Application of KCNQ4 in liver cancer diagnostic kit and targeted drug development

Abstract

The invention discloses application of KCNQ4 as a liver cancer diagnostic kit and in targeted drug development, and belongs to the field of biological medicine. Statistical analysis is carried out on the expression quantity of the KCNQ4 gene in liver cancer and normal liver tissues of a liver cancer patient in a TCGA database, and it is found that the expression quantity of the KCNQ4 gene in the liver cancer tissues is obviously higher than that of the KCNQ4 gene in the normal tissues. Secondly, an expression vector for interfering the KCNQ4 gene is utilized, and a large number of in-vitro cell experiments prove that interference on the expression level of the KCNQ4 gene can play a role in inhibiting proliferation and migration of liver cancer cells. The mRNA level of the genes CDK1 and CDK2 related to cell proliferation is inhibited, and it is proved from the molecular level of the genes that KCNQ4 can promote the occurrence of liver cancer, which prompts that KCNQ4 has good application in preparation of liver cancer diagnostic kits and targeted therapeutic drugs.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of KCNQ4 as a biomarker for liver cancer diagnosis, in diagnostic kits and in the development of targeted drugs. Background Art

[0002] Cancer is a major global public health problem that seriously threatens human health, and its morbidity and mortality rates are increasing. It is urgent to find new diagnostic markers and therapeutic targets for cancer.

[0003] Liver cancer is a global health challenge, and its incidence is increasing worldwide. Liver cancer is the sixth most common malignancy in the world and the third leading cause of cancer death. It is estimated that by 2025, more than 1 million people will be affected by liver cancer each year. Hepatocellular carcinoma (HCC), the main histological type of liver cancer, is the cause of 75% to 85% of primary liver cancer cases. Most HCC patients are already in the advanced stage when they are first diagnosed, so the survival rate is very low. At the same time, the treatment methods for liver cancer are limited, and the molecular mechanisms of liver cancer are still poorly understood. Despite the use of innovative treatment strategies, the survival rate of patients remains low. Therefore, it is crucial to find sensitive and effective biomarkers to clarify the specific mechanisms of liver cancer occurrence, invasion and metastasis, and ultimately achieve an improvement in the survival rate of liver cancer patients, which is crucial for early diagnosis of liver cancer patients and the development of new treatment methods.

[0004] The KCNQ family of voltage-gated potassium channels (Kv7) includes five members (Kv7.1–Kv7.5) that play important roles in the brain, heart, kidney, and inner ear. In particular, KCNQ channels consist of a K+ channel pore-forming subunit (α subunit) with six transmembrane domains (S1-S6) and a pore loop (P loop) as well as two intracellular terminals. Functional KCNQ channels assemble in homotetramers or heterotetramers of pore-forming subunits. These proteins show 30%-65% amino acid identity, with particularly high homology in the transmembrane regions. The S4 transmembrane domain contains regularly distributed positively charged amino acids that act as a voltage sensor, while the P loop contains the K + The characteristic sequence of the pore is TxxTxGYG. The N-terminal length is about 100 amino acids, which is similar among the five subtypes, while the C-terminal length varies greatly among different subtypes. All five proteins show a highly homologous region at their intracellular C-termini, called the "A domain". Kv7 channels are widely distributed in the nervous system, cardiomyocytes, and smooth muscle cells, play an important role in controlling cell excitability, and are related to a variety of cardiovascular physiological processes and pathological conditions.

[0005] All five Kv7 members are mapped to the corresponding sites of human diseases, and mutations in KCNQ genes have been shown to cause hereditary diseases. Specifically, studies have reported that KCNQ1 mutations can cause heart disease, including long QT syndrome (LQTS) and Jervell-Lange-Nielsen syndrome in autosomal dominant and recessive ways, respectively. KCNQ2 mutations can cause autosomal dominant benign familial neonatal epilepsy. KCNQ3 mutations have also been shown to cause autosomal dominant benign neonatal epilepsy. KCNQ4 was originally thought to play an important role in regulating neuronal excitability. In recent years, studies have reported that KCNQ4 plays a role in a variety of malignant tumors. In breast cancer, the long noncoding RNA BC069792 sponge can adsorb miR-658 and miR-4739, upregulate the expression of the transmembrane protein KCNQ4, thereby inhibiting AKT phosphorylation and inhibiting the proliferation and migration of breast cancer. In prostate cancer, overexpression of KCNQ4 leads to a shortened time to recurrence, and cg06885782 in KCNQ4 (within 1500 bases upstream of the KCNQ4 transcription start site) is positively correlated with prostate cancer risk and negatively correlated with life expectancy. Overexpression of the KCNQ4 gene in liver cancer cells leads to poor prognosis, and its expression is positively correlated with immune infiltration.

[0006] Therefore, the present invention will detect the expression of KCNQ4 in liver cancer tissues, aiming to prepare a diagnostic kit, and on this basis study the effect of down-regulation of KCNQ4 expression on the proliferation and migration of liver cancer cells, which provides a favorable theoretical basis for improving the diagnosis rate of liver cancer and the survival of liver cancer patients. Summary of the invention

[0007] Purpose of the invention: In order to overcome the shortcomings of the above-mentioned prior art, one purpose of the present invention is to provide an application of KCNQ4 as a biomarker for liver cancer diagnosis to meet the use requirements of cancer diagnostic indicators. Another purpose of the present invention is to provide an application of KCNQ4 in the preparation of a cancer diagnostic kit, which is suitable for large-scale promotion and application.

[0008] Technical solution: In order to achieve the above-mentioned invention object, the technical solution adopted by the present invention is as follows:

[0009] (1) The role of the KCNQ4 gene (NCBI database, Gene ID: 9132) as a biomarker for cancer diagnosis. The cancer is liver cancer.

[0010] (2) Use of the KCNQ4 gene in the preparation of a diagnostic kit for detecting gastric cancer with abnormal KCNQ4 expression. The cancer is liver cancer. The drug is designed with the KCNQ4 gene as a target.

[0011] (3) The inhibitor of KCNQ4 gene is small interfering RNA si-KCNQ4, and its sequence is: 5'-GCAAACUCGGGUGGACCAATT-3'.

[0012] (4) After the KCNQ4 gene inhibitor is applied, its effectiveness is determined by detecting the changes in the KCNQ4 gene mRNA level in cells using 18S rRNA as the internal reference gene. The primer sequences are as follows: the forward primer of 18S is ATCACCATTATGCAGAATCCACG, and the reverse primer is GACCTGGCTGTATTTTCCATCC; the forward primer of KCNQ4 is CTGTCCACTATCCAGGAGCAC, and the reverse primer is CGAAAACCACGATCATCACGAA; the forward primer of CDK1 is AAACTACAGGTCAAGTGGTAGCC, and the reverse primer is TCCTGCATAAGCACATCCTGA; the forward primer of CDK2 is GTACCTCCCCTGGATGAAGAT, and the reverse primer is CGAAATCCGCTTGTTAGGGTC.

[0013] (5) Use of a KCNQ inhibitor in the preparation of a drug for treating cancer with abnormal KCNQ4 expression, wherein the cancer is liver cancer.

[0014] Beneficial effects: Compared with the existing technology, the present invention has confirmed through real-time fluorescence quantitative PCR that the expression of KCNQ4 in liver cancer is significantly higher than that in normal tissues adjacent to the cancer; the specific siRNA sequence is used to efficiently inhibit the expression of the KCNQ4 gene in human liver cancer cell lines, and experimental methods such as MTT, cell scratch and real-time fluorescence quantitative PCR have verified that reducing the expression of KCNQ4 can inhibit the proliferation and migration of liver cancer cells. It can be seen that KCNQ4 has a wide range of applications as a liver cancer biomarker and in the preparation of drugs for treating liver cancer and in cancer diagnostic kits. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 : Analysis of the difference in KCNQ4 expression between liver cancer tissues and normal tissues of liver cancer patients in the TCGA database.

[0016] Figure 2 :Real-time fluorescence quantitative PCR analysis; Changes in the mRNA level of KCNQ4 gene in cells after transfection of KCNQ4 interference vector (si-KCNQ4) in the liver cancer cell line HCC-LM3. 18S rRNA was used as the internal reference gene of KCNQ4.

[0017] Figure 3: After HCC-LM3 cells were transfected with si-KCNQ4, cell proliferation was measured by MTT colorimetry from 0 to 96 h.

[0018] Figure 4 : After HCC-LM3 cells were transfected with si-KCNQ4, the effect of knocking down KCNQ4 on cell migration was analyzed by cell wound healing assay at 0h, 24h, 48h, and 72h.

[0019] Figure 5 : Real-time fluorescence quantitative PCR analysis; A: Changes in the mRNA level of CDK1 gene in HCC-LM3 cells after transfection with si-KCNQ4 for 48 hours; B: Changes in the mRNA level of CDK2 gene in HCC-LM3 cells after transfection with si-KCNQ4 for 48 hours. DETAILED DESCRIPTION

[0020] The interference with the expression of the KCNQ4 gene described in the present invention is not limited to the sequence of siRNA, but also includes knocking out the coding gene of KCNQ4, interfering with the transcription or translation of the KCNQ4 gene and other biological processes. Although the specific mechanisms of interference are more and not yet fully understood, it does not hinder the realization of the "knockdown" effect.

[0021] In some specific embodiments, the drug may be added with one or more pharmaceutically acceptable adjuvants, including but not limited to granules, buffers, surfactants and other recognized pharmaceutical adjuvants.

[0022] In some specific embodiments, the drug can be prepared into dosage forms including but not limited to microinjections and dosage forms suitable for transfection, and these dosage forms can be prepared according to conventional methods in the pharmaceutical field.

[0023] The present invention is further described below by examples, including materials used and specific sources. However, it should be understood that these are exemplary only and are not intended to limit the present invention. Materials similar or identical to the types and models, or properties or functions of the following tissues, cells, reagents, and instruments can be used in the practice of the present invention.

[0024] The methods in the following examples are common methods unless otherwise specified.

[0025] Main Materials:

[0026]

[0027] Note: Unless otherwise specified, the reagents used in the present invention can be any suitable commercially available reagents; cell lines can be obtained commercially.

[0028] 1. Analysis of KCNQ4 expression differences between liver cancer and normal tissues of patients with liver cancer in the TCGA database

[0029] The Xena functional genomics browser was used to perform genomic statistical analysis on the mRNA expression of KCNQ4 in liver cancer tissues and normal tissues of liver cancer patient samples based on the online TCGA database, and the significant differences were calculated, including 36 normal tissue samples and 190 liver cancer tissue samples.

[0030] Results: Compared with the expression in normal liver tissue, the expression level of KCNQ4 in liver cancer tissue was significantly upregulated (P=0.0004). This indicates that KCNQ4 is highly expressed in liver cancer tissue and is a potential factor promoting liver cancer.

[0031] 2. Changes in mRNA levels in HCC-LM3 cells after KCNQ4 knockdown

[0032] 1. Cell Culture and Seeding

[0033] Human liver cancer cell line HCC-LM3 cells were cultured using DMEM complete medium. The complete medium contained 10% (V / V) fetal bovine serum (FBS), 1% (V / V) penicillin and streptomycin. The final concentration of penicillin was 100u / ml, and streptomycin was 0.1mg / ml. The cells were cultured in a 37°C incubator with 5% (V / V) CO2. The cells were cultured at 6.0×10 4 The cells were seeded at a concentration of 4.0×10 / mL in a 96-well cell culture plate, with 100 μL per well for MTT assay to determine cell proliferation. 5 The cells were seeded at a concentration of 1.5×10 / mL in a 24-well plate, with 500 μL per well, for cell scratch assay to determine cell migration ability; 5 The concentration of 100 μg / mL was seeded in a 6-well plate, 2 mL per well, for RNA extraction.

[0034] 2. siRNA Design

[0035] siRNA was constructed targeting the KCNQ4 gene sequence, and the si-KCNQ4 sequence was 5'-GCAAACUCGGGUGGACCAATT-3'.

[0036] 3. Cell Transfection

[0037] First, 1.5×10 5HCC-LM3 cells in good condition were seeded in a 6-well culture plate. After about 24 hours of seeding, the cells were transfected when they grew to a density of about 70%. si-KCNQ4 (50nM) and si-NC (50nM) universal negative controls were transfected. The transfection reagent used was Lipofectamine 8000. The transfection method was carried out according to the instructions. Before transfection of siRNA, the cell culture medium was replaced with an incomplete culture medium, and after 6-8 hours, it was replaced with a complete culture medium and continued to be cultured.

[0038] 4. RNA Extraction

[0039] After transfection, continue to culture cells for 48 hours, discard the culture medium, add 1mL Trizol reagent to lyse the cells, transfer the lysed cells to a 1.5mL centrifuge tube, add 100μL BCP solution for extraction, vortex mix for 15 seconds, let stand for 8 minutes, centrifuge at 4℃, 12000g for 15 minutes, take 500μL of supernatant solution to a new centrifuge tube, add 500μL isopropanol, let stand for 10 minutes, centrifuge at 4℃, 12000g for 10 minutes to obtain RNA precipitation. Aspirate the supernatant, add 500μL 75% (V / V) DEPC ethanol solution to wash RNA twice, discard the supernatant, and place it at room temperature for ventilation and air drying for 40 minutes. Add 15-30μL nuclease-free water according to the amount of RNA, and dissolve it in a 55℃ metal bath for 10 minutes. Use Nano Drop 2000 spectrophotometer to detect the concentration of RNA samples and OD260 and OD280 absorbance values. When A260 / A280 is between 1.8 and 2.0, the RNA sample is of good quality. The RNA sample is homogenized and centrifuged, and then stored at -80℃ for a long time.

[0040] 5. Reverse transcription of cDNA

[0041] Select the Vazyme reverse transcription kit, load 3000ng according to the RNA concentration, 20μM Oligo (dT) and random primers in 1μL amounts, add nuclease-free water to a total volume of 10μL in the corresponding PCR eight-row tube, mix and place in a PCR instrument for 65℃ reaction for 10min. Add 5×HiScript II Select qRTSuperMix and nuclease-free water according to the kit instructions and react at 50℃ for 15min, then react at 85℃ for 5sec. After the reaction is completed, store at -80℃.

[0042] 6. Detection of KCNQ4 gene mRNA levels in cells

[0043] cDNA was used as a template, and KCNQ4 upstream and downstream primers and 2×SYBR Select Master Mix were added for real-time fluorescence quantitative PCR. The control group samples were selected for gradient dilution as the standard curve. The reaction conditions were 50℃2min; 95℃10min, 95℃1s, 60℃1min, and repeated 40 cycles. Relative quantification was performed according to the standard curve, and the internal reference gene 18SrRNA was used for correction to compare the differences in KCNQ4 content between different samples. The 18S forward primer used was described in the sequence list ID NO: 1; the 18S reverse primer was described in the sequence list ID NO: 2; the KCNQ4 forward primer used was described in the sequence list ID NO: 3; and the KCNQ4 reverse primer was described in the sequence list ID NO: 4.

[0044] Results: Figure 2 As shown in the figure, the results of real-time fluorescence quantitative PCR showed that the mRNA level of KCNQ4 was knocked down by more than 80% in the si-KCNQ4 transfection group compared with the control group (P<0.0001), proving that si-KCNQ4 has been successfully transferred into the cells and caused a decrease in KCNQ4 content. This result shows that the expression level of KCNQ4 in liver cancer cells can be reduced by exogenous interference.

[0045] 3. Interfering with the KCNQ4 gene can inhibit the proliferation of liver cancer cells

[0046] HCC-LM3 cells were cultured at 1.5×10 5 Cells were seeded in 6-well culture plates at a density of 6×10 / mL, and si-KCNQ4 and si-NC universal negative control were transfected according to the method in Specific Implementation 2. Cells were collected 48 hours after transfection, and the two transfected cells were re-seeded in 96-well plates at a density of 6×10 3 / well, and 3 replicate wells were set for each transfection group. After the cells adhered to the wall, 10 μL of MTT solution (5 mg / mL) was added to each well, and the 96-well plate was placed in an incubator for 4 hours, and then dimethyl sulfoxide solution was added for extraction for 10 minutes, and the absorbance at 595 nm was measured with an enzyme marker. The detection was performed at 0h, 24h, 48h, 72h, and 96h after inoculation into the 96-well plate. The cell proliferation curve was drawn according to the measured OD value.

[0047] Results: Figure 3 Compared with the negative control group, after knocking down KCNQ4, the proliferation rate of HCC-LM3 cells gradually decreased. At 48h, the growth rate of cells in the si-KCNQ4 group and the NC group was statistically different (P < 0.001). At 72h, the growth rate of cells in the si-KCNQ4 group was significantly lower than that in the NC group (P < 0.001). This shows that knocking down KCNQ4 can effectively inhibit the proliferation of liver cancer cells HCC-LM3.

[0048] 4. Interfering with KCNQ4 can inhibit the migration ability of liver cancer cells

[0049] 1. Cell wound healing assay

[0050] HCC-LM3 cells were seeded in 24-well culture plates at 1×10 5 Before transfection, the cells were grown to a density of about 70%, and si-KCNQ4 and si-NC universal negative controls were transfected respectively. After 8 hours of transfection, fresh complete medium was replaced. After 48 hours of transfection, a 200μL sterile pipette tip was used to scratch the monolayer cells in a "cross" shape, and PBS was washed three times to remove the fallen cells, and complete medium was added to continue culturing the cells. Under a 4x microscope, a smooth scratch position was selected and marked, and a photo was taken as the 0h control, and then the culture dish was placed in the incubator for continued culture, and cell images at the same position were collected at 24h and 72h.

[0051] Results: Figure 4 As shown in the figure, the scratch healing rate of liver cancer cells in the transfected group after si-KCNQ4 transfection was significantly reduced at 24 hours compared with the negative control group; 72 hours after transfection, the scratch wounds of the NC group cells had completely healed, while the scratch wounds of the knockdown group cells had not yet completely healed, indicating that transfection of si-KCNQ4 can significantly inhibit the migration ability of gastric cancer cells.

[0052] 5. Interference with the KCNQ4 gene can inhibit the expression of proliferation-related genes in liver cancer cells

[0053] According to the method in Example 2, growing HCC-LM3 cells were seeded into 6-well plates, and transfection was performed after the cells adhered to the wall. The si-NC negative control group and the si-KCNQ4 interference group were set up. RNA was extracted 48 hours after transfection, the concentration was measured, and cDNA was reverse transcribed, and then Real-time PCR was performed. The internal reference gene 18S was used for correction, and the differences in the mRNA content of CDK1 and CDK2 between the two groups were compared. The 18S forward primer used is as described in the sequence list ID NO: 1; the 18S reverse primer is as described in the sequence list ID NO: 2, the CDK1 forward primer used is as described in the sequence list ID NO: 5; the CDK1 reverse primer is as described in the sequence list ID NO: 6, the CDK2 forward primer used is as described in the sequence list ID NO: 7; the CDK2 reverse primer is as described in the sequence list ID NO: 8.

[0054] Results: Figure 5-A, 5-B show that CDK1 and CDK2 are typical pro-proliferation genes. After transfection with si-KCNQ4, RNA was extracted, reverse transcribed, and real-time fluorescence quantitative PCR was performed. It was found that compared with the NC group, the mRNA levels of CDK1 and CDK2 in the si-KCNQ4 transfection group decreased significantly (P < 0.001). This indicates that knocking down KCNQ4 can inhibit the expression of pro-proliferation genes in liver cancer cells HCC-LM3.

[0055] Statistical analysis: All data were obtained by taking the average of three parallel independent experimental data and subjected to standard deviation analysis. P < 0.05 was considered statistically significant, denoted by *; P < 0.01 was denoted by **; P < 0.001 was denoted by ***; P < 0.0001 was denoted by ****.

[0056] The scope of protection claimed for the present invention is not limited to the description of the specific embodiments.

[0057] Sequence Listing

[0058]

Claims

1. Application of KCNQ4 as a biomarker or diagnostic kit for liver cancer diagnosis.

2. Application of KCNQ4 in the preparation of drugs for treating liver cancer with abnormal KCNQ4 expression.

3. The use according to claim 1 or 2, It is characterized in that All targets were designed based on KCNQ4.

4. The use according to claim 1, It is characterized in that The specific detection primer sequences of KCNQ4 are F: CTGTCCACTATCCAGGAGCAC; R: CGAAAACCACGATCATCACGAA.

5. The use according to claim 2, It is characterized in that The specific steps are as follows: (1) Construct a vector with KCNQ4 as the target gene; (2) Using the carrier in step (1), preparing a pharmaceutical preparation for in vitro use.

6. The use according to claim 5, It is characterized in that The inhibitor of KCNQ4 is KCNQ4-siRNA, and its sequence is 5'-GCAAACUCGGGUGGACCAATT-3'.

7. The use according to claim 5, It is characterized in that In addition to RNAi interference, vectors also include viral vectors or other non-viral gene silencing vectors.

8. The use according to claim 7, It is characterized in that The viral vector is an adenoviral vector, an adeno-associated viral vector, a retroviral vector or a herpes virus vector; the non-viral gene silencing vector is a CRISPR / Cas9 system gene knockout vector or a vector modified on the basis of RNAi silencing.

Images