchymally, intramuscularly, or by convection-enhanced (CED) administration, preferably administered intraventricularly or intraparenchymally, to express exogenous functional GCase and variant GDNF in target cells (e.g., diseased nerve cells) in the patient, thereby completely or partially alleviating or eliminating the symptoms of the disease. Moreover, a single administration can continuously express functional GCase and variant GDNF, upregulate Nurr1, and reduce the accumulation of α-syn.

[0180] In some embodiments, the expression cassette / viral vector of the present invention can be used to prevent and / or treat the following neurodegenerative diseases:

[0181] diseases in which Nurr1 levels are abnormally decreased and / or would benefit from upregulation of Nurr1;

[0182] Diseases that accumulate α-syn and / or would benefit from reduced α-syn accumulation;

[0183] Diseases in which GBA1 levels are abnormally decreased and / or would benefit from upregulation of GBA1;

[0184] and / or diseases that would benefit from GDNF.

[0185] VI. Use in the preparation of medicines

[0186] In some embodiments, the expression cassette of the present invention can be used to prepare a drug for preventing and / or treating neurodegenerative diseases. In some preferred embodiments, the drug is prepared in the form of oral administration, intravenous administration, medullary cisterna magna administration, intrathecal administration, intraventricular administration, intraparenchymal administration, intramuscular administration, or convection enhanced administration (CED), preferably intraventricular administration or intraparenchymal administration. The drug can be a gene drug.

[0187] In other embodiments, the viral vector of the present invention can be used to prepare a drug, which is used to prevent and / or treat neurodegenerative diseases. In some preferred embodiments, the drug is prepared by oral administration, intravenous administration, medullary cisterna magna administration, intrathecal administration, intraventricular administration, intracerebral parenchymal administration, intramuscular administration, or convection enhanced (CED) administration, preferably intraventricular administration or intracerebral parenchymal administration. The drug can be a gene drug.

[0188] In other embodiments, the variant GDNF and nucleic acid molecules encoding the variant GDNF of the present invention can be used to prepare drugs for preventing and / or treating neurodegenerative diseases, which can be gene drugs.

[0189] In some embodiments, the present invention also provides the resulting pharmaceutical composition, which comprises the variant GDNF protein of the present invention, the polynucleotide encoding the variant GDNF protein, the gene expression cassette of the present invention (e.g., the double transgenic expression cassette), the expression vector of the present invention, the viral vector of the present invention, or the gene drug of the present invention.

[0190] VII. Treatment Methods

[0191] In one aspect, the present invention provides a pharmaceutical composition or formulation comprising a recombinant viral vector. These compositions or formulations may also optionally contain suitable pharmaceutical excipients, such as pharmaceutical carriers and pharmaceutical excipients known in the art, including buffers.

[0192] In one aspect, the present invention also provides a combination product (eg, a pharmaceutical combination product) comprising the recombinant viral vector of the present invention and one or more other therapeutic agents. The combination product of the present invention can be used in the treatment method of the present invention.

[0193] The present invention also provides a kit comprising the combination product, for example, the kit comprises in the same package:

[0194] - a first container containing the recombinant viral vector of the present invention or a pharmaceutical composition or preparation comprising the same;

[0195] - A second container comprising one or more additional therapeutic agents or a pharmaceutical composition or formulation comprising the same.

[0196] In some embodiments, the therapeutic agent is selected from any substance effective in neurodegenerative diseases, including levodopa, monoamine oxidase inhibitors, and the like.

[0197] In one aspect, the present invention relates to a method for preventing or treating a neurodegenerative disease in a subject, the method comprising administering to the subject an effective amount of a recombinant viral vector as described herein, or a pharmaceutical composition comprising the same. The neurodegenerative disease may be in the early, middle or late stages. Preferably, the neurodegenerative disease exhibits a decrease in Nurr1 and / or an increase in α-syn, more preferably, the neurodegenerative disease is Gaucher disease, Parkinson's disease or Parkinson's syndrome, preferably Gaucher disease or GBA1-related Parkinson's disease.

[0198] In some embodiments, the neurodegenerative disease is:

[0199] diseases in which Nurr1 levels are abnormally decreased and / or would benefit from upregulation of Nurr1;

[0200] Diseases that accumulate α-syn and / or would benefit from reduced α-syn accumulation;

[0201] Diseases in which GBA1 levels are abnormally decreased and / or would benefit from upregulation of GBA1;

[0202] and / or diseases that would benefit from GDNF.

[0203] The recombinant viral vector of the present invention (as well as compositions, pharmaceutical compositions, preparations, combination products, etc. comprising the same) can be administered by any suitable method, for example, by oral administration, intravenous administration, cisterna magna administration, intrathecal administration, intraventricular administration, intraparenchymal administration, intramuscular administration, or convection enhanced (CED) administration, preferably intraventricular administration or intraparenchymal administration.

[0204] In some embodiments, the recombinant viral vectors of the present invention, or medicaments or formulations comprising the same, are administered in combination with one or more treatment modalities or other therapeutic agents. Example

[0205] The technical scheme in the embodiment of the present invention is clearly and completely described below. Obviously, the described embodiment is only a part of the embodiment of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. Unless otherwise specified, the various reaction reagents involved in the embodiments can be purchased through commercial channels.

[0206] Example 1 Beneficial Effects of GDNF T154S in the Neuropathic Gaucher Disease (nGD) Model

[0207] The human glioblastoma cell line SH-SY5Y was treated with β-epoxide (Conduritol B epoxide, CBE), a chemical inhibitor of GCase, to simulate the effect of reduced GCase activity in nGD on neurons in vitro and construct an nGD cell model.

[0208] Subsequently, AAV overexpressing GDNF T154S was used to infect SH-SY5Y cells with reduced GCase activity. Figure 1 As shown in the figure, compared with the untreated control group cells, the CBE-treated cells (model group) showed a neuronal function inhibition phenotype, in which the synapses were significantly shortened or disappeared, and there were almost no long synapses. In contrast, the synapses of the model group cells treated with GDNF T154S were longer than those of the untreated model group cells, indicating that the synaptic structure and function were significantly restored.

[0209] The experimental operation is as follows:

[0210] 1. Inoculate SH-SY5Y cells cultured to P5 into 24-well plates;

[0211] 2. After 24 h of culture, add 25×CBE (Sigma-Aldrich #324599) to the cells, 5 μL / well;

[0212] 3. At the same time, add AAV9-GDNF T154S to the wells (1×10 9 vg / hole)

[0213] 4. At 24h and 48h after treatment, use an inverted microscope to continuously observe the cells and collect images (see 48h images for details). Figure 1 ).

[0214] Example 2 Construction of double transgenic recombinant plasmid

[0215] Take the construction process of variant recombinant plasmid pAAV9-CBA-Kozak-hGBA1-T2A-hGDNF-polyA as an example (commissioned by Suzhou Jinweizhi Biotechnology Co., Ltd. for construction, the plasmid map is as follows Figure 2 The steps are as follows:

[0216] (1) Gene synthesis of the expression frame CBA-Kozak-hGBA1-T2A-hGDNF-polyA gene fragment.

[0217] The sequence of the CBA promoter is shown in SEQ ID NO:5;

[0218] The Kozak sequence is shown in SEQ ID NO:7;

[0219] The codon-optimized sequence of hGBA1 is shown in SEQ ID NO:4;

[0220] The T2A coding sequence is shown in SEQ ID NO:9;

[0221] The sequence encoding hGDNF T154S is shown in SEQ ID NO: 3;

[0222] The polyA signal sequence is shown in SEQ ID NO:6;

[0223] Double digestion was performed with restriction endonucleases BglⅡ (New England Biolabs, R0144V) and BsrGI (New England Biolabs, R3575V). After overnight digestion at 37°C, the DNA was recovered using a gel recovery and purification kit (Tiangen Agarose Gel DNA Recovery Kit Enhanced - DP219).

[0224] (2) The vector was double-digested with BglⅡ and BsrG I restriction endonucleases: pAAV9 empty vector (pAAV2 / 9n, addgene, Plasmid #112865) was digested at 37°C overnight and then the vector was recovered using a gel recovery and purification kit.

[0225] (3) The vector and the synthetic fragment (CBA-Kozak-hGBA1-T2A-hGDNF-polyA fragment) were connected by T4 (New England Biolabs, M0202V) at a molar ratio of 1:3, and the transformation plate was cultured at 37°C overnight.

[0226] (4) Pick a single clone of overnight shake bacteria (add kanamycin), use a plasmid extraction kit (Tian Gen DP103) to extract the plasmid, and use BsrG I and EcoR V (New England Biolabs, R0195V) restriction endonucleases to double-digest the plasmid for identification. After successful identification, send the plasmid to a third-party company for sequencing. If the sequence alignment is successful, it means that the plasmid construction is successful.

[0227] The wild-type pAAV9-CBA-Kozak-hGBA1-T2A-hGDNF-polyA plasmid was constructed according to the same process, except that the hGDNF gene sequence encodes wild-type GDNF instead of the T154S variant. The wild-type hGDNF gene sequence is shown in SEQ ID NO:29.

[0228] Hereinafter, the two vectors are referred to as "variant type" and "wild type".

[0229] Example 3 Wild-type and variant pAAV9-CBA-Kozak-hGBA1-T2A-hGDNF-polyA plasmids were transfected into human neuroblastoma cells in vitro

[0230] At the cellular level, GBA1-GDNF plasmid was transfected to detect changes in NURR1 gene expression.

[0231] Cells were transfected with wild-type and variant pAAV9-CBA-Kozak-hGBA1-T2A-hGDNF-polyA plasmids. SH-SY5Y cells (Wuhan Punosai) were transferred to Advanced DMEM / F-12 medium (supplemented with 10% FBS) (Gibco 12634010) in a 10 cm dish. Transfection was performed after the cell growth was stable and the confluence reached about 80%.

[0232] Transfection method: Take a 1.5mL EP tube and mark it. Tube A: add 10μg of the target plasmid, add 480μL Opti-MEM (Cat. No. 31985070), mix well and let stand at room temperature for 5 minutes; Tube B: add 20μg PEI (Cat. No.: 919012), add 480μL Opti-MEM and mix well; add the liquid in tube A to tube B, mix well and let stand at room temperature for 15 minutes. After 15 minutes, gently mix the liquid and add it to a 10cm dish, place it in a 37℃ incubator and culture it for 2-3 days, then collect the cells for qPCR detection.

[0233] In order to detect the improvement effect of the variant constructed in Example 2 on the expression of the target gene compared with the wild-type pAAV9-CBA-Kozak-hGBA1-T2A-hGDNF-polyA plasmid, the wild-type / variant plasmids were used to transfect SH-SY5Y cells, and the RNA in the cells was extracted for real-time fluorescence quantitative PCR, and quantified and statistically analyzed by relative quantitative methods.

[0234] Total RNA was extracted from cells using TRIzol reagent, and the RNA concentration was detected by Nano Photometer N50 Touch. Different RNAs were diluted to 200 ng / μL and reverse transcribed into cDNA using PrimeScript RT Master Mix. Fluorescence quantitative PCR was then performed. Relative quantification (2 -△△Ct ) to calculate the relative expression value.

[0235] The primer sequences for real-time fluorescence quantitative PCR are as follows:

[0236] Targeting GBA1:

[0237] hGBA1-F:5′-3′(forward)ATGGAGCGGTGAATGGGAAG(SEQ ID NO:19)

[0238] hGBA1-R:5′-3′(reverse)GTGCTCAGCATAGGCATCCAG (SEQ ID NO:20)

[0239] Targeting GDNF:

[0240] hGDNF-F:5′-3′(forward)CTGACTTGGGTCTGGGCTATG (SEQ ID NO:21)

[0241] hGDNF-R:5′-3′(reverse)TTGTCACTCACCAGCCTTCTATTT (SEQ ID NO:22)

[0242] Targeting NURR1:

[0243] NURR1-F:5′-3′(forward)TTTGCAATGGGGTGGTCTTG(SEQ ID NO:23)

[0244] NURR1-R:5′-3′(reverse)AAACTGTCTGTGCGAACCAC(SEQ ID NO:24)

[0245] Targeting α-syn:

[0246] SNCA-F:5′-3′(forward)AAGAGGGTGTTCTCTATGTAGGC(SEQ ID NO:25)

[0247] SNCA-R:5′-3′(reverse)GCTCCTCCAACATTTGTCACTT(SEQ ID NO:26)

[0248] Targeted internal reference GAPDH:

[0249] GAPDH-F:5′-3′(forward)GGAGCGAGATCCCTCCAAAAT(SEQ ID NO:27)

[0250] GAPDH-R:5′-3′(reverse)GGCTTGTTGTCATACTTCTCATGG(SEQ ID NO:28)

[0251] The results are as follows Figure 3 As shown, after the cells were transfected with wild-type or variant plasmids, the expression of hGBA1 and hGDNF in SH-SY5Y cells increased, which was statistically significant; compared with the wild-type plasmid, the expression of hGBA1 and NURR1 in SH-SY5Y cells after transfection with the variant plasmid increased, and the expression of hGDNF and α-syn decreased, and the difference was statistically significant.

[0252] Example 4: In vitro transfection of α-syn overexpressing human neuroblastoma cells with wild-type and variant pAAV9-CBA-Kozak-hGBA1-T2A-hGDNF-polyA plasmids

[0253] Overexpression of α-syn is intended to simulate the intracellular biochemical reactions of neurons in the body during PD and provide a suitable model for in vitro verification of related mechanisms. GBA1-GDNF triple-target double transgenic plasmid was transfected on the basis of overexpression of α-syn, and NURR1 gene expression was detected by qPCR experiment

[0254] In order to detect the effect of the pAAV9-CBA-Kozak-hGBA1-T2A-hGDNF-polyA plasmid in Example 2 on α-syn overexpressing SH-SY5Y cells, pcDNA3.1-α-syn A53T overexpression plasmid (the exogenous gene is the coding sequence of the α-syn mutant associated with familial early-onset PD) was used to co-transfect SH-SY5Y cells with the wild-type / variant plasmid of Example 2, and then RNA in the cells was extracted for real-time fluorescence quantitative PCR, and quantified and statistically analyzed by relative quantitative methods.

[0255] Total RNA was extracted from cells using TRIzol reagent, and the RNA concentration was detected by Nano Photometer N50 Touch. Different RNAs were diluted to 200 ng / μL and reverse transcribed into cDNA using PrimeScript RT Master Mix. Fluorescence quantification was then performed. Relative quantification (2 -△△Ct ) Calculate the relative expression value. The primer sequences of real-time fluorescence quantitative PCR are the same as those in Example 3.

[0256] The results are as follows Figure 4 As shown, in SH-SY5Y cells transfected with α-syn overexpression plasmid alone, α-syn expression increased and Nurr1 expression decreased, which was statistically significant and consistent with the known conclusions in the art; in SH-SY5Y cells co-transfected with α-syn and wild-type / variant plasmids, the expression of hGBA1 and hGDNF increased, which was statistically significant; compared with the wild-type plasmid, SH-SY5Y cells transfected with the variant plasmid had decreased α-syn expression and increased Nurr1 expression, which was statistically significant.

[0257] The results of this example indicate that even in cells rich in α-syn protein, the variant GDNF of the present invention can still reverse the decreasing trend of Nurr1.

[0258] Example 5 Virus packaging and purification

[0259] 5.1 Virus preparation

[0260] Figure 5 A is a schematic diagram of the rAAV-CBA-Kozak-hGBA1-T2A-hGDNF-polyA triple-target double-transgenic recombinant adeno-associated virus vector constructed in the present invention.

[0261] Take the rAAV9-CBA-Kozak-hGBA1-T2A-hGDNF-polyA virus preparation process as an example:

[0262] (1) Plasmid transfection

[0263] 1. Add 500 μg of plasmid to the cell factory (Nest Scientific 771001), and transfect the plasmid when the cells grow to 70-80%, and prepare MIX:

[0264] A: Take a 50 mL centrifuge tube and add the following in equal molar ratios: Helper plasmid, Rep-Cap2 plasmid (the first two were purchased from Addgene), and pAAV9-CBA-Kozak-hGBA1-T2A-hGDNF-polyA plasmid prepared in Example 2;

[0265] B: PEI and plasmids (Helper plasmid, Rep-Cap2 plasmid and pAAV9-CBA-Kozak-hGBA1-T2A-hGDNF-polyA plasmid) were mixed at a mass concentration ratio of 2:1.

[0266] 2. Vortex A and B to mix: Add B dropwise into A, mix by inverting, and let stand at room temperature for 15 minutes to MIX.

[0267] 3. Take out the cell factory, turn the centrifuge tube upside down twice before adding MIX, add it dropwise into the cell factory, and place it in the incubator for culture.

[0268] 4. On the second day after transfection, discard the supernatant and replace it with an equal amount of serum-free culture medium.

[0269] (2) Collecting viruses

[0270] 1. Collect the virus on the third day after changing the medium.

[0271] 2. Shake the cell factory vigorously to make the cells float, add them to a 50mL centrifuge tube, centrifuge at 1500g, 4℃ for 10min, discard the supernatant and retain the cells at the bottom.

[0272] 3. Add appropriate amount of Lysis buffer (Biyuntian P0013F) to the centrifuge tube, mix the cells and vortex.

[0273] 4. Take liquid nitrogen to a suitable container, put the centrifuge tube into liquid nitrogen for quick freezing for 10 minutes, put it in 37°C until it is completely thawed, vortex for 2 minutes, put it in liquid nitrogen again, and repeat 3 times.

[0274] 5. Centrifuge at 1500g, 4°C for 30 min.

[0275] (3) PEG precipitation

[0276] 1. Take the supernatant and transfer it to a new 50 mL centrifuge tube. Add PEG8000 at a ratio of liquid: PEG = 4:1. Invert to mix well and let it precipitate at 4°C overnight.

[0277] 2. On the next day, centrifuge at 1500g and 4°C for 30 minutes.

[0278] 3. Discard the supernatant.

[0279] 4. Dissolve the precipitate in 2 mL of PBS.

[0280] (4) Cesium chloride density gradient centrifugation

[0281] After precipitation, the virus was purified and concentrated by cesium chloride density gradient centrifugation.

[0282] 5.2 Virus titer and purity tested by qPCR, silver staining and genome identification

[0283] First, the viral protein capsid was identified using the Bio-Sky Silver Staining Kit.

[0284] (1) SDS-PAGE electrophoresis: Use a 1.5 mm, 15-hole comb to prepare an SDS-PAGE gel with a separation gel concentration of 10%. Take 10 μL of the sample virus capsid and intact virus in a 1.5 mL EP tube, dilute each with 10 μL of ddH2O, add 6× loading buffer, and denature the protein at 95°C for 10 min. Prepare 1× electrophoresis buffer and add it to the electrophoresis tank to prepare for sample loading. Add 3 μL of marker, 20 μL of virus capsid sample, and 20 μL of intact virus sample to the lanes in turn. Electrophoresis at 90 V for 30 min, then 120 V for 60 min until bromophenol blue runs to the bottom of the gel.

[0285] (2) Fixation: After electrophoresis, place the gel in about 100 mL of fixative solution and shake on a shaker at room temperature at 60 rpm for 20 min. Fixation for more than 40 min can further reduce the background. Fixative solution: Add 50 mL of ethanol, 10 mL of acetic acid, and 40 mL of Milli-Q grade pure water in sequence, and mix well to make 100 mL of fixative solution.

[0286] (3) 30% ethanol washing: discard the fixative, add 100 mL of 30% ethanol, and shake on a shaker at room temperature at 60 rpm for 10 min.

[0287] (4) Water washing: discard 30% ethanol, add 200 mL of Milli-Q grade pure water, and shake on a shaker at room temperature at 60 rpm for 10 minutes. If this step is washed with water for a longer time, it will slightly help reduce the staining background.

[0288] (5) Sensitization: Discard the water, add 100 mL of silver staining sensitization solution, and shake on a shaker at room temperature at 60 rpm for 2 min.

[0289] (6) Water washing: discard the original solution, add 200 mL of Milli-Q grade pure water, and shake on a shaker at room temperature and 60 rpm for 1 min. Repeat the above steps once.

[0290] (7) Silver staining: discard the water, add 100 mL of silver solution, and shake on a shaker at room temperature at 60 rpm for 10 min.

[0291] (8) Water washing: discard the original solution, add 100 mL of Milli-Q grade pure water, and shake on a shaker at room temperature at 60 rpm for 1 min (the water washing time cannot exceed 1.5 min).

[0292] (9) Color development: discard the water, add 100 mL of silver staining solution, shake on a shaker at room temperature until the expected protein bands appear, at a speed of 60 rpm. Preparation of silver staining solution: add 20 mL of silver staining basic solution to 80 mL of Milli-Q grade pure water, then add 0.05 mL of silver staining acceleration solution, mix well to obtain the silver staining solution.

[0293] (10) Termination: Discard the silver staining colorimetric solution, add 100 mL of silver staining stop solution, and shake on a shaker at room temperature at 60 rpm for 10 minutes. It is normal for gas to be generated during termination, and the generated gas is carbon dioxide. Preparation of silver staining stop solution: Add 5 mL of silver staining stop solution to 95 mL of Milli-Q grade pure water, and mix well to terminate the silver staining. The silver staining stop solution should be used on the same day after preparation. Store the stained gel block in Milli-Q grade pure water. Take photos and record the results.

[0294] SDS PAGE gel preparation system

[0295]

[0296] Electrophoresis related reagent configuration system

[0297]

[0298] Agarose gel electrophoresis was used to further identify the viral genome size.

[0299] (1) Add 2× lysis buffer (mainly composed of SDS, NaCl, and EDTA) to the sample and incubate at 95°C for 10 min to release the viral genome;

[0300] (2) After the sample was cooled for 10 min, 2 μL of 6× DNA Gel Loading Purple Dye (NEB) was added;

[0301] (3) Take 3 μL of 5k Marker (Takara) and add it to the first channel;

[0302] (4) 20 μL of the treated AAV9-GBA1-GDNF sample was added to the third channel, and its genome size was 4.3 kb;

[0303] (5) 20 μL of the treated AAV9 capsid sample was added to the fourth channel, which has no genome;

[0304] (6) Electrophoresis at 100 V 200 mA for 50 min;

[0305] (7) When photographed under a gel imager, the genome size of AAV9-GBA1-GDNF was approximately 4.3 kb.

[0306] Finally, RT-qPCR was used to identify the virus concentration (primers see Example 3)

[0307] (1) Add DNase I, DNase I buffer and ddH2O to 10 μL of sample to make up to 50 μL and incubate at 37°C for 15 min to digest DNA.

[0308] (2) Add 50 μL of lysis buffer to the digestion system to terminate the digestion and lyse the viral capsid to release the viral genome at 95°C for 10 min;

[0309] (3) After taking out the sample, cool it to room temperature and dilute it in a gradient manner of 1000-fold, 10,000-fold, and 30,000-fold;

[0310] (4) Dilute the standards S1-S7, starting at a concentration of 1e7, and dilute five-fold;

[0311] (5) preparing a mix of fluorescent dye and primers;

[0312] (6) Add samples to the eight rows: first add mix, 15 μL / well. Then add the standard sample from low to high concentration to each well at 10 μL / well, and add the three dilution gradient samples to the sample wells in sequence at 10 μL / well;

[0313] (7) On-machine testing

[0314] Absolute quantitative PCR reaction time

[0315]

[0316] Figure 5 The results are from cesium chloride density gradient centrifugation and silver staining of the virus. Figure 5 B shows that after cesium chloride density gradient centrifugation for 24 hours, clear virus bands were obtained. The lower band 3 is the genome band in the complete virus, and the virus shell 1 does not contain the genome. The virus bands were extracted for silver staining to detect the purity of the virus. Figure 5 As can be seen in D, the three proteins are all viral capsid proteins; Figure 5 C is the identification of the virus genome by agarose electrophoresis, and the band position and size are correct. The above results show that the virus with low impurities and high purity has been prepared.

[0317] Example 6 Expression of rAAV9-CBA-Kozak-hGBA1-T2A-hGDNF-polyA in the brain of GBA1-CKO mice

[0318] (1) Western blot detection of GBA1 and GDNF expression

[0319] It was tested whether the variant rAAV9-CBA-Kozak-hGBA1-T2A-hGDNF-polyA virus prepared in Example 5 could be successfully injected and transcribed in the brain of GBA1-CKO mice. GBA1-CKO mice were purchased from Jiangsu Saiye Biotechnology, and exons 9-11 of the GBA1 gene in their genome were knocked out. Each mouse was injected with NC (control group) or virus (experimental group) in the brain parenchyma:

[0320] The mice were injected intraparenchymally at P1 (postnatal day 1) with the injection site at the distal 1 / 3 of the Lambda line, the depth was 2 mm, and the dose was 2×10 11 vg / μL, 2μL / injection point.

[0321] Three months after the vector was injected into the brain parenchyma, the mouse brain tissue was obtained and repeatedly shaken in RIPA lysis buffer for 30 minutes, and tissue proteins were extracted for Western blot detection.

[0322] Prepare 10% SDS-PAGE gel, add about 400-500mL of 1× electrophoresis buffer to the electrophoresis tank, then add the samples to the sample wells in order, turn on the power, perform electrophoresis in constant voltage mode (90V for concentrated gel, 110V for separation gel), and stop electrophoresis when the gel runs to the bottom. Immerse the PVDF membrane in methanol to activate it, discard the concentrated gel part, immerse it in the transfer solution in the order of blackboard-fiber pad-thick filter paper-PAGE gel-PVDF membrane-thick filter paper-fiber pad-white board, and perform wet transfer in constant current mode (200mA, 120min). After the transfer, block with 5% skim milk powder. Wash with 1×TBST on a horizontal shaker for 10min.

[0323] Prepare the primary antibody working solution as follows:

[0324] anti-GBA1 (Sigma-Aldrich G4171) WB 1:1000

[0325] anti-βactin (Proteintech 66009-1-Ig) WB 1:1000

[0326] anti-GAPDH (Proteintech HRP-60004) WB 1:5000

[0327] anti-Nurr1 (boster PB0332) WB 1:1000

[0328] anti-GDNF (abcam ab18956) WB 1:1000

[0329] anti-α-syn(S129)(abcam ab51253) WB 1:1000

[0330] The primary antibody working solution was completely immersed in the PVDF membrane, placed on a horizontal shaker, and incubated at room temperature for 120 minutes. The membrane was washed 3 times with 1×TBST, 10 minutes each time, to completely wash away the residual primary antibody, and then the diluted secondary antibody (HRP-conjugated GoatAnti Rabbit IgG (H+L), diluted 1:5000) was added and incubated at room temperature for 60 minutes. The membrane was washed 5 times with 1×TBST, 5 minutes each time, and then imaged in a pre-cooled chemiluminescence instrument.

[0331] like Figure 6 As shown in the figure, the expression of GCase and GDNF in the brain of CKO mice was reduced compared with wild-type mice; compared with untreated CKO mice (flox group in the figure), the expression of GCase and GDNF in the brain of mice was significantly increased after three months of treatment.

[0332] (2) Absorbance method using substrate 4-MUG to detect GCase activity

[0333] Frozen brain tissue samples were lysed on ice with RIPA, and the total protein concentration was determined by the BCA method. A 1 μg / μL protein sample was prepared. 5 μg protein and 1×4-MUG were added to a 96-well ELISA plate, totaling 50 μL / well. The standard was a gradient dilution of 4-MUG. The samples and standards were incubated with the substrate at 37°C in the dark for 2 h. The reaction was terminated with 1M glycine buffer (pH=10.4) at 50 μL / well. The readings of the standards and samples were measured with an ELISA reader at an excitation wavelength of 360 nm and an emission wavelength of 490 nm.

[0334] like Figure 7 As shown, the GCase activity in the brain of CKO mice was reduced compared with that of wild-type mice; whereas, the GCase activity in the brain of mice was significantly increased after three months of treatment compared with that of untreated CKO mice.

[0335] (3) Western blot detection of syn expression

[0336] like Figure 8 As shown, the accumulation of syn in the brain of CKO mice was significantly increased compared with that of wild-type mice; whereas, the accumulation of syn in the brain of mice was significantly reduced after three months of treatment compared with that of untreated CKO mice.

[0337] (4) Western blot detection of Nurr1 expression

[0338] like Fig. 9As shown, compared with wild-type mice, the expression of Nurr1 in the brain of CKO mice was significantly reduced; however, compared with untreated CKO mice, the expression of Nurr1 in the brain of mice was significantly increased after three months of treatment.

[0339] (5) Immunohistochemical detection of neuronal function

[0340] like Fig.10 As shown, compared with wild-type mice, the expression of Nissl bodies in the brains of CKO mice was reduced; compared with untreated CKO mice, the expression of Nissl bodies in the brains of mice increased after three months of treatment, with a clear, teardrop-shaped morphology.

[0341] This example shows that GBA1 knockout causes significant pathological changes in the central nervous system of mice, which is reflected in a variety of structural and functional indicators. After treatment with the triple-target dual-transgenic rAAV vector of the present invention, a number of structural and functional indicators of mice were restored or significantly restored, indicating that the disease was alleviated or even reversed.

[0342] Sequence Listing

[0343]

[0344]

[0345]

[0346]

[0347]

[0348]

[0349]

[0350]

[0351]

[0352]

[0353]

Claims

1. A polynucleotide encoding a variant GDNF protein, wherein the variant GDNF protein comprises a T154S mutation, Preferably wherein the polynucleotide has: (1) the sequence shown in SEQ ID NO: 2; (2) a nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO: 1; or (3) A nucleic acid sequence that encodes the same variant GDNF protein as the nucleic acid sequence of (1) or (2), but is different from (1) or (2) due to the degeneracy of the genetic code.

2. A gene expression cassette comprising the polynucleotide according to claim 1 and one or more regulatory sequences, and optionally, further comprising a polynucleotide encoding GCase.

3. The gene expression cassette as claimed in claim 2, comprising a promoter, a polynucleotide as claimed in claim 1 and a polynucleotide encoding GCase, wherein the latter two are connected by a linker sequence, in, The polynucleotide encoding GCase has a sequence as shown in SEQ ID NO:4, Preferably, the linker sequence is a self-cleaving polypeptide encoding sequence or an IRES sequence.

4. The gene expression cassette according to claim 2 or 3, further comprising other regulatory sequences besides the promoter, such as a Kozak sequence and / or a polyA signal sequence.

5. A gene expression cassette comprising the nucleic acid sequence shown in any one of SEQ ID NOs: 13-18.

6. An expression vector comprising the gene expression cassette of any one of claims 2 to 5, preferably, the expression vector is a plasmid vector, or a viral vector, for example, a recombinant adeno-associated virus (rAAV) vector.

7. A viral vector, characterized in that Comprising the gene expression cassette according to any one of claims 2 to 5.

8. The viral vector according to claim 7, characterized in that It comprises the nucleic acid sequence shown in any one of SEQ ID NOs: 13-18.

9. A gene medicine for preventing and / or treating neurodegenerative diseases, comprising the gene expression cassette according to any one of claims 2 to 5, the expression vector according to claim 6, or the viral vector according to claim 7 or 8, Preferably, the drug is administered orally, intravenously, cisterna magna, intrathecally, intraventricularly, intraparenchymally, intramuscularly, or by convection-enhanced (CED) administration. More preferably, the drug is administered intracerebroventricularly or intraparenchymally.

10. The viral vector according to claim 7 or 8 or the gene medicine according to claim 9, characterized in that: The viral vector is a rAAV vector, and its serotype is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAVrh10, or any combination thereof, or any variant thereof, or any combination of variants thereof, preferably AAV9 or a combination comprising AAV9 or any variant of AAV9 or a combination comprising any variant of AAV9.

11. A recombinant virus particle comprising the virus vector of claim 7 or 8 and a capsid, preferably the capsid described in claim 10.

12. A host cell, characterized in that The host cell contains the polynucleotide according to claim 1, the gene expression cassette according to any one of claims 2-5, the expression vector according to claim 6, the viral vector according to any one of claims 7, 8 and 10, or the polynucleotide according to claim 1 or the gene expression cassette according to any one of claims 2-5 is integrated into its chromosome.

13. The host cell according to claim 12, characterized in that The host cells include, but are not limited to, HeLa, SH-SY5Y, Sf9, HEK293, HEK293F, HEK293T, HT22 cells, or a combination thereof, preferably HEK293 cells.

14. Use of a variant GDNF protein comprising a T154S mutation, a polynucleotide according to claim 1, a gene expression cassette according to any one of claims 2 to 5, an expression vector according to claim 6, a viral vector according to any one of claims 7, 8 and 10, a gene medicine according to claim 9 or 10 or a recombinant virus particle according to claim 11 in the preparation of a drug for preventing and / or treating a neurodegenerative disease, Preferably, the drug is administered orally, intravenously, cisterna magna, intrathecally, intraventricularly, intraparenchymally, intramuscularly, or by convection-enhanced (CED) administration. More preferably, the drug is administered intracerebroventricularly or intraparenchymally.

15. The gene medicine according to claim 9 or 10 or the use according to claim 14, characterized in that: The neurodegenerative disease shows a decrease in Nurr1 and / or an increase in α-syn. Preferably, the neurodegenerative disease is Gaucher disease, Parkinson's disease or Parkinson's syndrome, preferably Gaucher disease or GBA1-related Parkinson's disease.

16. A pharmaceutical composition comprising a GDNF protein having a T154S mutation, a polynucleotide according to claim 1, a gene expression cassette according to any one of claims 2 to 5, an expression vector according to claim 6, a viral vector according to any one of claims 7, 8 and 10, a gene drug according to claim 9 or 10, or a recombinant viral particle according to claim 11, or any combination thereof.

Images