Cloning and application of corn kernel size gene ZmTRX1

Abstract

The invention discloses a protein ZmTRX1 related to corn kernel development and application thereof, and mainly solves the genetic mechanism of corn kernel development. Specifically disclosed are applications of a protein, a substance for regulating and controlling expression of a coding gene of the protein or a substance for regulating and controlling activity or content of the protein in regulating and controlling the plant grain size and / or preparing a product for regulating and controlling the plant grain size and / or plant breeding and / or preparing a plant breeding product. The protein is shown as a sequence 3 in the sequence table. The corn histone methyltransferase gene ZmTRX1 is found and cloned, EMS mutant plants of the two ZmTRX1 genes are prepared, and the gene mutation causes abnormal development of corn kernels, which shows that the kernels become small and the hundred-kernel weight is obviously reduced. According to the invention, a new clue is provided for researching the genetic characteristics of corn kernel development, the deep research on the molecular mechanism of corn kernel development is promoted, and a new gene resource is provided for improving the kernel size and the crop yield.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering and relates to the cloning and application of a corn kernel size gene ZmTRX1. Background Art

[0002] Corn (Zea mays) is an important global food crop with extremely high economic and ecological value. Its kernels contain 70% starch, 10% protein, and 4% oil. These components not only provide key nutrients for seed germination and early seedling growth, but also provide the main source of raw materials for animal feed and ethanol production. Kernel development is a complex biological process that is affected by multiple genetic and environmental factors. The kernel development process is directly related to yield and quality. The key to studying corn kernel size and composition is to deeply understand its development mechanism, thereby improving yield and quality, which is crucial for food security and sustainable agricultural development.

[0003] When the embryo of corn begins to form its initial structure, the endosperm also develops to provide the embryo with essential nutrients. During embryonic development, cell division and expansion promote the formation of roots, stems, and leaves. The endosperm is the part of the corn kernel responsible for storing nutrients and is essential for the growth of the entire kernel. During the endosperm development stage, endosperm cells proliferate rapidly and accumulate energy storage substances such as starch, protein, and fat. During the kernel expansion stage, with the rapid growth of the endosperm, the kernel volume increases significantly, and the cells continue to expand and differentiate. The kernel expands rapidly under the conditions of sufficient water and nutrients, and eventually forms a complete kernel structure. When entering the maturity stage, the nutrient supply of the endosperm gradually decreases, and the moisture content of the kernel decreases, usually below 30%. During this process, the endosperm gradually dries and the epidermis hardens, marking the beginning of kernel maturity. The color of mature kernels usually becomes darker and the shell becomes harder.

[0004] The development of corn kernels involves three key processes: embryonic development, endosperm cell differentiation, and accumulation of storage substances, all of which are regulated by numerous genes. Corn kernel mutants are roughly divided into the following categories according to the location of the defect: embryo defect mutants, endosperm defect mutants, embryo and endosperm abnormal mutants, and ear sprouting mutants. Among them, embryo and endosperm abnormal mutants include: small kernel, defective kernel, and empty percarp. At present, researchers have cloned many genes related to kernel development. For example, several genes that control corn kernel development and their biological effects have been identified, such as ZmPPR protein that reduces kernel weight by affecting photosynthesis; ZmEXPB15 controls kernel size and weight by interacting with ZmNAC11 / 29 to promote nuclear cell elimination. In addition, genes that control kernel development, ZmGRAS11, opaque2, Smk11, crk2, dek, HSP90.6, and TaDA1, have been revealed. Therefore, it is crucial to reveal the genetic basis of genes controlling maize kernel size and weight and to gain a deeper understanding of the molecular mechanisms behind yield-related traits. Summary of the invention

[0005] The purpose of the invention is to provide a protein related to corn kernel size and its encoding gene and application.

[0006] The present invention firstly protects the application of ZmTRX1 protein, which can be divided into S1) or S2):

[0007] S1) Regulates plant seed size;

[0008] S2) Cultivating transgenic plants with altered grain size.

[0009] In the above application, the ZmTRX1 protein is derived from Zea mays L. of the genus Zea and is the following a1) or a2) or a3):

[0010] a1) the amino acid sequence is the protein shown in SEQ ID NO: 3;

[0011] a2) a fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in SEQ ID NO: 3;

[0012] a3) A protein associated with plant seed size obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 3.

[0013] Among them, SEQ ID NO: 3 consists of 1025 amino acid residues.

[0014] In order to facilitate purification of the protein in a1), a tag as shown in Table 1 may be connected to the amino terminus or carboxyl terminus of the protein shown in SEQ ID NO: 3.

[0015] Table 1. Sequences of tags

[0016] Label Residue sequence Poly-Arg 5-6 (usually 5) RRRRR FLAG 8 DYKDDDDK Strep-tag II 8 WSHQ c-myc 10 EQKLISEEDL

[0017] In the protein described in a3) above, the substitution and / or deletion and / or addition of one or several amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0018] The protein in a3) above can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0019] The coding gene of the protein in a3) above can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in SEQ ID NO: 2, and / or performing missense mutation of one or several base pairs, and / or connecting the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.

[0020] The present invention also protects the use of nucleic acid molecules encoding the ZmTRX1 protein, which can be S1) or S2):

[0021] S1) Regulates plant seed size;

[0022] S2) Cultivating transgenic plants with altered grain size.

[0023] In the above application, the nucleic acid molecule encoding the ZmTRX1 protein may be a DNA molecule as shown in b1) or b2) or b3) or b4) or b5) below:

[0024] b1) the coding region is the DNA molecule shown in SEQ ID NO: 2;

[0025] b2) the nucleotide sequence is the DNA molecule shown in SEQ ID NO: 2;

[0026] b3) the nucleotide sequence is the DNA molecule shown in SEQ ID NO: 1;

[0027] b4) a DNA molecule that has 75% or more identity with the nucleotide sequence defined in b1) or b2) or b3) and encodes the TRX1 protein;

[0028] b5) A DNA molecule that hybridizes with the nucleotide sequence defined in b1) or b2) or b3) under stringent conditions and encodes the ZmTRX1 protein.

[0029] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0030] Wherein, SEQ ID NO: 2 consists of 3078 nucleotides, and the nucleotides of SEQ ID NO: 2 encode the amino acid sequence shown in SEQ ID NO: 3.

[0031] A person skilled in the art can easily mutate the nucleotide sequence encoding the ZmTRX1 protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of the ZmTRX1 protein isolated from the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the ZmTRX1 protein.

[0032] The term "identity" as used herein refers to sequence similarity with a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of the present invention encoding the ZmTRX1 protein consisting of the amino acid sequence shown in SEQ ID NO: 3. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0033] In any of the above applications, regulating the plant grain size may be increasing the grain size or decreasing the grain size.

[0034] In any of the above applications, the cultivation of transgenic plants with altered grain size may be cultivation of transgenic plants with increased grain size or cultivation of transgenic plants with reduced grain size.

[0035] The present invention also protects a method for cultivating transgenic plants, which may include the following steps: reducing the expression level and / or activity of the ZmTRX1 protein in the starting plant to obtain a transgenic plant; compared with the starting plant, the grain size of the transgenic plant becomes smaller.

[0036] In the above method, the "reducing the expression level and / or activity of the ZmTRX1 protein in the starting plant" can be achieved by methods well known in the art such as RNA interference, homologous recombination, and gene site editing to reduce the expression level and / or activity of the ZmTRX1 protein in the starting plant.

[0037] In the above method, the “reducing the expression level and / or activity of the ZmTRX1 protein in the starting plant” can be specifically achieved by introducing a plant genome editing vector into the starting plant;

[0038] The plant genome editing vector contains a sgRNA encoding gene;

[0039] The target DNA recognized by the sgRNA in the plant is a DNA fragment encoding the ZmTRX1 protein.

[0040] In the above method, the plant genome editing vector may also contain a gene encoding the Cas9 protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 The domain structure and phylogenetic analysis of ZmTRX1. A is the protein structure diagram of maize ZmTRX1. B is the phylogenetic tree analysis of TRX1 proteins in representative plants. Maize (Zm; Zea mays); Arabidopsis thaliana (At; Arabidopsis thaliana); Rice (Os; Oryza sativa); Sorghum bicolor (Sb); Millet (Si; Setaria italica); Brachypodium distachyon (Bd); Populus trichocarpa (Pt; Populus trichocarpa).

[0042] Figure 2 Schematic diagram of the mutation sites in the EMS mutant materials trx1-1 (left) and trx1-2 (right) of maize ZmTRX1.

[0043] Figure 3 The phenotypic comparison diagram of the mutants trx1-1, trx1-2 and wild type of maize ZmTRX1. Among them, A to B are self-pollinated ears of trx1-1 / + (A) and trx1-2 / + (B). Mutant seeds are indicated by arrows. Bar = 1 cm. C is a phenotypic comparison of mature grains of wild-type WT, mutant trx1-1 and mutant trx1-2. Bar = 1 cm. D is the measurement of 100-grain weight of mature grains in wild-type WT, mutant trx1-1 and mutant trx1-2. Error bars represent ±SD (n = 50 for each ear). Three independent measurements were performed using different ears, ***P < 0.001, Student's t test. DETAILED DESCRIPTION

[0044] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0045] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0046] The following examples used EXCEL statistical software to process the data, and the experimental results were expressed as average values ​​and tested using T-test. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates an extremely significant difference, and P < 0.001 (***) indicates an extremely significant difference.

[0047] The B73 mutant involved in the present invention is available in the maize EMS-induced mutant library (http: / / maizeems.qlnu.edu.cn / ).

[0048] The maize ZmTRX1 mutants trx1-1 and trx1-2 were collected and preserved in our laboratory.

[0049] Maize genome sequencing information is available in the MaizeGDB database, the link to which is as follows: http: / / www.maizegdb.org / .

[0050] Example 1: Cloning, domain structure and phylogenetic analysis of ZmTRX1 gene

[0051] 1. The CDS sequence of the ZmTRX1 gene in corn was cloned. The length of the target band detected by electrophoresis was about 3000bp, which was consistent with the CDS sequence length of 3078bp retrieved from the corn genome annotation database MaizeGDB. It was preliminarily determined that the target gene was obtained. The sequencing results showed that the sequence was consistent with the CDS sequence of the ZmTRX1 gene (Zm00001d019907) queried on MaizeGDB. After querying the MaizeGDB database, it was learned that the ZmTRX1 gene was located on chromosome 7 of corn, including 24 exons, which can encode 1025 amino acids. The protein structure and function were predicted by SMART (http: / / smart.embl-heidelberg.de / ). The results showed that ZmTRX1 had a conserved histone methyltransferase domain located at the C-terminus, 2 histone H3 binding domains, and 1 DNA binding domain, etc. ( Figure 1 A), indicating that this gene encodes a protein involved in establishing histone modifications.

[0052] 2. Using the NCBI (https: / / www.ncbi.nlm.nih.gov / ) database, the maize ZmTRX1 protein XP_008651793 was compared with homologous proteins from seven species, including Arabidopsis thaliana (At); rice (Os); Sorghum bicolor (Sb); millet (Si); Brachypodium distachyon (Bd); and poplar (Pt); Populus trichocarpa, to perform phylogenetic tree analysis. The ClustaW method of MEGA11 was used to perform multiple sequence alignment on the nine proteins, and then the neighbor-joining method was used to construct the phylogenetic tree. The results are shown in the figure ( Figure 1 B), the maize ZmTRX1 protein is most closely related to sorghum SbTRX1, with an amino acid sequence similarity of 92.68%, and is relatively distantly related to dicotyledonous plants such as rice and Arabidopsis.

[0053] Example 2: Construction of mutant material of gene ZmTRX1

[0054] Two independent EMS mutants of Zm00001d019907 gene in B73 background were obtained from the maize EMS-induced mutant library (http: / / maizeems.qlnu.edu.cn / ). The mutants were sold by the mutant library MEMD and are available to the public. From the MEMD website, we know that the mutation site of the mutant EMS4-0972b6 is located in the 13th exon of ZmTRX1, causing the base G at 1790bp of the CDS sequence to mutate to A, resulting in a change in the encoded protein from Gly to Asp, leading to abnormal function of the gene. The sanger sequencing results verified that the mutation site was consistent with the description; the mutation site of the mutant EMS4-09728f occurred in the 24th exon, located at 2956bp of the CDS sequence, causing the base C to mutate to T, causing the encoded protein to terminate translation prematurely, resulting in loss of function of the gene. The sanger sequencing results were consistent with the description ( Figure 2 ). The EMS4-0972b6 and EMS4-09728f mutant materials obtained above were backcrossed with wild-type corn B73 materials, and BC3F1 generation seeds were obtained by backcrossing for three generations, and then self-pollinated once to obtain BC3F2 generation seeds, and the seeds were retained.

[0055] Primer sequences:

[0056] Sequencing primers for ZmTRX1 mutant EMS4-0972b6:

[0057] ZmTRX1-EMS(b6)-F:GATCTGGACTATTGCAATGTTTG

[0058] ZmTRX1-EMS(b6)-R:CCATATAGCACATGCGAGATG

[0059] Sequencing primers for ZmTRX1 mutant EMS4-09728f:

[0060] ZmTRX1-EMS(8f)-F:AGCTGTCAGCCGATGAGTATC

[0061] ZmTRX1-EMS(8f)-R:CCTCGGATCGAACCAGCCTA

[0062] Example 3: Functional verification of gene ZmTRX1

[0063] The homozygous mutants of EMS4-0972b6 and EMS4-09728f of the constructed ZmTRX1 gene were named trx1-1 and trx1-2, respectively. After self-pollination of the heterozygous plants trx1-1 / + and trx1-2 / +, BC3F2 seeds were obtained. By observing the phenotypes of the ears and mature grains, it was found that compared with normal corn grains, trx1-1 and trx1-2 showed abnormal grain development ( Figure 3 A to 3C), the grains of trx1-1 were significantly smaller, and the phenotype of trx1-2 was more severe, with the grains becoming shrunken. The 100-grain weight of the two types of mutants was only 64% and 19% of that of the wild type, respectively ( Figure 3 D). The phenotype of this phenomenon was consistent in Beijing and Hainan for three consecutive years. The mutation of ZmTRX1 significantly affected the development of kernels, indicating that the gene ZmTRX1 is involved in regulating the development of maize kernels.

[0064] Based on the research results of the above embodiments, it can be seen that the ZmTRX1 gene in the present invention is a gene that controls the development of corn kernels, and its mutation can lead to abnormal development of corn kernels, which can be used in the corn seed production process.

Claims

1. Application of ZmTRX1 protein, for S1) or S2): S1) Regulates plant seed size; S2) Cultivating transgenic plants with altered grain size.

2. The use according to claim 1, characterized in that: The ZmTRX1 protein is a1) or a2) or a3): a1) the amino acid sequence is the protein shown in SEQ ID NO: 3; a2) a fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in SEQ ID NO: 3; a3) A protein associated with grain size obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO:

3.

3. Use of a nucleic acid molecule encoding the ZmTRX1 protein according to claim 1 or 2, which is S1) or S2): S1) Regulates plant seed size; S2) Cultivating transgenic plants with altered grain size.

4. The use according to claim 3, characterized in that: The nucleic acid molecule encoding the ZmTRX1 protein is a DNA molecule as shown in b1) or b2) or b3) or b4) or b5) below: b1) the coding region is the DNA molecule shown in SEQ ID NO: 2; b2) the nucleotide sequence is the DNA molecule shown in SEQ ID NO: 2; b3) the nucleotide sequence is the DNA molecule shown in SEQ ID NO: 1; b4) a DNA molecule having 75% or more identity with the nucleotide sequence defined in b1) or b2) or b3) and encoding the ZmTRX1 protein of claim 1 or 2; b5) A DNA molecule that hybridizes with the nucleotide sequence defined in b1) or b2) or b3) under stringent conditions and encodes the ZmTRX1 protein of claim 1 or 2.

5. The use according to any one of claims 1 to 4, characterized in that: The regulating plant grain size may be increasing the grain size or decreasing the grain size; The cultivating of transgenic plants with altered grain size can be cultivating transgenic plants with increased grain size or cultivating transgenic plants with reduced grain size.

6. A method for cultivating transgenic plants, comprising the following steps: reducing the expression level and / or activity of the ZmTRX1 protein of claim 1 or 2 in a starting plant to obtain a transgenic plant; compared with the starting plant, the grain size of the transgenic plant becomes smaller.

7. A plant breeding method, comprising the following steps: reducing the expression level and / or activity of the ZmTRX1 protein of claim 1 or 2 in a starting plant, thereby reducing the grain size.

8. The use according to any one of claims 1 to 5 or the method according to any one of claim 6, characterized in that: The plant is any one of the following c1) to c6): c1) dicotyledonous plant; c2) monocotyledonous plant; c3) grass plant; c4) corn; c5) corn B104; c6) corn variety B73.

Images