Application of soybean lysophosphatidic acid acyltransferase LPAT4 coding gene GmRGD14
By overexpressing the GmRGD14 gene in soybeans and Arabidopsis, the number of lateral roots and root amounts have been significantly increased, the problem of insufficient research on the development function of soybean roots has been solved, the tolerance of soybeans to high salt and drought has been improved, and the health of soybean roots has been promoted. Development and stress resistance.
Patent Information
- Application Number
- CN202411341363.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-25
- Publication Date
- 2024-12-20
AI Technical Summary
The research on the gene function of soybean root system development in the prior art is relatively lacking, which affects the tolerance and yield of soybeans under adverse conditions.
By overexpressing the gene GmRGD14 encoding soy lysophosphatidic acid acyltransferase LPAT4, genetic engineering technology is used to carry out root system transformation in soybeans and Arabidopsis, significantly increasing the number of lateral roots and the amount of roots, and improving tolerance to high salt and drought.
It has successfully improved the root amount of soybeans and Arabidopsis and its tolerance to adversity, and promoted the healthy development and stress resistance of soybean root system.
Smart Images
Figure CN119162227A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to application of soybean lysophosphatidic acid acyltransferase LPAT4 encoding gene GmRGD14, and belongs to the field of genetic engineering. Specifically, soybean lysophosphatidic acid acyltransferase LPAT4 encoding gene GmRGD14 increases the number of lateral roots of Arabidopsis thaliana and the root amount of soybean hairy roots. Background Art
[0002] Soybean is an important grain and oil crop, and is also the most cultivated oilseed crop in the world. The root system of soybean is composed of main roots, lateral roots and root hairs, and is a taproot system. The root system is the most important organ for soybean to absorb water and nutrients from the soil. Its growth and development directly affects the growth of the aboveground part, which in turn affects the yield and quality. In addition, the root structure also plays a key role in the tolerance of soybeans under adverse conditions. A strong root system can significantly improve the drought resistance and waterlogging resistance of soybeans. Therefore, revealing the genetic basis of root formation and function is crucial for developing soybean varieties with stronger stress resistance and stronger growth.
[0003] Soybean oil is stored in seeds in the form of triacylglycerol (TAG). Lysophosphatidic acid acyltransferase (LPAT / LPAAT) is one of the key rate-limiting enzymes for TAG synthesis. At present, LPATs have been isolated from many plants, such as Arabidopsis, rice, soybean, peanut, castor, rapeseed, etc. There are five LPAT subtypes in Arabidopsis: LPAT1, LPAT2, LPAT3, LPAT4 and LPAT5. LPAT1 is a plastid LPAT, and the loss of AtLPAT1 will cause embryonic lethality. The LPAT2 deletion mutant lpat2 will cause female gametophyte lethality. LPAT4 and LPAT5 are redundant under low nitrogen conditions, and the lpat4-1lpat5-1 double mutant has slow growth of the aboveground part. LPAT2 in rice positively regulates the response of rice to hyperosmotic stress by mediating abscisic acid signaling. Heterologous expression of soybean GmLPAT2 in Arabidopsis changes the TAG composition in seed oil. Overexpression of peanut AhLPAT2 in Arabidopsis can increase the oil content and weight of seeds. In castor, overexpression of LPAT2 can increase the content of ricinoleic acid. Overexpression of rapeseed BnLPAT2 and BnLPAT5 significantly increased the oil content of rapeseed seeds. However, so far, there has been no report on the function of the LPAT gene family in soybean root development. Summary of the invention
[0004] The purpose of the present invention is to disclose the genetic engineering application of soybean lysophosphatidic acid acyltransferase LPAT4 encoding gene GmRGD14 for improving soybean root mass.
[0005] The purpose of the present invention can be achieved through the following technical solutions:
[0006] Application of soybean lysophosphatidic acid acyltransferase LPAT4 encoding gene GmRGD14 in genetic engineering transformation of soybean root system. The soybean lysophosphatidic acid acyltransferase LPAT4 encoding gene GmRGD14 has a coding region sequence as shown in SEQ ID NO.1 and an amino acid sequence as shown in SEQ ID NO.2.
[0007] The application of overexpressing soybean lysophosphatidic acid acyltransferase LPAT4 encoding gene GmRGD14 in constructing soybean varieties with developed root systems, wherein the coding region sequence of the soybean lysophosphatidic acid acyltransferase LPAT4 encoding gene GmRGD14 is shown in SEQ ID NO.1.
[0008] The application of overexpressing soybean lysophosphatidic acid acyltransferase LPAT4 encoding gene GmRGD14 in soybean tolerance to high salt and drought, the coding region sequence of the soybean lysophosphatidic acid acyltransferase LPAT4 encoding gene GmRGD14 is shown in SEQ ID NO.1.
[0009] The application of overexpressing soybean lysophosphatidic acid acyltransferase LPAT4 encoding gene GmRGD14 in constructing soybean varieties with developed root systems and tolerance to high salt and drought, wherein the coding region sequence of the soybean lysophosphatidic acid acyltransferase LPAT4 encoding gene GmRGD14 is shown in SEQ ID NO.1.
[0010] Beneficial Effects
[0011] GmRGD14 is a gene encoding lysophosphatidic acid acyltransferase LPAT4, which regulates soybean root development. Tissue expression analysis showed that GmRGD14 was expressed in soybean roots, stems, and leaves. Genetic transformation technology showed that the number of lateral roots of transgenic Arabidopsis thaliana overexpressing the GmRGD14 gene and the root mass of soybean hairy roots increased significantly. Therefore, GmRGD14 can be used as a target for regulating soybean root structure and for soybean root modification. BRIEF DESCRIPTION OF THE DRAWINGS
[0012] Figure 1 .Agarose gel electrophoresis of GmRGD14 clone. C081: Hengnan medicinal bean; C032: Jinlong black bean. M: DL2000 molecular marker. The full length of the target fragment is 1152bp.
[0013] Figure 2 .Tissue expression pattern of GmRGD14. Tubulin gene of soybean was used as internal reference gene. NJAU_C081: Hengnan medicinal bean; NJAU_C032: Jinlong black bean.
[0014] Figure 3. Molecular identification of Arabidopsis thaliana transformed with GmRGD14. (A) DNA detection; P: plasmid, WT: Col-0, H 2 O: water, OE#1 and OE#2 are Arabidopsis thaliana transformed with GmRGD14. (B) RT-qPCR detection, using the Arabidopsis thaliana Tubulin gene as the internal reference gene.
[0015] Figure 4 .GmRGD14 gene overexpression in Arabidopsis increases the number of lateral roots. (A) Wild-type and GmRGD14-transgenic Arabidopsis; Scale bar: 1 cm. (B) Number of lateral roots; (C) Main root length. WT: Col-0, OE#1 and OE#2 are GmRGD14-transgenic Arabidopsis. Two-tailed t-test was used for statistical analysis, and the numbers in the figure are P values.
[0016] Figure 5 .GmRGD14 gene overexpression improves Arabidopsis tolerance to high salt and drought stress. (A) High salt; (B and C) 150mM mannitol and 300mM mannitol simulated drought. The left side of each figure is the main root length, and the right side is the number of lateral roots. WT: Col-0, OE#1 and OE#2 are Arabidopsis transgenic with GmRGD14. Two-tailed t test was used for statistical analysis. *, **, *** are significant at the 0.05, 0.01, and 0.001 levels, respectively.
[0017] Figure 6 Quantitative detection of the GmRGD14 gene in transgenic soybean hairy roots. The soybean Tubulin gene was used as an internal reference gene. OE-EV: hairy roots without vector, OE-GmRGD14: hairy roots transfected with GmRGD14. Two-tailed t-test was used for statistical analysis, and the numbers in the figure are P values.
[0018] Figure 7 .GmRGD14 gene overexpression increases root mass in soybean hairy roots. (A) Soybean hairy roots of empty vector control; (B) Soybean hairy roots of GmRGD14 gene; Scale bar: 1 cm. (C) Total root length; (D) Total root surface area; (E) Number of root tips; (F) Root volume; (G) Root fresh weight; (H) Root dry weight. OE-EV: hairy roots of empty vector, OE-GmRGD14: hairy roots of GmRGD14 gene. Numbers in the figure are P values, and two-tailed t test was used for statistical analysis. DETAILED DESCRIPTION
[0019] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.
[0020] Unless otherwise specified, the methods used in the following examples are all conventional methods.
[0021] Example 1 Expression pattern of soybean GmRGD14 gene
[0022] 1) Cloning of soybean GmRGD14 gene
[0023] Total RNA was extracted from the roots of soybean varieties Jinlong black bean and Hengnan medicinal bean using a total RNA extraction kit (Total RNA Kit, Tiangen). Total RNA was used as a template and reverse transcription was performed according to the instructions of the reverse transcription kit (HiScript III 1st Strand cDNA Synthesis Kit, Vazyme, Nanjing, R123-01) to obtain the first strand of cDNA. Primers were designed based on the mRNA (Glyma.14G077500) sequence of GmRGD14 in the soybean reference genome Williams 82v2.1. Genes were amplified from the cDNA in the root tissues of Jinlong black bean and Hengnan medicinal bean by PCR reaction. The PCR program was as follows: 95℃ pre-denaturation for 30 seconds, 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 1 minute and 45 seconds, a total of 35 cycles, and finally 72℃ incubation for 5 minutes. The PCR product was sequenced to obtain the CDS sequence of the GmRGD14 gene with a complete coding region, wherein the coding region sequence is shown in SEQ ID NO.1, with a length of 1152 bp ( Figure 1 ). The amino acid sequence is shown in SEQ ID NO.2, with a length of 383 amino acids. The primer sequences for amplifying the gene are F: AAGGGAAGTTTTTTCAACAGGTTC; R: GTAAATGATCCCTTCGATTTCCT.
[0024] 2) Tissue expression of GmRGD14 gene in soybean
[0025] Soybean varieties Jinlong black beans and Hengnan medicinal beans were used as materials. Seeds that were plump, spot-free, and uniform in size were selected and sown in vermiculite. Four days after sowing, seedlings with uniform growth were selected and placed in 1 / 2 Hoagland nutrient solution for hydroponics. The nutrient solution was replaced every 5 days. After 15 days of hydroponic treatment, the root, stem, and leaf tissues of soybeans were quickly frozen in liquid nitrogen and stored. The total RNA of the tissues was extracted and reversed into cDNA, and RT-qPCR reactions were performed to detect the expression level of the GmRGD14 gene in each tissue. After the reaction, data analysis was processed using ABI 7500system Sequence Detection System (SDS) software v.1.4, and the tissue relative expression level of the target gene was calculated using 2 -ΔΔCTThe calculation was performed by the method, and the soybean Tubulin (Glyma.03G124400) gene was selected as the internal reference gene for correction and standardization of expression, and the expression level in stem tissue was 1. The primer sequences for GmRGD14 fluorescence quantitative analysis were F: TGTCTCTGTGGCCCTCACTA and R: CCACTTCCTCTCCACTGCAA, and the soybean gene Tubulin (Glyma.03g124400) was used as the internal reference, and the primer sequences were F: ggagttcacagaggcagaga and R: cacttacgcatcacatagca. The results showed that GmRGD14 was expressed in the roots, stems, and leaves of both materials ( Figure 2 ).
[0026] Example 2 Genetic Engineering Application of Gene GmRGD14
[0027] 1) Overexpression of the GmRGD14 gene increases the number of lateral roots in Arabidopsis
[0028] Using pBA002 as a vector, specific primers were designed to amplify the ORF of the GmRGD14 gene from the root cDNA of soybean variety Jinlong Black Bean by PCR reaction. The primer sequence is F: CGCGCCGGGCCCAGGCCTACGCGT ATGGAAGTTTGCGAGCCAGT and R: ATCGGGGAAATTCGAGCTC CTATTCACTCTTTTGATTCT, a plant expression vector pBA002-GmRGD14 containing the GmRGD14 gene was constructed by homologous recombination. The plant expression vector pBA002 contains the herbicide (phosphinothricin) resistance gene Bar, and a 2x35S strong promoter drives the expression of the target gene GmRGD14 in the receptor. The vector was then transferred into the Agrobacterium tumefaciens strain EHA105 by the freeze-thaw method.
[0029] Arabidopsis thaliana was transformed by the floral method. The wild-type Col-0 Arabidopsis thaliana flower buds were immersed in the bacterial solution of Agrobacterium tumefaciens strain EHA105 containing pBA002-GmRGD14 in step 1) for 30 seconds to 1 minute. The plants were wrapped with plastic wrap or a fresh-keeping bag to maintain humidity and cultured in the dark for 24 hours. After that, the plants could be transformed again after a new batch of inflorescences grew out, depending on their growth. Arabidopsis thaliana was placed under normal conditions to continue growing and the seeds were harvested. The wild-type and two T 2 The phenotypes of the two GmRGD14-OE / Col-0 transgenic Arabidopsis lines (OE#1 and OE#2) were identified. PCR and real-time fluorescence quantitative qPCR were performed using specific primers to detect the two overexpression Arabidopsis lines. The results showed that the GmRGD14 gene had been transferred into Arabidopsis Col-0 and successfully expressed ( Figure 3). The GmRGD14 gene DNA detection primers are the same as the overexpression vector construction primers. The Arabidopsis thaliana internal reference Tubulin (At5g62690) fluorescence quantitative primer sequences are F: ctcaagaggttctcagcagta and R: tcaccttcttcatccgcagtt. The GmRGD14 gene fluorescence quantitative primer sequence is the same as above.
[0030] The seeds of Arabidopsis wild type and GmRGD14 gene overexpression lines OE#1 and OE#2 were sterilized with chlorine and sown on the culture medium. The wild type seeds were sown on MS culture medium, and the overexpression line Arabidopsis seeds were sown on MS culture medium containing glufosinate. The culture dish sown with Arabidopsis was first placed in a 4°C refrigerator for vernalization for 2 days, and then moved into a light incubator with a 16h light / 8h dark photoperiod and a temperature of 22°C for vertical culture. After 5 days, 5 strains of wild type and overexpression lines with consistent growth were selected and transferred to the same MS culture medium for vertical culture. Each culture dish contained the offspring of the wild type and an overexpression line. One culture dish was a replicate, and 6 replicates were set. After 10 days of culture, the taproot length and lateral root number of Arabidopsis were investigated. Compared with the wild type Col-0, the lateral root number of the overexpression lines OE#1 and OE#2 increased by about 50% and 56%, respectively, both reaching significant differences, and the taproot length was not significantly different from the wild type ( Figure 4 ). Therefore, it is speculated that the GmRGD14 gene may positively regulate the growth and development of lateral roots in Arabidopsis.
[0031] 2) Overexpression of the GmRGD14 gene increases Arabidopsis tolerance to drought and high salt
[0032] Well-developed roots play an important role in plant adaptation to stress environments. 1 The GmRGD14 gene overexpressing Arabidopsis strains and wild-type controls were used as materials to further evaluate the role of the GmRGD14 gene in plant tolerance to drought and high salt. Arabidopsis seeds were sterilized with chlorine and sown on culture medium, and wild-type seeds were sown on MS culture medium for 2 T 1 The seeds of the overexpression Arabidopsis thaliana were sown on MS medium containing glufosinate ammonium, and the culture dishes were placed vertically in a 22°C light incubator for culture. Five days later, five Arabidopsis wild-type and overexpression seedlings with consistent growth were selected and transferred to the same MS medium (control), high salt stress MS medium (150mM NaCl), and drought stress MS medium (150mM mannitol, 300mM mannitol) for continued vertical culture. Six replicates were set for each treatment. After 10 days of culture, the taproot length and lateral root number of Arabidopsis thaliana were investigated. The ratio of stress treatment to control (relative taproot length and relative lateral root number) was used as an indicator to evaluate the tolerance of Arabidopsis thaliana to various stresses.
[0033] High salt stress and drought stress will inhibit the elongation of the main root of the plant and reduce the number of lateral roots. In this study, under high salt stress and drought stress, the relative main root length and relative lateral root number of the two overexpression lines were significantly or extremely significantly higher than those of the wild type ( Figure 5 ). These results indicate that overexpression of the GmRGD14 gene in Arabidopsis can also enhance the tolerance of Arabidopsis to salt stress and drought stress.
[0034] 3) Overexpression of the GmRGD14 gene increases the root mass of soybean hairy roots
[0035] Using pMDC83 as a vector, specific primers were designed, and the ORF of the GmRGD14 gene was amplified from the root cDNA of the soybean variety Jinlong Black Bean by PCR reaction. The primer sequences were F: CAGGTCGACTCTAGAGGATCCGCCACCTGGAAGTTTGCGAGCCAGT and R: GGGAAATTCGAGCTCGGTACCCTATTCACTCTTTTGATTCT. The plant expression vector pMDC83-GmRGD14 containing the GmRGD14 gene was constructed by homologous recombination. The plant transformation vector pMDC83 carries the green fluorescent protein gene GFP, and the 2x35S strong promoter drives the expression of the target gene. The vector was then transferred into the rhizogenes Agrobacterium rhizogenes strain K599 by the freeze-thaw method. At the same time, the empty pMDC83 was also transformed into K599 as an empty control.
[0036] The back of the cotyledons of soybean seedlings grown for 5 days was wounded, and then the root-inducing Agrobacterium strain K599 containing pMDC83-GmRGD14 and an empty control was inoculated into the wound on the back of the soybean cotyledons, and the inoculated cotyledons were placed in White medium containing 500μg / mL carboxybenzene and 50μg / mL cephalosporin. After 3-4 weeks of dark culture at 25℃, hairy roots will grow from the wound on the back of the cotyledons. The overexpressed hairy roots are called overexpressed hairy roots OE-GmRGD14, and the empty control is OE-EV. Since the vector carries the GFP gene, non-luminous hairy roots are extracted by fluorescent irradiation, and the luminous hairy roots are retained for further positive detection and phenotypic investigation. Real-time fluorescence quantitative qPCR was used to detect the expression level of the target gene GmRGD14. The results showed that compared with the control (OE-EV), the expression level of the GmRGD14 gene in OE-GmRGD14 was increased ( Figure 6 ). The sequences of fluorescent quantitative primers for GmRGD14 and soybean internal reference Tubulin are the same as above. Phenotypic identification showed that the total root length, root surface area, number of root tips, root volume, root fresh weight and root dry weight of overexpressed soybean hairy roots (OE-GmRGD14) were significantly higher than those of the control (OE-EV), indicating that GmRGD14 overexpression increased the root mass of transgenic hairy roots ( Figure 7). These results indicate that overexpression of the GmRGD14 gene promotes root development in soybean, which is consistent with the results of its overexpression in Arabidopsis.
Claims
1. Application of soybean lysophosphatidic acid acyltransferase LPAT4 encoding gene GmRGD14 in genetic engineering to modify soybean root system.
2. Application of overexpression of soybean lysophosphatidic acid acyltransferase LPAT4 encoding gene GmRGD14 in constructing soybean varieties with developed root systems. The coding region sequence of the soybean lysophosphatidic acid acyltransferase LPAT4 encoding gene GmRGD14 is shown in SEQ ID NO.
1.
3. Application of overexpression of soybean lysophosphatidic acid acyltransferase LPAT4 encoding gene GmRGD14 in soybean tolerance to high salt and drought. The coding region sequence of the soybean lysophosphatidic acid acyltransferase LPAT4 encoding gene GmRGD14 is shown in SEQ ID NO.
1.
4. Application of overexpression of soybean lysophosphatidic acid acyltransferase LPAT4 encoding gene GmRGD14 in constructing soybean varieties with developed root systems and tolerance to high salt and drought. The coding region sequence of the soybean lysophosphatidic acid acyltransferase LPAT4 encoding gene GmRGD14 is shown in SEQ ID NO.1.