Quantitative detection method of radix pseudostellariae TuMV and BBWV2 viruses and rapid analysis program thereof

Abstract

The invention relates to the technical field of virus quantitative detection and analysis, in particular to a radix pseudostellariae TuMV and BBWV2 virus quantitative detection method and a rapid analysis program thereof. The method comprises the following steps: preparing a virion standard substance of a virus type to be detected, diluting the virion standard substance by 10 times of gradient, carrying out TaqMan qPCR amplification on the standard substance subjected to gradient dilution to obtain a mapping relationship between a corresponding Cq value and a logarithm of an initial copy number, fitting a standard curve relational expression by utilizing the mapping relationship, establishing a VBA data processing module by utilizing a VBA code of Excel, and carrying out quantitative analysis on the VBA data. The fitting standard curve relational expression is written into a program, when a user subsequently detects various virus loads of a radix pseudostellariae sample, the corresponding virus load result can be quickly output only by utilizing primers of corresponding viruses to respectively carry out TaqMan qPCR amplification and importing a plurality of Cq values into a VBA data processing module, and the method has the characteristics of simplicity, high efficiency and accuracy.

Description

Technical Field

[0001] The present invention relates to the technical field of virus quantitative detection and analysis, and in particular to a method for quantitative detection of TuMV and BBWV2 viruses of Pseudostellaria heterophylla and a rapid analysis program thereof. Background Art

[0002] The main detection technologies for plant virus diseases include: trait observation and identification method and indicator plant detection method, electron microscopy detection method, serological detection method, immune technology, molecular biology and other methods. Among them, trait observation and identification method and indicator plant detection method mainly make preliminary diagnosis by observing the phenotypic symptoms of susceptible plants. Electron microscopy technology is to identify viruses by observing the structure, morphology, size and other aspects of plant viruses, and is one of the important means to deeply study the pathogenic mechanism of viral diseases. Serological detection method is to detect plant viruses by using the binding specificity between antigens and antibodies, including enzyme-linked immunosorbent assay, dot immunoassay technology, immunocolloidal gold technology and rapid immunofilter paper method, among which enzyme-linked immunosorbent assay (ELISA) is the most widely used serological method. Molecular biology detection method is a technology that uses the DNA or RNA of viruses as the research basis and uses molecular biology technology to detect and identify plant viruses. It has the advantages of high sensitivity, good stability and strong specificity, and is currently the most commonly used method for plant virus detection. At present, there are many types of molecular biological techniques for detecting plant viruses, including RT-PCR, real-time fluorescence quantitative PCR (qPCR), loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), etc. Compared with traditional virus detection technology, molecular detection of viral diseases has the advantages of accuracy, high efficiency, batch size, and simplicity.

[0003] Pseudostellaria virus disease, also known as mosaic disease, is a typical multi-virus complex infection disease, among which Turnip mosaic virus (TuMV) and Broad bean wilt virus (BBWV) are the two core viruses that cause Pseudostellaria virus disease. At present, molecular identification technologies such as RT-PCR and LAMP have been preliminarily applied in the detection of Pseudostellaria virus, providing an important reference for the identification of the pathogen of Pseudostellaria virus disease. Pseudostellaria virus disease will occur throughout the growth period of Pseudostellaria, and at the same time, it will be transmitted to the next generation through the tubers of the vegetative reproduction organs, causing more serious harm. Therefore, Pseudostellaria virus disease is a key disease that affects or restricts the entire planting chain of Pseudostellaria. At present, the virus disease detection method can only roughly identify the infection profile of Pseudostellaria virus, and cannot accurately determine the type of virus infected by Pseudostellaria and its degree of infection. In particular, it is impossible to effectively identify the latent period of Pseudostellaria germination and seedling stage when the virus proliferation is low. Therefore, establishing an efficient method for detecting and analyzing P. heterophylla virus is of great significance for the prevention and early warning of P. heterophylla virus disease, the construction of prevention and control measures, and seedling inspection and quarantine. Summary of the invention

[0004] The technical problem to be solved by the present invention is: a quantitative detection method for TuMV and BBWV2 viruses in Pseudostellaria heterophylla and a rapid analysis program thereof, so as to improve the detection efficiency of specific viral load of Pseudostellaria heterophylla.

[0005] In order to solve the above technical problems, the technical solution adopted by the present invention is:

[0006] The quantitative detection method of TuMV and BBWV2 viruses in Pseudostellaria heterophylla and the rapid analysis procedure thereof comprise the following steps:

[0007] S1: Prepare viral plasmid standards, the viral plasmid standards are BBWV2 and TuMV, dilute the viral plasmid standards by 10-fold gradients, use them as templates, amplify by TaqMan qPCR, obtain the Cq value of the corresponding template, establish a rectangular coordinate system with the Cq value as the ordinate and the logarithm of the starting copy number of the plasmid standard as the abscissa, and represent multiple discrete points in the rectangular coordinate system according to the logarithmic relationship between the Cq value and the starting copy number corresponding to each template; obtain a standard curve relationship formula of the mapping relationship between the Cq value and the logarithm of the starting copy number according to the multiple discrete points;

[0008] S2: Amplify the sample to be tested under the same TaqMan qPCR conditions as in S1 to obtain the Cq value of the corresponding viral sequence amplification;

[0009] S3: using Excel VBA code to establish a VBA data processing module, the VBA data processing module includes an import module, a data processing module and an output module;

[0010] The import module is used to import the Cq value obtained by TaqMan qPCR amplification of the corresponding virus sequence in the sample to be tested obtained by S2;

[0011] The step of processing data by the processing module comprises:

[0012] The Cq value of the imported corresponding viral sequence amplification is substituted into the standard curve relationship to obtain the logarithmic value of the template initial copy number, and the corresponding copy number is obtained by converting the logarithmic value;

[0013] The output module is used to output the obtained copy number.

[0014] Further, in the above-mentioned quantitative detection method for TuMV and BBWV2 viruses of Pseudostellariae heterophylla and the rapid analysis procedure thereof, in S1, the logarithm of the plasmid copy number of the viral plasmid standard is 10, and "using the copy number of the viral plasmid standard after 10-fold gradient dilution as a template" specifically means: selecting 10 3 ~10 9 The plasmid standard with 7 concentrations was used as template according to 10-fold gradient copy / μL.

[0015] Furthermore, in the above-mentioned quantitative detection method for TuMV and BBWV2 viruses of Psoralea corylifolia and its rapid analysis procedure, when the viral plasmid standard is BBWV2, the standard curve is y=-3.3208x+40.302, where y is the Cq value and x is the logarithm of the starting copy number of BBWV2.

[0016] Furthermore, in the above-mentioned quantitative detection method for TuMV and BBWV2 viruses of Psoralea corylifolia and its rapid analysis procedure, when the viral plasmid standard is TuMV, the standard curve is y=-3.5123x+42.692, where y is the Cq value and x is the logarithm of the starting copy number of TuMV.

[0017] Furthermore, in the above-mentioned quantitative detection method for TuMV and BBWV2 viruses of Pseudomonas heterophylla and the rapid analysis procedure thereof, in S1 and S2, the reaction system of TaqMan qPCR is:

[0018]

[0019] Among them, BBWV2-F and BBWV2-R are primers designed based on the conserved region of RNA2 strand of BBWV2;

[0020] Among them, BBWV2-Probe is a TaqMan probe designed based on the conserved region of RNA2 strand of BBWV2;

[0021] Among them, TuMV-F and TuMV-R are primers designed based on the conserved region of the TuMV sequence;

[0022] Among them, TuMV-Probe is a TaqMan probe designed based on the conserved region of the TuMV sequence;

[0023] The 5'-3' sequence of BBWV2-F is: CCTTTTGTTCGGTTGTTGCA

[0024] The 5'-3' sequence of BBWV2-R is: ATTCTCATGAGCTGAAACTGTCAA

[0025] The 5'-3' sequence of BBWV2-Probe is:

[0026] HEX-TGAGAGGTCCTTCTGTAaCTCATGTAACAGAG-BHQ2

[0027] The 5'-3' sequence of TuMV-F is: CGTAGCTGAAGCGTACATTGAA

[0028] The 5'-3' sequence of TuMV-R is: TTGCGCTGAAGACCATATCG

[0029] The 5'-3' sequence of TuMV-Probe is:

[0030] FAM-AGCGTAACCAAGACCGACCATACATGC-BHQ1

[0031] The reaction conditions of TaqMan qPCR were: 37°C for 2 min; 95°C for 5 min; 95°C for 10 sec, 64°C for 30 sec, and 45 cycles.

[0032] Furthermore, in the above-mentioned quantitative detection method for TuMV and BBWV2 viruses of Pseudostellariae Pseudostellariae and the rapid analysis procedure thereof, in S2, the method for processing the sample to be tested is: extracting RNA from the Pseudostellariae Pseudostellariae tissue sample, and reverse transcribing it to obtain cDNA.

[0033] Further, in the above-mentioned quantitative detection method for TuMV and BBWV2 viruses of Pseudostigma heterophylla and the rapid analysis program thereof, in S3, the step of processing data by the data processing module further includes:

[0034] According to the Cq value of the imported corresponding virus sequence amplification, it is judged whether the Cq value of the corresponding virus sequence amplification of the sample to be tested is valid and whether it is positive, specifically:

[0035] If the Cq value is between 0 and 35, it is judged as effective and positive;

[0036] If the Cq value is NA, it is judged as negative;

[0037] If the Cq value is greater than 35, it is judged as invalid and needs to be re-tested to obtain the Cq value. If the Cq value result is still greater than 35 or is NA, it is judged as negative, otherwise it is judged as positive.

[0038] Further, in the above-mentioned quantitative detection method for TuMV and BBWV2 viruses of Pseudostellaria heterophylla and the rapid analysis procedure thereof, in S1, the steps of preparing the viral plasmid standard are as follows:

[0039] Extract RNA from Pseudostellariae Radix tissue samples, reverse transcribe to obtain cDNA, use cDNA as template, perform PCR amplification with primers of viral conserved sequences, link the amplified cDNA fragment to the vector plasmid, obtain the viral plasmid, transfer the viral plasmid into competent cells, pick a single clone, extract the plasmid after sufficient proliferation, and adjust the final concentration of the plasmid according to the following formula:

[0040] Plasmid copy number = 6.02 × 10 23 × plasmid concentration / (plasmid length × 660)

[0041] The unit of plasmid copy number is copies / μL, the logarithm of plasmid copy number is 10, and the unit of plasmid concentration is ng / μL×10 -9 .

[0042] Furthermore, in the quantitative detection method of TuMV and BBWV2 viruses in Pseudomonas heterophylla and its rapid analysis procedure, when the viral plasmid standard is BBWV2, the plasmid copy number is 2.38×10 10 copies / μL, the plasmid concentration is 146.2ng / μL; when the viral plasmid standard is BBWV2, the plasmid copy number is 1.12×10 10 copies / μL, and the plasmid concentration was 145.8ng / μL.

[0043] The beneficial effects of the present invention are as follows: the present invention prepares a virus particle standard of the desired virus type to be detected, dilutes the virus particle standard by 10 times in a gradient, and then performs TaqMan qPCR amplification on the gradient diluted standard to obtain a mapping relationship between a corresponding Cq value and the logarithm of the starting copy number, fits a standard curve relationship using the mapping relationship, establishes a VBA data processing module using Excel VBA code, and writes the fitted standard curve relationship into the program. Since the standard curve relationship of multiple virus types can be written into the program at the same time, when the user subsequently detects multiple virus loads of Pseudostellaria heterophylla samples, the user only needs to perform TaqMan qPCR amplification with primers of the corresponding viruses to obtain the corresponding Cq values. Subsequently, the user only needs to import multiple Cq values ​​into the VBA data processing module to quickly output the corresponding virus load results, and the method has the characteristics of simplicity, high efficiency and accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 This is the sensitivity detection profile of BBWV2 in the TaqMan qPCR system;

[0045] Figure 2 This is the sensitivity detection profile of TuMVR in the TaqMan qPCR system;

[0046] Figure 3 This is the standard curve between BBWV2 Cq value and plasmid loading in the Pseudomonas heterophylla BBWV2 and TuMV TaqMan qPCR co-detection system;

[0047] Figure 4 It is the standard curve between TuMV Cq value and plasmid loading in the co-detection system of Pseudomonas heterophylla BBWV2 and TuMV TaqMan qPCR;

[0048] Figure 5 The interface diagram of the output module of the program that uses Excel VBA code to establish the VBA data processing module without importing Cq data;

[0049] Figure 6 The import module interface diagram for the program that uses Excel's VBA code to establish a VBA data processing module;

[0050] Figure 7 The output module of the program that uses Excel's VBA code to establish a VBA data processing module outputs the result interface after importing Cq data; DETAILED DESCRIPTION

[0051] In order to explain the technical content, achieved objectives and effects of the present invention in detail, the following is an explanation in conjunction with specific embodiments and accompanying drawings.

[0052] Based on the TaqMan qPCR technology, this example designed specific probes and corresponding primers for two common viruses in Pseudomonas heterophylla, established a TaqMan qPCR quantitative detection system for two viral diseases, constructed a standard curve equation for viral load, and compiled a rapid analysis program for viral disease detection data.

[0053] In this embodiment, TaqMan qPCR probes and matching primers for two viruses of Radix Pseudostellariae are designed, specifically:

[0054] The RNA2 strand of BBWV2 and TuMV sequences were aligned using Clustal Omega online software (https: / / www.ebi.ac.uk / Tools / msa / clustalo / ) to obtain the conserved regions of different viruses. According to the qPCR TaqMan primer design principles, PrimerQuestTM Tool online software (https: / / sg.idtdna.com / pages / tools / primerquest) was used to design appropriate TaqMan probes and primers in the conserved sequences of the virus sequences. The BBWV2-RNA2 probe was labeled with a HEX fluorescent group at the 5′ end and a BHQ2 quenching group at the 3′ end; the TuMV probe was labeled with a FAM fluorescent group at the 5′ end and a BHQ1 quenching group at the 3′ end. The fluorescent quantitative PCR probes and corresponding primers for P. heterophylla TuMV and BBWV2-RNA2 viruses are shown in Table 1:

[0055] Table 1 Probe and primer information for TaqMan qPCR detection of two Pseudostellariae viruses

[0056]

[0057] In this embodiment, RNA extraction and reverse transcription of Pseudostellaria chinensis tissue samples are included, specifically: RNA extraction method: ① Take samples from different tissue parts of Pseudostellaria chinensis leaves, stems, roots, etc., and grind them in a sterile mortar precooled with liquid nitrogen. Move the ground samples to a precooled centrifuge tube, add TRIZOL at a rate of 100 mg tissue / mL and mix thoroughly, and let stand at room temperature for 15 minutes; ② Centrifuge at 4°C, 12000rpm for 5 minutes, and take the supernatant; ③ Add 2 / 3 of the supernatant volume of chloroform, shake thoroughly to mix, and let stand at room temperature for 5 minutes. Centrifuge at 4℃, 12000rpm for 15min; ③ Take the supernatant, add an equal volume of isopropanol, mix by inversion, and let stand at -20℃ for 20min; ④ Centrifuge at 4℃, 12000rpm for 10min, discard the supernatant, add 1mL 80% ethanol, mix gently, let stand for 2min, centrifuge at 4℃, 7500rpm for 5min, repeat this step twice; ⑤ Discard the supernatant, add anhydrous ethanol, mix gently, let stand for 2min, centrifuge at 4℃, 7500rpm for 5min; ⑥ Discard the supernatant, dry at room temperature for 5-10min, and add appropriate amount of RNase-free ddH2O water to dissolve the precipitate. ⑦ Determine the RNA concentration of the sample, and use random primers as guide sequences to reverse transcribe the sample RNA into cDNA.

[0058] In this embodiment, the preparation of two viral plasmid standards including Radix Pseudostellariae Radix is ​​as follows:

[0059] Using cDNA of Radix Pseudostellariae as template, PCR amplification was performed with primers of conservative sequences of BBWV2-RNA2 and TuMV genomes to obtain amplified fragments of conservative sequences of BBWV2-RNA2 and TuMV genomes, which were connected to vector plasmids to obtain BBWV2-RNA2 and TuMV genome viral plasmids. BBWV2-RNA2 and TuMV genome viral plasmids were selected and transferred into E.coli DH10B competent cells, and single clones were picked. After sufficient proliferation, plasmids were extracted. The purity and quality of the two viral plasmids were identified, and the viral plasmids that passed the quality test were used as quantitative plasmid standards. Virus plasmid standards usually need to be graded diluted by multiples of 10 to obtain Cq values ​​under different virus concentration gradients and to construct a linear relationship between the Cq value of virus qPCR detection and its copy number. According to the concentration level of the target plasmid, the final concentration of BBWV2-RNA2 plasmid was adjusted to 146.2ng / μL and the concentration of TuMV plasmid was adjusted to 145.8ng / μL. Based on the BBWV2-RNA2 and TuMV cloning vectors, the final concentration of the virus plasmid was determined according to the following formula, and the logarithm of the plasmid copy number was designated as 10:

[0060] Plasmid copy number (copy / μL) = (6.02×10 23 )×(plasmid concentration ng / μL×10 -9 ) / (plasmid length × 660), the copy numbers of the two Pseudostellaria heterophylla virus plasmids are:

[0061] BBWV2-RNA2 plasmid copy number = (146.2 × 10 -9 ×6.02×10 23 ) / (660×5606)=2.38×10 10 copies / μL;

[0062] TuMV plasmid copy number = (145.8 × 10 -9 ×6.02×10 23 ) / (660×11822)=1.12×10 10 copies / μL.

[0063] In this embodiment, the screening of the annealing temperature of Pseudostigma heterophylla TaqMan qPCR is included, specifically:

[0064] The plasmid standards of two viruses of Pseudomonas heterophylla (10 9The co-detection system of two heavy viruses, BBWV2-RNA2 and TuMV, was optimized by using 1000 copies / μL) as a template, and the optimal concentration of primers and probes and the optimal annealing temperature for the highest amplification efficiency were screened. First, the reaction system was set to 20μL, of which 10μL was amplification enzyme solution (AceQ Universal U+Probe MasterMix V2, Vayzme, China). At the same time, two pairs of primers and two probes were combined, and the primer concentration and probe concentration were set to 0.2μM and 0.1μM, respectively. Amplification was performed on the BioRad CFX Manager instrument. The amplification program was set to: 37℃2min; 95℃5min, 95℃10s, (56~64℃)30s, 45 cycles, of which the annealing temperatures were set to: 56℃, 58℃, 60℃, 62℃, 64℃, and each annealing temperature condition was repeated 3 times. Then, the optimal amplification annealing temperature was screened based on factors such as Cq value, fluorescence increment, amplification efficiency, and plateau phase. The optimized annealing temperature was: 64°C, with the best reaction effect. Both TaqMan qPCR of the two viruses showed a smooth S-shaped curve, and the Cq value was the smallest. Finally, 64°C was selected as the annealing temperature for the co-detection of the two viruses of P. heterophylla, refer to Table 2.

[0065] Table 2 Cq values ​​of dual virus TaqMan qPCR co-detection at different annealing temperatures

[0066]

[0067] In this embodiment, the optimization of the Pseudostigma Pseudostigma TaqMan qPCR amplification system is included, specifically:

[0068] On the basis of optimizing the annealing temperature of TaqMan qPCR for two viruses of Pseudospermum officinale, the combination of primer and probe concentration in the TaqMan qPCR co-detection system of two viruses was further screened. Then, the optimal combination of primer and probe concentration in the co-detection system was screened based on factors such as Cq value, fluorescence increment, amplification efficiency, and plateau phase. The results showed that when the primer concentration and probe concentration of the two viruses in the TaqMan qPCR system were 0.1μM and 0.2μM, respectively, the Cq values ​​of the co-detection of BBWV2 and TuMV viruses were similar and both were low. Therefore, in the co-detection of two viruses of Pseudospermum officinale, the 0.1μM primer concentration and the 0.2μM probe concentration were the optimal conditions for the TaqMan qPCR co-detection system of two viruses of Pseudospermum officinale, refer to Table 3. After optimization, the complete system of TaqMan qPCR co-detection of two viruses in P. heterophylla was set as follows: total reaction volume 20 μL, amplification enzyme mixture (AceQ Universal U+Probe Master Mix V2, Vayzme, China) 10 μL, 2 pairs of upstream and downstream primers (10 μmol / L) 0.2 μL each, 2 pairs of TaqMan probes 0.4 μL each (10 μmol / L), cDNA template 1 pg-5 μg, ddH2O fill to 20 μL;

[0069] The optimal reaction conditions for TaqMan qPCR are: 37°C for 2 min; 95°C for 5 min; 95°C for 10 sec, 64°C for 30 sec, 45 cycles, see Table 4.

[0070] Table 3 Cq values ​​of TaqMan qPCR co-detection of two viruses at different primer and probe concentration combinations

[0071]

[0072] Table 4 Composition of TaqMan qPCR co-detection reaction system for two viruses in Pseudostellaria heterophylla

[0073]

[0074] In this embodiment, the stability, specificity and repeatability of the Pseudostellariae TaqMan qPCR co-detection system were verified, specifically:

[0075] The detection limit threshold of TaqMan qPCR of two viruses in Pseudomonas heterophylla was analyzed. The plasmid standards of BBWV2-RNA2 and TuMV were diluted 10 times (10 5 copy / μL-10 0The TaqMan qPCR amplification Cq values ​​were obtained under different concentrations of virus templates. Results In the detection of two core viruses of Pseudomonas heterophylla, the lowest detection threshold of BBWV2 was 2.38×10 1 copies / μL, and the minimum detection threshold of TuMV was 1.12×10 3 copies / μL, indicating that the two-virus TaqMan qPCR co-detection system of the present invention has a high sensitivity. Figure 1 as well as Figure 2 ;

[0076] Figure 1 Medium, 1:2.38×10 5 copy / μL; 2: 2.38×10 4 copy / μL; 3: 2.38×10 3 copy / μL; 4: 2.38×10 2 copy / μL; 5: 2.38×10 1 copy / μL; 6: 2.38×10 0 copy / μL;

[0077] Figure 2 Medium, 1:1.12×10 5 copy / μL; 2: 1.12×10 4 copy / μL; 3: 1.12×10 3 copy / μL; 4: 1.12×10 2 copy / μL; 5: 1.12×10 1 copy / μL; 6: 1.12×10 0 copy / μL.

[0078] In this example, the repeatability of the TaqMan qPCR detection system for two viruses of Pseudomonas heterophylla was verified. 6 copy / μL-10 4 The plasmid standard of 10000 copies / μL was used as a template to perform intra-group and inter-group repeatability tests. The intra-group coefficient of variation of BBWV2 was 0.41% to 1.02%, and the inter-group coefficient of variation was between 0.48% and 0.62%, both less than 1.1%; the intra-group coefficient of variation of TuMV was 0.42% to 0.86%, and the inter-group coefficient of variation was between 0.16% and 0.71%, both less than 1.2%, refer to Table 5. The intra-group and inter-group repeatability test coefficients were both less than 1.2%, indicating that the TaqMan qPCR co-detection system of two viruses of Pseudostellaria heterophylla established by the present invention has good repeatability and stability.

[0079] Table 5 Repeatability of TaqMan qPCR system for two viruses in Pseudostigma heterophylla

[0080]

[0081] In this embodiment, the linear equation (standard curve relationship) between the Cq value of Pseudostellariae TaqMan qPCR amplification and the viral load is included:

[0082] In order to quantify the concentration of BBWV2 and TuMV viruses, a linear relationship between copy number and qPCR Cq needs to be established. 3 ~10 9 The plasmid standards with 7 concentrations of different copies / μL were used as templates, and amplified according to the optimized reaction conditions. The standard curve was drawn with the Cq value as the ordinate and the logarithm of the initial copy number of the plasmid standard (LogX) as the abscissa. The linear equations of the plasmid standards of the two viruses were obtained respectively: the standard curve of BBWV2 was y=-3.3208x+40.302, and the correlation coefficient (R 2 ) is 0.9952, and the amplification efficiency (E) is 100.0471% ( Figure 3 ); the standard curve of TuMV is y=-3.5123x+42.692, the correlation coefficient (R2) is 0.9935, and the amplification efficiency (E) is 92.6003% ( Figure 4 The correlation coefficients (R2) of the standard curves of BBWV2 and TuMV TaqMan qPCR were all above 0.992, indicating that there was a good linear relationship between the starting template number of different virus concentrations and their Cq values. Figure 3 and Figure 4 In the figure, the X-axis is the logarithm of the plasmid copy number; the Y-axis is the Cq value.

[0083] In this embodiment, a VBA data processing module is established using Excel VBA code, and the VBA data processing module includes an import module, a data processing module and an output module;

[0084] The import module is used to import the Cq value obtained by TaqMan qPCR amplification of the corresponding virus sequence in the sample to be tested obtained by S2;

[0085] The step of processing data by the processing module comprises:

[0086] The Cq value of the imported corresponding viral sequence amplification is substituted into the standard curve relationship to obtain the logarithmic value of the template initial copy number, and the corresponding copy number is obtained by converting the logarithmic value;

[0087] The output module is used to output the obtained copy number.

[0088] Use Excel's VBA code to create the program interface of the VBA data processing module. Figure 5 and Figure 6 As shown;

[0089] In order to test the effectiveness of the TaqMan qPCR co-detection system and conversion program for two viruses of Radix Pseudostellariae established in the present invention, 16 Radix Pseudostellariae samples were randomly sampled from different Radix Pseudostellariae planting areas in Zherong County, the Radix Pseudostellariae production area. The total RNA extraction method and quantitative detection system described in this patent were used to detect the two core viruses in different samples, and the Cq values ​​of the viruses in different samples were preliminarily obtained. The Excel VBA program developed by the present invention was further used to quickly convert the Cq values ​​of different viruses with the viral load. As a result, the distribution of virus content in Radix Pseudostellariae plants planted in the main Radix Pseudostellariae production areas can be quickly obtained ( Figure 7 , Table 6, Table 7).

[0090] Table 6 Cq values ​​obtained by TaqMan qPCR detection of two core viruses in Pseudostellaria heterophylla plants in the main production areas using the present invention

[0091]

[0092]

[0093] Table 7 Rapid calculation results of viral load of Pseudostellaria heterophylla plants using the program established by the present invention

[0094]

[0095] In this embodiment, the code including using Excel VBA code to establish the VBA data processing module is as follows:

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106] The above descriptions are merely embodiments of the present invention, and are not intended to limit the patent scope of the present invention. Any equivalent transformations made using the contents of the present invention's specification and drawings, or directly or indirectly applied in related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. Quantitative detection method and rapid analysis procedure of TuMV and BBWV2 viruses in Pseudostellaria heterophylla. It is characterized in that The following steps are involved: S1: Prepare viral plasmid standards, the viral plasmid standards are BBWV2 and TuMV, dilute the viral plasmid standards by 10-fold gradients, use them as templates, amplify by TaqMan qPCR, obtain the Cq value of the corresponding template, establish a rectangular coordinate system with the Cq value as the ordinate and the logarithm of the starting copy number of the plasmid standard as the abscissa, and represent multiple discrete points in the rectangular coordinate system according to the logarithmic relationship between the Cq value and the starting copy number corresponding to each template; obtain a standard curve relationship formula of the mapping relationship between the Cq value and the logarithm of the starting copy number according to the multiple discrete points; S2: Amplify the sample to be tested under the same TaqMan qPCR conditions as in S1 to obtain the Cq value of the corresponding viral sequence amplification; S3: Using Excel VBA code to establish a VBA data processing module, the VBA data processing module includes an import module, a data processing module and an output module; The import module is used to import the Cq value obtained by TaqMan qPCR amplification of the corresponding virus sequence in the sample to be tested obtained by S2; The step of processing data by the processing module comprises: The Cq value of the imported corresponding viral sequence amplification is substituted into the standard curve relationship to obtain the logarithmic value of the template initial copy number, and the corresponding copy number is obtained by converting the logarithmic value; The output module is used to output the obtained copy number.

2. The quantitative detection method for TuMV and BBWV2 viruses of Pseudostellariae Pseudostellariae according to claim 1 and its rapid analysis procedure, It is characterized in that In S1, the logarithm of the plasmid copy number of the viral plasmid standard is 10, and "using the viral plasmid standard copy number as a template after being diluted by 10 times" specifically means: selecting 10 3 ~10 9 The plasmid standard with 7 concentrations was used as template according to 10-fold gradient copy / μL.

3. The quantitative detection method of TuMV and BBWV2 viruses of Pseudostellariae Pseudostellariae according to claim 2 and its rapid analysis program, It is characterized in that When the viral plasmid standard is BBWV2, the standard curve is y=-3.3208x+40.302, where y is the Cq value and x is the logarithm of the initial copy number of BBWV2.

4. The quantitative detection method for TuMV and BBWV2 viruses of Pseudostellariae Pseudostellariae according to claim 2 and its rapid analysis procedure, It is characterized in that When the viral plasmid standard is TuMV, the standard curve is y=-3.5123x+42.692, where y is the Cq value and x is the logarithm of the initial copy number of TuMV.

5. The quantitative detection method of TuMV and BBWV2 viruses of Pseudostellariae Pseudostellariae according to claim 2 and its rapid analysis program, It is characterized in that In S1 and S2, the TaqMan qPCR reaction system is: Among them, BBWV2-F and BBWV2-R are primers designed based on the conserved region of RNA2 strand of BBWV2; Among them, BBWV2-Probe is a TaqMan probe designed based on the conserved region of RNA2 strand of BBWV2; Among them, TuMV-F and TuMV-R are primers designed based on the conserved region of the TuMV sequence; Among them, TuMV-Probe is a TaqMan probe designed based on the conserved region of the TuMV sequence; The 5'-3' sequence of BBWV2-F is: CCTTTTGTTCGGTTGTTGCA The 5'-3' sequence of BBWV2-R is: ATTCTCATGAGCTGAAACTGTCAA The 5'-3' sequence of BBWV2-Probe is: HEX-TGAGAGGTCCTTCTGTAaCTCATGTAACAGAG-BHQ2 The 5'-3' sequence of TuMV-F is: CGTAGCTGAAGCGTACATTGAA The 5'-3' sequence of TuMV-R is: TTGCGCTGAAGACCATATCG The 5'-3' sequence of TuMV-Probe is: FAM-AGCGTAACCAAGACCGACCATACATGC-BHQ1 The reaction conditions of TaqMan qPCR were: 37°C for 2 min; 95°C for 5 min; 95°C for 10 sec, 64°C for 30 sec, and 45 cycles.

6. The quantitative detection method for TuMV and BBWV2 viruses of Pseudostellariae Pseudostellariae according to claim 1 and its rapid analysis procedure, It is characterized in that In S2, the method for processing the sample to be tested is: extracting RNA from the Pseudostellaria heterophylla tissue sample, and reverse transcribing it to obtain cDNA.

7. The quantitative detection method for TuMV and BBWV2 viruses of Pseudostellariae Pseudostellariae according to claim 1 and its rapid analysis procedure, It is characterized in that In S3, the step of processing data by the data processing module further includes: According to the Cq value of the imported corresponding virus sequence amplification, it is judged whether the Cq value of the corresponding virus sequence amplification of the sample to be tested is valid and whether it is positive, specifically: If the Cq value is between 0 and 35, it is judged as effective and positive; If the Cq value is NA, it is judged as negative; If the Cq value is greater than 35, it is judged as invalid and needs to be re-tested to obtain the Cq value. If the Cq value result is still greater than 35 or is NA, it is judged as negative, otherwise it is judged as positive.

8. The quantitative detection method for TuMV and BBWV2 viruses of Pseudostellariae Pseudostellariae according to claim 1 and its rapid analysis procedure, It is characterized in that In S1, the steps for preparing viral plasmid standards are as follows: Extract RNA from Pseudostellariae Radix tissue samples, reverse transcribe to obtain cDNA, use cDNA as template, perform PCR amplification with primers of viral conserved sequences, link the amplified cDNA fragment to the vector plasmid, obtain the viral plasmid, transfer the viral plasmid into competent cells, pick a single clone, extract the plasmid after sufficient proliferation, and adjust the final concentration of the plasmid according to the following formula: Plasmid copy number = 6.02 × 10 23 × plasmid concentration / (plasmid length × 660) The unit of plasmid copy number is copies / μL, the logarithm of plasmid copy number is 10, and the unit of plasmid concentration is ng / μL×10 -9 .

9. The quantitative detection method for TuMV and BBWV2 viruses of Pseudostellariae Pseudostellariae according to claim 8 and its rapid analysis procedure, It is characterized in that When the viral plasmid standard is BBWV2, the plasmid copy number is 2.38×10 10 copies / μL, the plasmid concentration is 146.2ng / μL; when the viral plasmid standard is BBWV2, the plasmid copy number is 1.12×10 10 copies / μL, and the plasmid concentration was 145.8ng / μL.

Images