Molecular markers related to cashmere diameter traits of Arbas cashmere goats and their application

Abstract

The present invention is applicable to the field of biotechnology, and provides a molecular marker related to the cashmere diameter trait of the Albas cashmere goat and its application, wherein the molecular marker includes at least one or several combinations of 17 SNP sites and 5 InDel sites located on chromosome 16 screened based on whole genome association analysis, and by detecting the molecular marker, the cashmere diameter trait of the cashmere goat can be predicted quickly, at low cost and effectively, which is of great significance in reducing the cashmere diameter and improving the quality of the wool. By using the above molecular markers, through molecular marker-assisted breeding, individuals with favorable genotypes are retained, and individuals with unfavorable genotypes are eliminated, so as to reduce the cashmere diameter of the group, thereby improving the fineness of the wool, achieving the purpose of improving the quality of the wool, and meeting market demand.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a molecular marker related to the cashmere diameter trait of Albas cashmere goats and an application thereof. Background Art

[0002] According to different geographical distributions, Inner Mongolia Cashmere Goats are divided into Arbas type, Erlangshan type and Alashan type. Among them, the Arbas type of Inner Mongolia Cashmere Goat is a branch of ancient Asian goats. The locals select them according to a unique way (red eyes, red nose, red buttocks, red mouth; white coat, white horns, white hooves; large body, long hair), forming a unique cashmere goat breed in the autonomous region. Its fine and white cashmere is an excellent textile raw material.

[0003] The domestic cashmere industry has experienced more than 30 years of rapid development. For a long time, cashmere goat breeders have been pursuing cashmere yields one-sidedly, using various high-yield breeds of sheep for hybridization and improvement to increase cashmere production, while ignoring seed conservation, cashmere refinement and cashmere quality control, resulting in a trend of cashmere becoming thicker year by year. With the growing demand for fine cashmere in the international market, its price is also getting higher and higher. Therefore, maintaining or reducing the diameter of cashmere fibers and increasing the cashmere production and cashmere quality of individual cashmere goats are key issues that need to be addressed by my country's cashmere goat industry. With the development of molecular biology, molecular marker-assisted selection has gradually been applied to breeding practice. Combined with whole genome association analysis technology, it is expected to identify key mutation sites related to cashmere diameter, which can effectively improve the efficiency of breeding work. Summary of the invention

[0004] The purpose of the embodiment of the present invention is to provide a molecular marker related to the cashmere diameter trait of the Albas cashmere goat, aiming to solve the problems raised in the background technology.

[0005] The embodiment of the present invention is implemented as follows: a molecular marker related to the cashmere diameter trait of the Albas cashmere goat includes at least one or a combination of the following SNP sites or InDel sites:

[0006] The SNP site at position 31750972 on chromosome 16 has polymorphisms of C and A;

[0007] The SNP site at position 31750973 on chromosome 16 has polymorphisms of C and G;

[0008] The SNP site at position 31752892 on chromosome 16 has polymorphisms of A and G;

[0009] The SNP site at position 31753568 on chromosome 16 has polymorphisms of G and A;

[0010] The InDel site at position 31754093 on chromosome 16 has polymorphisms of TGAA and T;

[0011] The SNP site at position 31754793 on chromosome 16 has polymorphisms of A and G;

[0012] The SNP site at position 31758597 on chromosome 16 has polymorphisms of C and T;

[0013] The SNP site at position 31762003 on chromosome 16 has polymorphisms of T and C;

[0014] The SNP site at position 31762382 on chromosome 16 has polymorphisms of C and T;

[0015] The SNP site at position 31762646 on chromosome 16 has polymorphisms of G and A;

[0016] The SNP site at position 31765472 on chromosome 16 has polymorphisms of C and T;

[0017] The SNP site at position 31765996 on chromosome 16 has polymorphisms of A and G;

[0018] The SNP site at position 31766047 on chromosome 16 has polymorphisms of T and C;

[0019] The SNP site at position 31768841 on chromosome 16 has polymorphisms of G and A;

[0020] The InDel site at position 31772207 on chromosome 16 has polymorphisms of C and CT;

[0021] The SNP site at position 31773492 on chromosome 16 has polymorphisms of G and T;

[0022] The SNP site at position 31776544 on chromosome 16 has polymorphisms of T and C;

[0023] The InDel site at position 31777164 on chromosome 16 has polymorphisms of AT and A;

[0024] The InDel site at position 31778080 on chromosome 16 has polymorphisms of CT and C;

[0025] The SNP site at position 31779538 on chromosome 16 has polymorphisms of G and A;

[0026] The InDel site at position 31780342 on chromosome 16 has polymorphisms of G and GA;

[0027] The SNP site at position 31781027 on chromosome 16 has polymorphisms of T and C.

[0028] Another object of the embodiment of the present invention is to provide an application of the above-mentioned molecular marker in breeding cashmere goats based on the cashmere diameter trait.

[0029] Preferably, the dominant genotype of the SNP sites at positions 31750972, 31753568, 31762646, and 31768841 on chromosome 16 is AA.

[0030] Preferably, the dominant genotype of the SNP sites at positions 31750973, 31752892, 31754793, 31765996, and 31779538 on chromosome 16 is GG.

[0031] Preferably, the dominant genotype of the SNP sites at positions 31758597, 31766047, and 31776544 on chromosome 16 is CC.

[0032] Preferably, the dominant genotype of the SNP sites at positions 31762003, 31762382, 31765472, 31773492, and 31781027 on chromosome 16 is TT.

[0033] Preferably, the dominant genotype of the InDel site at position 31754093 on chromosome 16 is TT; the dominant genotype of the InDel site at position 31772207 on chromosome 16 is CTCT; the dominant genotype of the InDel site at position 31777164 on chromosome 16 is ATAT; the dominant genotype of the InDel site at position 31778080 on chromosome 16 is CC; the dominant genotype of the InDel site at position 31780342 on chromosome 16 is GAGA.

[0034] The embodiment of the present invention provides a molecular marker related to the cashmere diameter trait of the Albas cashmere goat, including at least one or several combinations of 17 SNP sites and 5 InDel sites located on chromosome 16 screened based on whole genome association analysis. By detecting the molecular marker, the cashmere diameter trait of the cashmere goat can be predicted quickly, at low cost and effectively, which is of great significance in reducing the cashmere diameter and improving the quality of the wool. The above molecular markers are used to assist breeding through molecular markers, retain individuals with favorable genotypes, and eliminate individuals with unfavorable genotypes, so as to reduce the cashmere diameter of the group, thereby improving the fineness of the wool, achieving the purpose of improving the quality of the wool, and meeting market demand. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 A flowchart of the screening of molecular markers provided in an embodiment of the present invention;

[0036] Figure 2 is the distribution map of molecular markers;

[0037] Figure 3 It is the density map of molecular markers after quality control;

[0038] Figure 4 This is the phenotypic distribution diagram of cashmere diameter trait;

[0039] Figure 5 This is the Manhattan plot of the genome-wide association analysis results of cashmere goat cashmere diameter traits; the ordinate represents the -lg of the association value, and each point represents a locus;

[0040] Figure 6 QQ plot of genome-wide association analysis of cashmere goat cashmere diameter traits;

[0041] Figure 7 This is the GO functional annotation map of the candidate genes significantly related to the cashmere diameter trait of cashmere goats;

[0042] Figure 8 This is the KEGG functional annotation map of candidate genes significantly associated with cashmere diameter traits of cashmere goats. DETAILED DESCRIPTION

[0043] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0044] In an embodiment of the present invention, 22 molecular marker combinations related to the cashmere diameter trait of cashmere goats are provided, and the molecular markers correspond to loci on chromosomes of the reference sequence of the goat reference genome Genome assembly ARS1.2 version, specifically including at least one or several combinations of the following 17 SNP loci and 5 InDel (insertion / deletion) loci:

[0045] The SNP site at position 31750972 on chromosome 16 (chr16:31750972) has polymorphisms of C and A;

[0046] The SNP site at position 31750973 on chromosome 16 (chr16:31750973) has polymorphisms of C and G;

[0047] The SNP site at position 31752892 on chromosome 16 (chr16:31752892) has polymorphisms of A and G;

[0048] The SNP site at position 31753568 on chromosome 16 (chr16:31753568) has polymorphisms of G and A;

[0049] The InDel site at position 31754093 on chromosome 16 (chr16:31754093) has polymorphisms of TGAA and T;

[0050] The SNP site at position 31754793 on chromosome 16 (chr16:31754793) has polymorphisms of A and G;

[0051] The SNP site at position 31758597 on chromosome 16 (chr16:31758597) has polymorphisms of C and T;

[0052] The SNP site at position 31762003 on chromosome 16 (chr16:31762003) has polymorphisms of T and C;

[0053] The SNP site at position 31762382 on chromosome 16 (chr16:31762382) has polymorphisms of C and T;

[0054] The SNP site at position 31762646 on chromosome 16 (chr16:31762646) has polymorphisms of G and A;

[0055] The SNP site at position 31765472 on chromosome 16 (chr16:31765472) has polymorphisms of C and T;

[0056] The SNP site at position 31765996 on chromosome 16 (chr16:31765996) has polymorphisms of A and G;

[0057] The SNP site at position 31766047 on chromosome 16 (chr16:31766047) has polymorphisms of T and C;

[0058] The SNP site at position 31768841 on chromosome 16 (chr16:31768841) has polymorphisms of G and A;

[0059] The InDel site at position 31772207 on chromosome 16 (chr16:31772207) has polymorphisms of C and CT;

[0060] The SNP site at position 31773492 on chromosome 16 (chr16:31773492) has polymorphisms of G and T;

[0061] The SNP site at position 31776544 on chromosome 16 (chr16:31776544) has polymorphisms of T and C;

[0062] The InDel site at position 31777164 on chromosome 16 (chr16:31777164) has polymorphisms of AT and A;

[0063] The InDel site at position 31778080 on chromosome 16 (chr16:31778080) has polymorphisms of CT and C;

[0064] The SNP site at position 31779538 on chromosome 16 (chr16:31779538) has polymorphisms of G and A;

[0065] The InDel site at position 31780342 on chromosome 16 (chr16:31780342) has polymorphisms of G and GA;

[0066] The SNP site is located at position 31781027 on chromosome 16 (chr16:31781027), and the polymorphism of the site is T and C.

[0067] Using the polymorphism of molecular markers, different genotypes have different effects on the cashmere diameter trait. In view of this, the embodiments of the present invention provide a method for molecular marker-assisted breeding of low cashmere diameter: Using the polymorphism of the chr16:31750972 molecular marker, the effects of different genotypes on the wool and cashmere diameter are AA < AC < CC. Therefore, the cashmere goat individuals with the A / A genotype are retained. Using the polymorphism of the chr16:31750973 molecular marker, the effects of different genotypes on the wool and cashmere diameter are GG < GC < CC. Therefore, the cashmere goat individuals with the G / G genotype are retained. Using the polymorphism of the chr16:31752892 molecular marker, the effects of different genotypes on the wool and cashmere diameter are GG < GA < AA. Therefore, the cashmere goat individuals with the G / G genotype are retained. Using the polymorphism of the chr16:31753568 molecular marker, the effects of different genotypes on the wool and cashmere diameter are AA < AG < GG. Therefore, the cashmere goat individuals with the A / A genotype are retained. Using the polymorphism of the chr16:31754093 molecular marker, the effects of different genotypes on the wool and cashmere diameter are TT < TTGAA < TGAATGAA. Therefore, the cashmere goat individuals with the T / T genotype are retained. Using the polymorphism of the chr16:31754793 molecular marker, the effects of different genotypes on the wool and cashmere diameter are GG < GA < AA. Therefore, the cashmere goat individuals with the G / G genotype are retained. Using the polymorphism of the chr16:31758597 molecular marker, the effects of different genotypes on the wool and cashmere diameter are CC < CT < TT. Therefore, the cashmere goat individuals with the C / C genotype are retained. Using the polymorphism of the chr16:31762003 molecular marker, the effects of different genotypes on the wool and cashmere diameter are TT < TC < CC. Therefore, the cashmere goat individuals with the T / T genotype are retained. Using the polymorphism of the chr16:31762382 molecular marker, the effects of different genotypes on the wool and cashmere diameter are TT < TC < CC. Therefore, the cashmere goat individuals with the T / T genotype are retained. Using the polymorphism of the chr16:31762646 molecular marker, the effects of different genotypes on the wool and cashmere diameter are AA < AG < GG. Therefore, the cashmere goat individuals with the A / A genotype are retained. Using the polymorphism of the chr16:31765472 molecular marker, the effects of different genotypes on the wool and cashmere diameter are TT < TC < CC. Therefore, the cashmere goat individuals with the T / T genotype are retained. Using the polymorphism of the chr16:31765996 molecular marker, the effects of different genotypes on the wool and cashmere diameter are GG < GA < AA. Therefore, the cashmere goat individuals with the G / G genotype are retained. Using the polymorphism of the chr16:31766047 molecular marker, the effects of different genotypes on the wool and cashmere diameter are CC < CT < TT. Therefore, the cashmere goat individuals with the C / C genotype are retained. Using the polymorphism of the chr16:31768841 molecular marker, the effects of different genotypes on the wool and cashmere diameter are AA < AG < GG. Therefore, the cashmere goat individuals with the A / A genotype are retained. Using the polymorphism of the chr16:31772207 molecular marker,The effects of different genotypes on the wool diameter were CTCT < CTC < CC. Therefore, the individual cashmere goats with the CT / CT genotype were retained. Using the polymorphism of the molecular marker chr16:31773492, the effects of different genotypes on the wool diameter were TT < TG < GG. Therefore, the individual cashmere goats with the T / T genotype were retained. Using the polymorphism of the molecular marker chr16:31776544, the effects of different genotypes on the wool diameter were CC < CT < TT. Therefore, the individual cashmere goats with the C / C genotype were retained. Using the polymorphism of the molecular marker chr16:31777164, the effects of different genotypes on the wool diameter were ATAT < ATA < AA. Therefore, the individual cashmere goats with the AT / AT genotype were retained. Using the polymorphism of the molecular marker chr16:31778080, the effects of different genotypes on the wool diameter were CC < CCT < CTCT. Therefore, the individual cashmere goats with the C / C genotype were retained. Using the polymorphism of the molecular marker chr16:31779538, the effects of different genotypes on the wool diameter were GG < GA < AA. Therefore, the individual cashmere goats with the G / G genotype were retained. Using the polymorphism of the molecular marker chr16:31780342, the effects of different genotypes on the wool diameter were GAGA < GAG < GG. Therefore, the individual cashmere goats with the GA / GA genotype were retained. Using the polymorphism of the molecular marker chr16:31781027, the effects of different genotypes on the wool diameter were TT < TC < CC. Therefore, the individual cashmere goats with the T / T genotype were retained.,

[0068] Example 1: As Figure 1 shown, this example provides a method for screening candidate markers related to the cashmere diameter trait of Albas cashmere goats based on genome-wide association analysis, which specifically includes the following processes:

[0069] I. Materials and Methods: 1.1 Experimental Animals and Sample Collection: The 1493 Albas cashmere goats in this example were from a sheep farm in Ordos, Inner Mongolia. Blood samples of this population were collected, and the phenotypic data of the cashmere diameter were recorded.

[0070] 1.2 Whole genome resequencing: Genomic DNA was extracted by magnetic bead method according to the conventional extraction steps. The extracted DNA was tested for integrity and purity. DNA that met the requirements was retained, and DNA that did not meet the requirements was re-extracted. Samples that still did not meet the requirements after re-extraction were discarded. The experiment was performed according to the standard protocol provided by BGI. For genomic DNA samples that passed the test, fragments of appropriate size were selected by gel electrophoresis, and then the library was constructed by PCR enrichment. After the library was constructed, Qubit was used for quantitative quality control. The qualified library was sequenced with DNBSEQ-T7, which was completed by Beijing Compson Biotechnology Co., Ltd. (Beijing, China). After DNBSEQ-T7 sequencing, base sequencing quality distribution analysis, base content distribution analysis, and filtering of the raw image data (Rawreads) files obtained by high-throughput sequencing were performed.

[0071] The final sequence obtained by sequencing was re-aligned to the reference genome for subsequent analysis. The reference gene species is goat and the reference genome is Genome assembly ARS1.2.

[0072] 1.3 Quality control of genomic data: To obtain reliable GWAS results, PLINK1.9 software was used to perform quality control on genotype data. The quality control conditions were as follows: (1) retaining loci on autosomes; (2) eliminating loci with a missing rate greater than 10%; (3) eliminating loci with a minor allele frequency less than 0.05; and (4) eliminating loci that did not meet the Hardy-Weinberg test P value less than 10. -6 The location of

[0073] After screening, a total of 15,575,112 SNP loci covering chromosomes 1-29 were finally obtained, and the number of loci on chromosomes before and after quality control changed (see Figure 2 ), density map of the sites after quality control (see Figure 3 ).

[0074] 1.4 Introduction to genome-wide association analysis software: GMAT software was used to conduct genome-wide association analysis on cashmere diameter traits. The current GWAS analysis software only considers the additive effect of genes, ignoring the non-additive effect, especially the effect of interaction, resulting in incomplete analysis of complex traits; the research traits also focus on cross-sectional data collected at a certain time point, ignoring longitudinal traits. GMAT software has six modules, including single trait analysis module, multi-trait analysis module, and longitudinal data analysis module. Compared with traditional GWAS analysis software, it is richer in model richness and trait applicability, significantly improves the statistical test power, and is more conducive to mining significant markers associated with traits. In terms of calculation, GMAT software is written in C++ language, calling Eigen and MKL libraries, using block reading and block calculation technology to save memory, and using technical means such as feature decomposition relationship matrix, linear transformation genome estimation value, EM and AI algorithm weighting, making GAMT software extremely efficient, and the calculation efficiency can be increased by thousands of times compared with Fast-LMM algorithm.

[0075] 1.5 Whole genome association analysis: After the sequencing data was quality controlled, the GMAT software was used to conduct an association analysis with the cashmere diameter trait based on the LMM model to screen out SNPs with significant effects. The LMM model is as follows:

[0076]

[0077] y is the phenotypic vector, Xβ is the population structure effect, To test the marker effect, For polygenic effects, is the residual effect; K in the polygenic effect is the kinship matrix inferred by markers.

[0078] 1.6 Candidate gene identification and functional annotation: Download the reference genome information of the corresponding species from the ENSEMBL website, and use ANNOVAR software to annotate genes near significant sites. Then use the clusterProfiler package to perform gene function enrichment analysis on the annotated candidate genes according to the GO and KEGG databases.

[0079] 1.7 Analysis of association between significant loci and traits and multiple comparisons: R4.2 software was used to test the association between marker genotype and phenotype. The model is as follows: y = Zγ + e; y is the phenotype vector, γ is the marker effect to be tested, Z is the association matrix of γ, is the residual effect. LSD method was used for multiple comparisons between different genotypes.

[0080] II. Results and analysis: 2.1 Sequencing data quality control and comparison with reference genome: Sample sequencing quality control data are shown in Table 1. Base type distribution detection is mainly used to check whether there is AT and CG separation. As shown in Table 1, the average percentage of G and C in the sample is 44.26% of the total bases, the number of bases with a quality value greater than or equal to 20 accounts for 98.79% of the total bases, and the number of bases with a quality value greater than 30 accounts for 96.41% of the total bases. The average efficiency of comparison between sample DNA and genomic DNA is 99.94%. This shows that the library construction and sequencing of the samples of this population are normal.

[0081] Table 1 Quality control statistics of sample sequencing data

[0082]

[0083] 2.2 Statistics of different cashmere diameter traits of Arbas cashmere goats: The statistical results are shown in Table 2. It can be seen from Table 2 that the maximum, minimum, average, standard deviation and coefficient of variation of the cashmere diameter trait of 1493 Arbas cashmere goats were statistically analyzed. The maximum, minimum and average of the cashmere diameter trait were 10cm, 3cm and 6.12cm respectively; the average cashmere diameter trait of 1500 goats was 6.12cm. Its phenotypic distribution (see Figure 4 ).

[0084] Table 2 Statistics of cashmere diameter characteristics of Arbas cashmere goats

[0085]

[0086] 2.3 GWAS analysis results: 15,575,112 molecular marker loci were retained after quality control for association analysis. A general mixed linear model was used to associate 22 significant molecular marker loci associated with the villus diameter trait. They were associated with the villus diameter trait (e.g. Figure 5 and Figure 6 The information of each significant locus is shown in Table 3.

[0087] Table 3 Information on significant molecular marker sites related to cashmere diameter

[0088]

[0089] 2.4 Identification of candidate genes related to cashmere diameter and GO functional annotation: Gene function enrichment analysis was performed based on the GO and KEGG databases, and the functional annotation results (see Figure 7 and Figure 8), the candidate functional genes near the 22 significant loci associated with villus diameter traits are located between ZBTB18 and AKT3. AKT3 is a member of the AKT gene family (including AKT1, AKT2 and AKT3), which is related to the development and regeneration of skin hair follicles. Studies have shown that downregulation of AKT3 can inhibit the proliferation and migration of fibroblasts, and the expression of AKT3 has an inhibitory effect on the growth of hair length.

[0090] 2.5 Analysis of association between significant loci and traits and multiple comparisons: Through the association test between marker genotype and phenotype, and the LSD method for multiple comparisons between different genotypes, it was found that there were three types of chr16:31750972 loci in the cashmere goat population (A / A, A / C and C / C), among which the villi diameter of A / A type was 0.031μm lower than that of A / C type (the difference was not significant), 0.207μm lower than that of C / C type (the difference was significant), and A / C type was 0.176μm lower than that of C / C type (the difference was significant). There were three types of chr16:31750973 loci in the cashmere goat population (G / G, G / C and C / C), among which the villi diameter of G / G type was 0.031μm lower than that of G / C type (the difference was not significant), 0.207μm lower than that of C / C type (the difference was significant), and G / C type was 0.176μm lower than that of C / C type (the difference was significant). There are three types of chr16:31772207 in cashmere goat population (CT / CT, CT / C and C / C), among which the villus diameter of CT / CT type is 0.005μm lower than that of CT / C type (the difference is not significant), 0.179μm lower than that of C / C type (the difference is significant), and 0.174μm lower than that of C / C type (the difference is significant). There are three types of chr16:31765472 in cashmere goat population (T / T, T / C and C / C), among which the villus diameter of T / T type is 0.005μm lower than that of T / C type (the difference is not significant), 0.177μm lower than that of C / C type (the difference is significant), and 0.172μm lower than that of C / C type (the difference is significant). There are three types of chr16:33449260 loci in cashmere goat populations (T / T, T / C and C / C), among which the villi diameter of T / T type is 0.023μm higher than that of T / C type (the difference is not significant), and 0.164μm lower than that of C / C type (the difference is significant), and T / C type is 0.187μm lower than that of C / C type (the difference is significant). The specific analysis results are shown in Table 4-5.

[0091] Table 4 Results of trait association analysis and multiple comparisons of different genotypes

[0092]

[0093] Table 5 Results of trait association analysis and multiple comparisons of different genotypes

[0094]

[0095] It should be noted that in Tables 4-5 above, the data with the same lowercase letters in the numbers of the same trait have no significant difference, while the data with different lowercase letters have significant difference.

[0096] In addition, the sequence information of 50 bp before and after the above 22 sites was extracted, as follows:

[0097] The sequence of 50 bp before and after chr16:31750972 (including the site itself) is: TCAATAAATATTTTTTGAATGAAGAAATGATTCAAATGTATACTCCCCCTCCAAAACCCACCCTCTCCAATAGTTGTATTAATGGATTGCCTTTGAAAGCA. The overall sequence is shown in the sequence listing SEQ ID NO.1.

[0098] The sequence of 50 bp before and after chr16:31750973 (including the site itself) is: CAATAAATATTTTTTGAATGAAGAAATGATTCAAATGTATACTCCCCCTCCAAAACCCACCCTCTCCAATAGTTGTATTAATGGATTGCCTTTGAAAGCAG. The overall sequence is shown in the sequence listing SEQ ID NO.2.

[0099] The sequence of 50 bp before and after chr16:31752892 (including the site itself) is: CTGGATTTAAGATTGCTGGAGAAATATCAATAACCTCAGATATGCAGATGACACCACCCTTATGGCAGAAAGTGAAGAGGAACTAAAGAGCCTCTTGGTGA. The overall sequence is shown in the sequence listing SEQ ID NO.3.

[0100] The sequence of 50 bp before and after chr16:31753568 (including the site itself) is: ATGAGATGGCAGGATGGCATCACCAACTCGAAGGACATGAGTCTGAGTGAGCTCCGGGAGTTGGTGATGGACAGGGAGGCCTGGTGTGCTGCGATTCATGG. The overall sequence is shown in the sequence listing SEQ ID NO.4.

[0101] The sequence of 50 bp before and after chr16:31754093 (including the site itself) is: GGAAAACTGCTCCAAAAAGAAGCAACAACACGCTAGGAAATAAAAAGAAATGAAGTATTGATATACGATATGACAGGAGTGAGCCTCGAAAACATGCTAAG. The overall sequence is shown in the sequence listing SEQ ID NO.5.

[0102] The sequence of 50 bp before and after chr16:31754793 (including the site itself) is: TTCATGGCTGCAGTCACCATCTGCAGTGATTTTGGAGCCCCCAAAAATAAAGTCTGACGCTGTTTCCACTGTTTCCCCATCTATTTCCCATGAACTGATGG. The overall sequence is shown in the sequence listing SEQ ID NO.6.

[0103] The sequence of 50 bp before and after chr16:31758597 (including the site itself) is: ATTCTGATACAGTCATGAGGTGTTGCAGGTATAAACTATGACTTTTACCACTGAAATAATAATTTTTAGAAATGGAAAGAGTGGTGTGGGAAAATATTCTC. The overall sequence is shown in the sequence listing SEQ ID NO.7.

[0104] The sequence of 50 bp before and after chr16:31762003 (including the site itself) is: ATTTGTTCTGGCTTTGGAAGAGTGAAAAGTGTCAGTTGCTCAGTCATGTCTGACTCTTTGTGATCCCATGGACTATACCCTGGTAGGCTCCTTTGTCCATG. The overall sequence is shown in the sequence listing SEQ ID NO.8.

[0105] The sequence of 50 bp before and after chr16:31762382 (including the site itself) is: GTCTCTCTGAGTTAGCGCAGGTCCAGTGGGACGAGCGAGGCCATCAGGCACCATTTGGATGCAGCAAAGGAGAAAGCCAAGGGGACCCTGTTCAGACAGTC. The overall sequence is shown in the sequence listing SEQ ID NO.9.

[0106] The sequence of 50 bp before and after chr16:31762646 (including the site itself) is: TTCAGTTACTCCTTAATATCTGACTCTGGGTTTCCTGTTTCCAGAGACAAGAGGGCTGTAAAAATCCTCCCTACCCAAAACCAAGATCACAGATTGAAGAG. The overall sequence is shown in the sequence listing SEQ ID NO.10.

[0107] The sequence of 50 bp before and after chr16:31765472 (including the site itself) is: AGATCTTTCTTTCCTTTGATCGGGCATACTCTTCCTCCAACTTTAACAACCATTTGTTACACCAAATTTTTCAGCAGTGCTAAAGTAAAGAAGAAAAAGCA. The overall sequence is shown in the sequence listing SEQ ID NO.11.

[0108] The 50 bp sequence before and after chr16:31765996 (including the site itself) is: TATTAAATGATGCTTCAGATAATTGCTCTGTAAAATTTGTTAGTTTAAGCATTAAAAGTTGTTGCACCATTAAGACAATATCTATTTCTTATAGAATGTTG. The overall sequence is shown in the sequence listing SEQ ID NO.12.

[0109] The sequence of 50 bp before and after chr16:31766047 (including the site itself) is: TTAAAAGTTGTTGCACCATTAAGACAATATCTATTTCTTATAGAATGTTGTCCAAACTCATATTTTAGAGAGCTAACCAAACTATATTTATAAAATTAATG. The overall sequence is shown in the sequence listing SEQ ID NO.13.

[0110] The sequence of 50 bp before and after chr16:31768841 (including the site itself) is: GTATTTTTTATTACAAGAGCCAGAGAATAAGAAAGGCAATTTTTTAAAACGTGTTGATGGAAGAAATCATGTCAAAAACTAGAGGAGTTTAATAAAGAAAT. The overall sequence is shown in the sequence listing SEQ ID NO.14.

[0111] The sequence of 50 bp before and after chr16:31772207 (including the site itself) is: TCTCCTTTGCCTTTAGCTTCTCTTCTTTTCTCCACTATTTGTAAGGCCTCCTCTGACATTTTGCCATTTTGCACTTCTTTTTCTTGGGGATGTTCTTGATC. The overall sequence is shown in the sequence listing SEQ ID NO.15.

[0112] The sequence of 50 bp before and after chr16:31773492 (including the site itself) is: GGCTTTTTGCCTTTTCATACTGTTCATGGGGTTCTCAAGGCAAGAATACTGAAGTGGTTTGCCATTCCCTTCTCCAGTGGACCACATTTTGTCAGAACTCT. The overall sequence is shown in the sequence listing SEQ ID NO.16.

[0113] The sequence of 50 bp before and after chr16:31776544 (including the site itself) is: CATTGGGAAATAGTCATTATATTTCAGAAACAAATAACCCTCCAATTTGATAACAAATTTTGGTTTAAATGCAAAGTGCGTTTTTATCTCCAAGAATTTGA. The overall sequence is shown in the sequence listing SEQ ID NO.17.

[0114] The sequence of 50 bp before and after chr16:31777164 (including the site itself) is: TCAATGCAGTTTTGTGCTCATTAGTTTTAGCTGGTAGATTCTATTTTACAATTTTTTTGATATGTATTTAGACTGAATCCAGGCAAAAATCGCCCTTACAA. The overall sequence is shown in the sequence listing SEQ ID NO.18.

[0115] The sequence of 50 bp before and after chr16:31778080 (including the site itself) is: GTCCAGATAGCACGATGCTACCTCCTCTTTTTTCAGCCTGGATTATTTAACTCACACTTTGCAGTGATGAAAGTTCCATCTATGCACTAATGCTTGAAAGA. The overall sequence is shown in the sequence listing SEQ ID NO.19.

[0116] The sequence of 50 bp before and after chr16:31779538 (including the site itself) is: CCTACATCTCAATCTCACTGTCCACACTTGCAAGTTTGAAAGGAGAATGGGAAGTCTTAACTATGTAGCTGTGTCATTGTCAGATGTATTAGCATAAGTAT. The overall sequence is shown in the sequence listing SEQ ID NO.20.

[0117] The sequence of 50 bp before and after chr16:31780342 (including the site itself) is: TGCCTGGAGAATCCCAGGGACGGGGGAGCCTGGTGGGCTGCTGTCTATGGGCTCGCACAGAGTCGTACATGACTGACATGTCTTAGCAGGATCATACTAAC. The overall sequence is shown in the sequence listing SEQ ID NO.21.

[0118] The sequence of 50 bp before and after chr16:31781027 (including the site itself) is: TGTCCAGCTCTTTGCAACTCTGTGGACTATAGCCCACCAGGCTCCTCTGTTCATGGGATTTCCCAGACAAGAATACTGGAGTGGGTTGCCATTTCCTTCTC. The overall sequence is shown in the sequence listing SEQ ID NO.22.

[0119] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Application of the cashmere diameter trait of Arbas cashmere goats to the breeding of cashmere diameter trait by detecting the polymorphism of SNP sites or InDel sites related to the cashmere diameter trait of Arbas cashmere goats, characterized in that: The SNP site is at least one of the following 17 SNP sites, the InDel site is at least one of the following 5 InDel sites, and the reference genome version of the 17 SNP sites and the 5 InDel sites is the goat Capra hicus genome ARS1.2: The SNP site at position 31750972 on chromosome 16 has a polymorphism of C or A; The SNP site at position 31750973 on chromosome 16 has a polymorphism of C or G; The SNP site at position 31752892 on chromosome 16 has a polymorphism of A or G; The SNP site at position 31753568 on chromosome 16 has a polymorphism of G or A; The InDel site at position 31754093 on chromosome 16 has a polymorphism of TGAA or T; The SNP site at position 31754793 on chromosome 16 has a polymorphism of A or G; The SNP site at position 31758597 on chromosome 16 has a polymorphism of C or T; The SNP site at position 31762003 on chromosome 16 has a polymorphism of T or C; The SNP site at position 31762382 on chromosome 16 has a polymorphism of C or T; The SNP site at position 31762646 on chromosome 16 has a polymorphism of G or A; The SNP site at position 31765472 on chromosome 16 has a polymorphism of C or T; The SNP site at position 31765996 on chromosome 16 has a polymorphism of A or G; The SNP site at position 31766047 on chromosome 16 has a polymorphism of T or C; The SNP site at position 31768841 on chromosome 16 has a polymorphism of G or A; The InDel site at position 31772207 on chromosome 16 has a polymorphism of C or CT; The SNP site at position 31773492 on chromosome 16 has a polymorphism of G or T; The SNP site at position 31776544 on chromosome 16 has a polymorphism of T or C; The InDel site at position 31777164 on chromosome 16 has a polymorphism of AT or A; The InDel site at position 31778080 on chromosome 16 has a polymorphism of CT or C; The SNP site at position 31779538 on chromosome 16 has a polymorphism of G or A; The InDel site at position 31780342 on chromosome 16 has a polymorphism of G or GA; The SNP site at position 31781027 on chromosome 16 has a polymorphism of T or C; The dominant genotype of the SNP sites at positions 31750972, 31753568, 31762646, and 31768841 on chromosome 16 is AA; The dominant genotype of the SNP loci at positions 31750973, 31752892, 31754793, 31765996, and 31779538 on chromosome 16 is GG; The dominant genotype of the SNP loci at positions 31758597, 31766047, and 31776544 on chromosome 16 is CC; The dominant genotype of the SNP sites at positions 31762003, 31762382, 31765472, 31773492, and 31781027 on chromosome 16 is TT; The dominant genotype of the InDel site at position 31754093 on chromosome 16 is TT; the dominant genotype of the InDel site at position 31772207 on chromosome 16 is CTCT; the dominant genotype of the InDel site at position 31777164 on chromosome 16 is ATAT; the dominant genotype of the InDel site at position 31778080 on chromosome 16 is CC; the dominant genotype of the InDel site at position 31780342 on chromosome 16 is GAGA.

Images