A KASP marker for rapid identification of powdery mildew resistance in Aegilops rubra and its application
By developing the KASP marker system and utilizing PCR amplification and fluorescence detection technology, the PmKu-2013 disease resistance gene was rapidly identified and screened, solving the problem of low screening efficiency of resistance genes in existing technologies and realizing efficient breeding of disease-resistant varieties and gene transfer.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-24
- Publication Date
- 2026-04-03
AI Technical Summary
Existing technologies make it difficult to efficiently screen and transfer powdery mildew resistance genes from Aegilops spp. to wheat, resulting in low utilization efficiency of resistance genes during breeding and the ineffectiveness of existing resistance genes when faced with pathogen mutations.
A KASP marker system was developed. PCR amplification and fluorescence detection techniques were used to design specific primers for genotyping of wheat and Aegilops scabra DNA, rapidly identifying the presence of the PmKu-2013 disease resistance gene. Efficient screening and transfer were achieved through the linkage marker SDAU-kaspPm2013.
It enables rapid, simple and efficient screening of powdery mildew resistance genes, shortens the breeding cycle, improves the breeding efficiency of disease-resistant varieties and the utilization efficiency of resistance genes, and reduces breeding costs.
Smart Images

Figure CN119162367B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of wheat genetics and molecular breeding technology, specifically to a KASP marker for rapid identification of powdery mildew resistance in Aegilops spp. and its application. Background Technology
[0002] Wheat powdery mildew is caused by *Bluegrass* (*Bryophyte graminearum*). Blumeria graminis f. sp Powdery mildew, caused by fungi of the genus *Brucea* in the subphylum Ascomycota, is a destructive disease that seriously threatens wheat yield and food safety. In recent years, with climate change, the disease has become increasingly prevalent in major wheat-growing areas of my country, such as the southwest, northwest, north, and northeast regions. Therefore, controlling wheat powdery mildew is of great significance for improving wheat quality and increasing wheat yield. Identifying resistance genes is the most environmentally friendly and effective strategy for developing resistant varieties and controlling the disease.
[0003] To date, over 110 Pm genes have been identified in wheat and its closely related wild germplasm, and 18 have been cloned. Although some disease resistance genes from closely related species, such as... Pm2b , PM4 , Pm50 Wheat can be introduced. However, linked harmful traits and hybrid inferiority can reduce yield and quality, such as... PM16 This resulted in a 15% yield loss. Furthermore, existing Pm genes, such as... Pm1 to PM5 and PM8 As they gradually lose their way Bgt Resistance in isolates, even with the most effective genes 21 PM Wheat also faces strong selection pressure and the risk of losing its resistance. Therefore, finding novel powdery mildew resistance genes that can balance broad-spectrum resistance and agronomic traits is key to improving high yield and multiple resistance in wheat.
[0004] rough goat grass ( Aegilopstauschii , 2n=14, DD), is the donor of the D genome of allohexaploid wheat, which contains abundant resistance genes and has the characteristics of being easily transferred to wheat for utilization.
[0005] Molecular markers, as a simple and low-cost technique, play a crucial role in the molecular identification of wheat and its distant hybrids. To achieve efficient aggregation of multiple disease-resistant genes while optimizing agronomic traits, molecular-assisted selection can be used to aggregate functionally complementary genes, thereby enhancing broad-spectrum and durable wheat resistance without sacrificing other agronomic traits. Summary of the Invention
[0006] To address the shortcomings of existing technologies, this patent provides a KASP marker for rapid identification of powdery mildew resistance in Aegilops spp. and its application.
[0007] Powdery mildew resistance identification of Aegilops rubra KU-2013 revealed it to be a source of durable immunity against wheat powdery mildew. Wheat powdery mildew resistance identification and genetic analysis showed that KU-2013 carries a single dominant resistance gene on chromosome 2D, which is tentatively named... PmKu -2013.
[0008] This invention provides a molecular marker system and application strategy for wheat powdery mildew resistance, aiming to fill the gap in current breeding technology regarding the use of efficient molecular markers to assist in the selection of wheat powdery mildew-resistant varieties. To achieve the above objective, this invention provides the following technical solution:
[0009] The inventors, based on their preliminary mapping of the powdery mildew resistance gene in DHKU-2013 (an artificially synthesized hexaploid wheat resulting from a cross between Aegilops kurroa KU-2013 and Langdon durum wheat) to chromosome 5.9M (…), Picture 1 Within the mapping interval, a set of KASP markers for inter-parental resistance and susceptibility polymorphisms were designed. Using these markers, genotypic analysis was performed on 40 randomly selected wheat varieties commonly used in wheat breeding from various parts of China, as well as on the durum wheat Langdon. The results showed that the genotypes of these 40 wheat varieties and the durum wheat Langdon were identical to the genotype of the susceptible control DH2147 (an artificially synthesized hexaploid wheat resulting from a cross between Aegilops tataricus 2147 and durum wheat Langdon). This finding indicates that the designed KASP markers... PmKu-2013 During gene transfer to wheat breeding, there is a potential role for molecularly assisted selection. The KASP marker is named as follows: SDAU-kaspPm2013 The nucleotide sequences of their primer sets are as follows:
[0010] FAM (SEQ ID NO:1):
[0011] GAAGGTGACCAAGTTCATGCTCGAAGCTGGTGAAAAATGATCGCC (Susceptibility site binding).
[0012] HEX (SEQ ID NO:2):
[0013] GAAGGTCGGAGTCAACGGATTCCGAAGCTGGTGAAAAATGATCGCT (anti-disease site binding).
[0014] COM (SEQ ID NO:3):
[0015] CACCCCAGTCTCAGTTTCTGCTAA.
[0016] Using the powdery mildew resistance gene of Aegilops spp. PmKu-2013 Chain mark SDAU-kaspPm2013 The usage methods are as follows:
[0017] (1) Using wheat or Aegilops spp. DNA as a template for PCR amplification and SDAU-kaspPm2013 as primers, PCR amplification was performed in a reaction volume of approximately 5 μl. The reaction volume specifically included: 1 μl of 80 ng / μl DNA, 2.5 μl of 2×KASP mix, 0.35 μl of KASP Primer mix, and ddH2O to a final volume of 5 μl.
[0018] (2) The PCR amplification program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 65℃ annealing and extension for 1 min (decreasing by 0.8℃ per cycle), 10 cycles; 94℃ denaturation for 20 s, 57℃ annealing for 1 min, 28 cycles;
[0019] (3) After PCR, the sample was placed on a 384-well multi-channel quantitative PCR instrument for fluorescence reading and detection of PCR typing results;
[0020] (4) Analysis and identification: if the genotype is concentrated on the Y-axis, it belongs to the disease-resistant genotype; if the genotype is concentrated on the X-axis, it belongs to the disease-susceptible genotype; and the genotype located at the origin is the negative control.
[0021] This research has the following advantages compared to existing technologies:
[0022] This invention obtains the linkage KASP marker for PmKu-2013: SDAU-kaspPm2013. SDAU-kaspPm2013 is a KASP marker with high throughput and simple operation, which can be used for high-throughput screening of large-scale segregating populations and fine mapping of PmKu2013. SDAU-kaspPm2013 detected that 40 randomly selected wheat varieties were all susceptible to the disease, therefore it can be used as a molecular marker for PmKu2013 resistance-assisted selection in wheat breeding. Attached Figure Description
[0023] Picture 1 Indicated as powdery mildew resistance gene PmKu-2013 The preliminary genetic linkage map and the 5DS physical location mapping map of AL8 / 78 will... PmKu-2013 It is located between molecular markers sdau4 and sdau5, at a position between 45.49 Mb and 51.39 Mb on chromosome 5DS of the reference genome AL8 / 78;
[0024] Picture 2 Indicates in PmKu-2013Within the genetic mapping region, a SNP site closely linked to powdery mildew resistance was found, with the base sequence before and after it being highlighted. The bases highlighted are differential SNPs, namely, the base is C in 8 susceptible germplasms and T in 2 resistant germplasms.
[0025] Picture 3 express PmKu-2013 Initial positioning of the parental lines DH2147 and DHKU-2013 SDAU-kaspPm2013 The genotyping results show that the black circle represents the control with water as the template, and the red, blue, and green circles represent the genotypes of susceptible, resistant, and heterozygous plants, respectively.
[0026] Picture 4 Indicates using SDAU-kaspPm2013 The genotyping results of 40 common wheat varieties, DH2147, and DHKU-2013 were scanned. The black circle represents the control with water as the template, and the red, blue, and pink circles represent the genotypes of disease-resistant plants DH2147, disease-susceptible plants DHKU-2013, and 40 common wheat varieties and Langdon, respectively. Detailed Implementation
[0027] Example 1: Construction and genetic mapping of the mapping population
[0028] The disease-resistant artificially synthesized hexaploid wheat DHKu-2013 was crossed with the disease-susceptible artificially synthesized hexaploid wheat DH2147 to obtain F1. Self-pollination yielded 167 F2 plants. Disease resistance was assessed and a chi-square test was performed, suggesting that the gene is a single dominant disease resistance gene, tentatively named... PmKu2013 Specific markers were developed on the long and short arms of each chromosome in the D genome. These markers were then scanned and screened in a pool of F2 susceptible plants to identify markers on the 5DS chromosome. PmKu2013 The gene exhibits a linkage relationship, indicating that it is located on chromosome 5DS of DHKU-2013. Genotyping of 167 F2 plants from DHKU-2013 and DH2147 was performed using newly developed polymorphic markers, and the powdery mildew resistance phenotype of the F2 population was analyzed. PmKu-2013 Genetic mapping was performed. The results showed that... PmKu-2013 It was located at a genetic distance of 1.9 cM. PmKu-2013 Mapped to the 45.49-51.39 Mb physical region of chromosome 5D in AL8 / 78, the distance between them is 5.90 Mb. Picture 1 ).
[0029] Example 2 PmKu2013 Development of chain tags
[0030] Through the PmKu-2013Preliminary gene mapping successfully pinpointed a 5.9 Mb physical region. Subsequently, resequencing data from 10 *Aegilops spp.* germplasm samples were compared with the AL8 / 78 genome database, revealing a SNP locus tightly linked to the disease resistance phenotype within the identified region. Specifically, this SNP locus exhibited a T-type in two resistant materials, while it was C-type in all eight susceptible materials. Picture 2 The sequence information before and after the SNP site is shown. Based on this finding, a KASP marker, named SDAU-kaspPm2013, was developed for this SNP site. The specific antibody and susceptibility genotyping results are shown below. Picture 3 As shown.
[0031] Example 3 SDAU-kaspPm2013 Application in molecular-assisted breeding of wheat for powdery mildew resistance
[0032] pass SDAU-kaspPm2013 Genotyping was performed on 40 randomly selected wheat varieties commonly used in wheat breeding from various parts of China, as well as the durum wheat variety Langdon. This involved genotyping of resistant, susceptible, and common wheat varieties. The results showed that the genotypes of these 40 wheat varieties and the durum wheat Langdon were all consistent with the genotype of the susceptible control DH2147. Picture 4 This finding indicates that the designed KASP tag is effective in... PmKu-2013 During gene transfer to wheat breeding, there is a potential role of molecularly assisted selection, which can serve as... PmKu-2013 Molecular breeding-assisted markers transferred to wheat.
[0033] This invention provides molecular markers and primer sets for wheat powdery mildew resistance, enabling effective identification and efficient utilization of resistance genes. This technology allows for rapid screening. PmKu-2013 The detection process for progeny materials transferred to wheat is convenient, quick, and unaffected by external environmental factors. It accelerates the breeding of disease-resistant varieties, reduces breeding costs, shortens the breeding cycle for powdery mildew-resistant wheat varieties, and improves the utilization efficiency of closely related wild germplasm materials.
Claims
1. A primer for rapidly identifying powdery mildew resistance in Aegilops scabra, wherein the marker is SDAU-kaspPm2013, characterized in that: The primer combination used to amplify the marker SDAU-kaspPm2013 and its corresponding primer sequences are as follows: The susceptibility site binding primer FAM shown in SEQ ID NO:1: GAAGGTGACCAAGTTCATGCTCGAAGCTGGTGAAAAAATGATCGCC; The anti-disease site binding primer HEX shown in SEQ ID NO:2: GAAGGTCGGAGTCAACGGATTCCGAAGCTGGTGAAAAAATGATCGCT; Primer COM shown in SEQ ID NO:3: CACCCCAGTCTCAGTTTCTGCTAA.
2. The application of the KASP-labeled primers according to claim 1 in screening for powdery mildew-resistant Aegilops spp. germplasm, characterized in that, When the SNP sites detected by the KASP-labeled primers show a T-type pattern, the plant is resistant to disease; when the SNP sites detected by the KASP-labeled primers show a C-type pattern, the plant is susceptible to disease.
3. The application of the KASP-labeled primers according to claim 1 in molecular-assisted breeding of wheat for powdery mildew resistance, characterized in that, When the SNP sites detected by the KASP-tagged primers show a T-type pattern, it is a disease-resistant wheat.
Citation Information
Patent Citations
KASP mark for detecting powdery mildew resistant gene of aegilops tauschii and application
CN107653341A
KASP molecular marker co-segregated with powdery mildew resistant gene Pm58 and application of KASP molecular marker
CN114231661A