Construction method and application of random polypeptide AD yeast library

Abstract

The invention discloses a construction method of a random polypeptide AD yeast library, which comprises the following steps: synthesizing a random fragment, carrying out PCR (Polymerase Chain Reaction) amplification, and using a fragment amplification primer to obtain a double-chain sequence; the method comprises the following steps: constructing a PCR (Polymerase Chain Reaction) product into an entry vector by utilizing Gateway BP reaction to form a primary library; 2, constructing the plasmid library in the step 2 into a target vector through Gateway LR reaction to generate a yeast two-hybrid AD plasmid library; and transforming the secondary plasmid library into a yeast strain Y187 to form a random peptide library marked by Y187AD. The method has the advantages that the operability is high, and operation and library construction are easy; diversity and complexity are realized; the method has high reliability and sensitivity; polypeptide ligands with high affinity and specificity can be effectively screened out; the rapid screening function is achieved, and the screening efficiency is improved; the method can be applied to various research fields.

Description

Technical Field

[0001] The present invention relates to a construction method and application of a random polypeptide AD yeast library, in particular to a construction method and application of a 20-amino acid random polypeptide AD yeast library, belonging to the technical field of bioengineering. Background Art

[0002] Yeast two-hybrid (Y2H) is a commonly used protein interaction research method and is widely used in the field of biological research. The technology was first proposed by Stanley Fields and Ok-Kyu Song in 1989 and implemented in yeast cells. Yeast two-hybrid technology detects protein-protein interactions based on the interaction between the two functional domains of proteins. The technology uses the fact that transcription factors in yeast cells are divided into two parts: DNA-binding domain (DBD) and activation domain (AD). When the two proteins bind, DBD binds to the promoter of the target gene, and AD interacts with the transcription activator to promote the transcription of the target gene. Yeast two-hybrid technology is mainly divided into two basic steps: constructing a yeast two-hybrid library and identifying protein interactions. In the library construction stage, the DNA sequence of the target protein is cloned into the expression vector constructed by AD fusion to form an AD-target protein fusion protein; at the same time, the DNA sequence in the large-scale constructed library is cloned into the expression vector constructed by DBD fusion to form a DBD-library fusion protein. In the protein interaction identification stage, AD-target protein and DBD-library fusion protein are co-transformed into yeast cells, and the interaction between proteins is determined by detecting the transcriptional activity of the target gene in yeast cells. Yeast two-hybrid technology has many advantages, such as high throughput, relative simplicity, and high sensitivity. It has been widely used in the study of protein interaction networks, analysis of protein functions, exploration of signal transduction pathways, and other fields. However, yeast two-hybrid technology also has some limitations, such as the generation of false positive and false negative results, and cannot be directly applied to membrane proteins, etc. Therefore, there is an urgent need for a tool that is highly operable, diverse and complex, highly reliable and sensitive, and can be quickly screened and widely applicable to multiple research fields to explore protein interactions and functions. Summary of the invention

[0003] The technical problem to be solved by the present invention is to provide a method for constructing a random polypeptide AD yeast library and its application.

[0004] The present invention is achieved through the following scheme: a method for constructing a random polypeptide AD yeast library, which comprises the following steps:

[0005] Step 1: synthesizing random fragments and performing PCR amplification, using fragment amplification primers to obtain a double-stranded sequence;

[0006] Step 2: Use the Gateway BP reaction to construct the PCR product into the entry vector to form a primary library;

[0007] Step 3: construct the plasmid library in step 2 into the destination vector through Gateway LR reaction to generate a yeast two-hybrid AD plasmid library;

[0008] Step 4: Transform the secondary plasmid library into yeast strain Y187 to form a Y187 AD-labeled random peptide library.

[0009] Step one includes the design of random polypeptide fragments and linker primers and the synthesis of DNA fragment amplification of 20 amino acid random polypeptide segments. The design of random polypeptide fragments and linker primers includes the design of gateway-compatible vector linkers, random peptide library fragment design, random polypeptide sequence, random polypeptide single-chain synthesis and amplification primer design. The synthesis of DNA fragment amplification of 20 amino acid random polypeptide segments includes fragment synthesis, random fragment amplification, and magnetic bead recovery of amplified fragments.

[0010] The amplification primers include an upstream amplification primer Primer1 and a downstream amplification primer Primer2. The upstream amplification primer Primer1 is: TCGTCGGGGACAACTTTGTACAAAAAAGTTGGAACC, and the downstream amplification primer Primer2 is: GGCGGCCGCACAACTTTGTACAAGAAAGTTGGGTCTTA.

[0011] Fragment synthesis: Synthesize Fragment 1, Primer 1, and Primer 2 and dissolve them in sterile water to a final concentration of 10 mM.

[0012] Random fragment amplification: high-fidelity enzyme was used, Fragment1 was used as template, Primer1 and Primer2 were used as primers for PCR amplification, and the PCR amplification temperature was as follows: 94°C for 30s in the denaturation stage; 28 cycles were used in the annealing stage: 94°C for 30s; 58°C for 45s; 72°C for 30s; and 72°C for 5min in the extension stage.

[0013] Amplified fragment magnetic bead recovery: Magnetic bead recovery fragment, remove primers, fragment length 134bp.

[0014] The construction method of step 2 is as follows: amplified fragment BP recombination, recombination product protein removal, recombination product recovery, recombination product E. coli transformation, primary library quality detection, primary library construction library capacity calculation, and primary library preservation.

[0015] The construction method of step three is as follows: plasmid extraction of primary library, library plasmid LR reaction recombination, deproteinization of recombination product, recovery of recombination product, E. coli transformation of recombinant product, secondary library quality detection, secondary library construction library capacity calculation, secondary library insert fragment detection, and secondary library preservation.

[0016] Step 4: The method for constructing the yeast Y187 hybrid library is as follows: plasmid extraction of the secondary library, transformation of the secondary library plasmid into the Y187 yeast strain, and collection of yeast library transformants.

[0017] Application of random peptide AD yeast library in protein-protein interaction research, signal transduction pathway analysis, drug discovery and protein engineering.

[0018] The beneficial effects of the present invention are:

[0019] 1. The present invention is highly operable and has the characteristics of being easy to operate and construct a library. By constructing a yeast random polypeptide library through the present invention, large-scale polypeptide screening can be conveniently performed;

[0020] 2. The present invention has diversity and complexity: by screening the yeast random peptide library of the present invention, peptide sequences that interact with multiple target proteins can be obtained, and the complexity of the protein interaction network can be more fully understood;

[0021] 3. The present invention has high reliability and sensitivity: The yeast random peptide library screening of the present invention has high reliability and sensitivity, provides a natural environment to identify the interaction between the peptide and the target protein, and can effectively screen out peptide ligands with high affinity and specificity;

[0022] 4. The present invention has a rapid screening function: the interaction screening between the polypeptide and the target protein in yeast cells can be completed in a short time, and can be accelerated by a high-throughput screening method to improve the screening efficiency;

[0023] 5. The present invention can be applied to a variety of research fields: it is widely used in protein interaction research, signal transduction pathway analysis, drug discovery and protein engineering. By screening out polypeptide sequences that interact with target proteins, important information on protein function, structure and interaction can be revealed. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 For the entry library constructed using pDONR227, the cyan bar graph shows the DNA sequence encoding the random peptide library.

[0025] Figure 2 This is a picture showing the capacity of the primary library.

[0026] Figure 3 For the secondary library constructed using pGADT7 GW, the grey bars show the DNA sequences encoding the random peptide library.

[0027] Figure 4 This is the image of the secondary library capacity identification.

[0028] Figure 5 Identify images for insert segment length,

[0029] Figure 6 Quality detection of the constructed 20-amino acid random peptide AD library. (A) Saturation detection of the library; (B) Random peptide length distribution. DETAILED DESCRIPTION

[0030] Combine the following Figure 1-6 The present invention is further described, but the protection scope of the present invention is not limited to the described contents.

[0031] For the sake of clarity, not all features of an actual embodiment are described. In the following description, well-known functions and structures are not described in detail because they would obscure the invention with unnecessary detail. It should be recognized that in the development of any actual embodiment, a large number of implementation details must be made to achieve the specific goals of the developer, such as changing from one embodiment to another according to relevant system or relevant business limitations. In addition, it should be recognized that such development work may be complex and time-consuming, but it is merely routine work for those skilled in the art.

[0032] A method for constructing a random peptide AD yeast library comprises the following steps:

[0033] Step 1: A random fragment (Fragment-1) was synthesized and PCR amplified, and a double-stranded sequence was obtained using fragment amplification primers (Primer 1, Primer 2); the specific steps are as follows:

[0034] 1. Design of random peptide fragments and adapter primers

[0035] 1.1 Designed to be compatible with gateway carrier connectors

[0036] attB1 forward primer(amino-terminal)

[0037] Lys-Lys

[0038] 5#-TCGTCGGGGACA ACT TTG TAC AAA AAA GTT GGA ANN--(template-specificsequence)-3#

[0039] attB1

[0040] attB2 reverse primer(carboxy-terminal):

[0041] Lys-Tyr

[0042] 5#-GGCGGCCGCAC AAC TTT GTA CAA GAA AGT TGG GTN--(template-specificsequence)-3#

[0043] attB2

[0044] 1.2 Random peptide library fragment design

[0045] TCGTCGGGGACA ACT TTG TAC AAA AAA GTT GGA ANN-(NNK)20-TAA NAC CCA ACTTTC TTG TAC AAA GTT GTGCGGCCGCC

[0046] Length: 9 (protection bases)-25 (attb1)-2 (in-frame)-60 (random library)-3 (stopcodon)-1 (in-frame)-25 (attb2)-9 (protection bases), a total of 134 bp

[0047] The first two NNs are translated as CC and ACC as T, which is a neutral amino acid.

[0048] The last N is replaced by G, and TAA is added in front as a stop codon.

[0049] 1.3 Random peptide sequences

[0050] TCGTCGGGGACA ACT TTG TAC AAA AAA GTT GGA ACC-(NNK)20-TAA GAC CCA ACTTTC TTG TAC AAA GTT GTGCGGCCGCC

[0051] (NNK)20:NNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNK

[0052] 1.4 Random peptide single-chain synthesis

[0053] >Random Fragment_134bp(Random Fragment 1)

[0054] TCGTCGGGGACAACTTTGTACAAAAAAGTTGGAACCNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNN KNNKNNKNNKNNKNNKNNKNNKNNKTAAGAC CCA ACT TTC TTG TAC AAA GTT GTGCGGCCGCC

[0055] 1.5 Amplification primer design

[0056] Upstream amplification primer (Primer 1): TCGTCGGGGACAACTTTGTACAAAAAAGTTGGAACC

[0057] Downstream amplification primer (Primer 2): GGCGGCCGCACAACTTTGTACAAGAAAGTTGGGTCTTA

[0058] Remark:

[0059] N:any Nucleotide,(not a gap),A / T / C / G

[0060] K: Keto, G / T

[0061] 2. Amplification of DNA fragments synthesizing 20aa random peptide segments

[0062] 2.1 Fragment synthesis: Fragment 1, Primer 1, and Primer 2 were synthesized by a biological company. Sterile water was added to dissolve the final concentration to 10 mM.

[0063] 2.2 Random fragment amplification: Use high-fidelity enzyme, Fragment 1 as template, Primer 1 and Primer 2 as primers for PCR amplification. The amplification system is (20ul system).

[0064] dd H20, 8uL;

[0065] 2× Primer Max MIX, 10uL;

[0066] Fragment 1(10um),1uL

[0067] Primer 1(10um),1uL

[0068] Total Volume:20uL.

[0069] The PCR amplification temperature was as follows: 94°C for 30 s in the denaturation phase; 28 cycles in the annealing phase: 94°C for 30 s; 58°C for 45 s; 72°C for 30 s; and 72°C for 5 min in the extension phase.

[0070] 2.3 Recovery of amplified fragments using magnetic beads: The fragments were recovered using magnetic beads and the primers were removed. The fragment length was 134 bp.

[0071] Step 2: Use Gateway BP reaction to construct the PCR product into the entry vector pDONR222 to form the primary library pDONR222-random peptide (see Figure 1 ); the specific steps are as follows:

[0072] Construction of pDONR222 entry vector library (primary library construction)

[0073] Amplified fragment BP recombination: Prepare 20uL BP recombination system in a sterile 1.5ml centrifuge tube at room temperature ( Figure 1 ), recovered fragment 13ul

[0074] pDONR222 (300 ng / ul) 2ul

[0075] BP Clonase II Mix 5ul

[0076] Total Volume 20ul

[0077] After mixing, place at 25°C for 16-20 hours.

[0078] Deproteinization of the recombinant product: Add 2ul of ProreinaseK to the BP recombinant reaction system and incubate at 37℃ for 15min and 75℃ for 10min;

[0079] Recovery of recombinant products: Add 80ul dd-water to the product to a total volume of 100uL, add 1ul of 20ug / ul Glycogen, 50ul of 5M NH4OAc, and 500ul of 100% ethanol. Mix well and place at -80℃ for 15min; centrifuge at 14,000rpm, 4℃ for 25min, remove the supernatant; add 1ml 70% ice-cold ethanol to wash, centrifuge at 14,000rpm, 4℃ for 3min, remove the supernatant; add 1ml 70% ice-cold ethanol to wash, centrifuge at 14,000rpm, 4℃ for 3min, remove the supernatant; dry the recombinant product at room temperature for 5-10min; dissolve the recombinant product with 8ul of deionized water;

[0080] Transformation of recombinant product into E. coli: Add the recombinant product into 50 μl of ElectroMAX DH10B cells, then transfer to the electroporation cup and operate according to the instructions of the electroporation instrument; after electroporation, add 2 ml of SOC medium into the electroporation cup, aspirate the bacterial solution into a 15 ml centrifuge tube, and culture in a shaking incubator at 37°C for 1 hour;

[0081] Primary library quality test: Take out 0.001ul of the above bacterial culture solution and apply it to the LB plate, and culture it in a 37°C incubator overnight; count the number of colonies on the plate, and calculate the library capacity based on the number of colonies contained in 2ml of cell culture solution;

[0082] Primary library construction library capacity calculation: CFU / mL of transformation plate (plate dilution 1:1000): CFU / mL = 202 / 50uL × 1000 × 1000uL = 4.0 × 106cfu / mL; total number of clones CFU = 4.0 × 106cfu / mL × 2mL = 8.0 × 106cfu ( Figure 2 ).

[0083] Preservation of primary library: Add 1 / 2 volume of 60% glycerol to the above bacterial culture solution, mix well, and store in a -80°C refrigerator.

[0084] Step 3: Use Gateway LR reaction to construct the pDONR207-random peptide plasmid library into the destination vector pGADT7-GW (see Figure 3 ), a yeast two-hybrid AD plasmid library was generated; the specific steps are as follows:

[0085] Construction of pGADT7-20aa vector library (secondary library)

[0086] Plasmid extraction of primary library: Take the library liquid containing 5×106-1×107 positive clones and inoculate it into 100mL LB culture containing kanamycin (working concentration 50ug / mL), and culture it at 30℃220rpm until OD600 is 1.0. HiPure Plasmid Filter Midiprep Kit was used to extract the library plasmid.

[0087] Library plasmid LR reaction recombination: dilute the obtained primary library plasmid to 300ng / uL, and add the components as shown in the table below ( Figure 3 ).

[0088] Primary library plasmid (300ng / ul) 1ul

[0089] pGADT7-gw (300ng / ul) 1ul

[0090] LR Clonase II Mix 4ul

[0091] ddH2O 14ul

[0092] Total Volume 20ul

[0093] After mixing, incubate at 25°C for 16-20 hours to perform LR recombination reaction.

[0094] Deproteinization of the recombinant product: Add 2ul of ProreinaseK to the BP recombinant reaction system and incubate at 37℃ for 15min and 75℃ for 10min;

[0095] Recovery of recombinant products: Add 180ul dd-water to the product to a total volume of 200uL, add 2ul of 20ug / ul Glycogen, 100ul of 5M NH4OAc, and 1000ul of 100% ethanol. Mix well and place at -80℃ for 15min; centrifuge at 14,000rpm, 4℃ for 25min, remove the supernatant; add 1ml 70% ice-cold ethanol to wash, centrifuge at 14,000rpm, 4℃ for 3min, remove the supernatant; add 1ml 70% ice-cold ethanol to wash, centrifuge at 14,000rpm, 4℃ for 3min, remove the supernatant; dry the recombinant product at room temperature for 5-10min; dissolve the recombinant product with 8ul of 0.5×TE buffer;

[0096] Transformation of recombinant product into E. coli: Add the recombinant product into 50 μl of ElectroMAX DH10B cells, then transfer to the electroporation cup and operate according to the instructions of the electroporation instrument; after electroporation, add 2 ml of SOC medium into the electroporation cup, aspirate the bacterial solution into a 15 ml centrifuge tube, and culture in a shaking incubator at 37°C for 1 hour;

[0097] Secondary library quality test: Take out 0.001ul of the above bacterial culture solution and apply it to the LB plate, and culture it in a 37°C incubator overnight; count the number of colonies on the plate, and calculate the library capacity based on the number of colonies contained in 2ml of cell culture solution;

[0098] Secondary library construction library capacity calculation: CFU / mL of transformation plate (plate dilution 1:1000): CFU / mL = 237 / 50uL × 1000 × 1000uL = 4.7 × 106cfu / mL; total number of clones CFU = 4.7 × 106cfu / mL × 2mL = 9.4 × 106cfu ( Figure 4 ).

[0099] Secondary library insert fragment detection: 25 clones were randomly selected for colony PCR identification, T7 and ADR universal primers were used to prepare PCR reaction, and then the length of the amplified fragment was detected by agarose gel electrophoresis. The secondary library detection results of the present invention are that all 25 clones are positive, and the length of the PCR fragment is in line with expectations, all of which are about 250bp fragments. Therefore, the recombination rate = number of successful recombination / total number of clones*100%=25 / 25*100%=100%( Figure 5 ).

[0100] Secondary library preservation: Add 1 / 2 volume of 60% glycerol to the above bacterial culture solution, mix well, and store in a -80°C refrigerator.

[0101] Step 4: Transform the secondary plasmid library (pGADT7 GW-random peptide) into yeast strain Y187 to form a Y187 AD-labeled random peptide library, with the following steps:

[0102] Yeast Y187 hybrid library construction

[0103] Plasmid extraction of secondary library: Take the library liquid containing 5×106-1×107 positive clones and inoculate it into 100mL LB culture containing ampicillin (working concentration 100ug / mL), and culture it at 30℃220rpm until OD600 is 1.0. HiPure Plasmid Filter Midiprep Kit was used to extract the library plasmid.

[0104] Secondary library plasmid transformation of Y187 yeast strain: prepare competent cells of yeast Y187; take a sterile pre-cooled 15ml centrifuge tube, add 5μg secondary library plasmid, 20μl pre-denatured Carrier DNA, 600μl yeast competent cells, and gently vortex to mix; add 2.5ml 1x PEG / LiAc solution, and gently vortex to mix; in a 30℃ water bath for 45min, mix every 15min; add 160μl DMSO and mix; heat shock in a 42℃ water bath for 20min, mix every 10min by inverting; centrifuge at 700g for 5min; discard the supernatant and resuspend with 1ml YPD liquid culture medium; shake and recover culture at 30℃ for an appropriate time (1.5h); centrifuge at 700g for 5min; discard the supernatant and resuspend the cells with 30ml 0.9% NaCl solution;

[0105] Yeast library transformant collection: spread the suspension on 150mm SD / -Leu plates, 300μl / plate, 100 plates in total; culture in a 30℃ constant temperature incubator for 3-5 days until a single clone grows to a size of 1-2mm; after the above 100 plates are cultured, take them out and cool them at 4℃ for 3-4h; add 5ml freezing medium to each plate; use a sterile glass rod to gently scrape the cells into the freezing medium; collect all the liquid into a flask (about 500ml) and mix well; use a hemocytometer to calculate the cell density; dispense into 1.5ml sterile centrifuge tubes, 1ml per tube, for a total of 100 tubes, which is the yeast working solution; dispense the remaining solution into 50ml centrifuge tubes, which is the yeast mother solution.

[0106] Estimation of library capacity:

[0107] Insert amplification: A 150 bp insert was amplified using primers CCAGATTACGCTCATATGACAAGTTTGTAC and TCATCTGCAGCTCGAGACCACTTTGTACAA.

[0108] Amplification product sequencing: The constructed library was sequenced using the Illumina Novaseq 6000 platform according to the instructions of ANNOROAD Biotech.Co.,Ltd.(China) to generate raw data. After quality control, about 34.5GB of clean data was generated.

[0109] Random peptide short sequence acquisition: 60bp random sequence was extracted from clean reads, and the linker was removed to obtain the sequence according to the design principle (TCGTCGGGGACAACTTTGTACAAAAAAGTTGGAACC-(NNK)20-TAAGACCCAACTTTCTTGTACAAAGTTGTGCGGCCGCC), and it was converted into amino acid sequence using the standard genetic code. The conversion stopped at the first stop codon, and peptides with a length of less than 5 amino acids after translation were removed.

[0110] Library capacity evaluation of the present invention: A total of 6,8190,232 peptides were obtained, and 3,359,176 peptides were obtained after removing redundancy. We performed saturation analysis and found that about 35GB of data is far from covering all types of peptides in the random peptide library ( Figure 6 A), indicating that our random peptide library has high diversity and broad potential for protein interaction studies and applications.

[0111] The random peptide length evaluation of the library involved in the present invention: The distribution of random peptides of 5-20 amino acids was evaluated, and the results showed that random peptides of 20 aa accounted for about 25% ( Figure 6 B).

[0112] Although the technical solutions of the present invention have been described and listed in detail, it should be understood that it is obvious to those skilled in the art to make modifications to the above embodiments or adopt equivalent alternatives. These modifications or improvements made without departing from the spirit of the present invention are within the scope of protection required by the present invention.

Claims

1. A method for constructing a random peptide AD yeast library. It is characterized in that It includes the following steps: Step 1: synthesizing random fragments and performing PCR amplification, using fragment amplification primers to obtain a double-stranded sequence; Step 2: Use the Gateway BP reaction to construct the PCR product into the entry vector to form a primary library; Step 3: construct the plasmid library in step 2 into the destination vector through Gateway LR reaction to generate a yeast two-hybrid AD plasmid library; Step 4: Transform the secondary plasmid library into yeast strain Y187 to form a Y187 AD-labeled random peptide library.

2. A method for constructing a random peptide AD yeast library according to claim 1, It is characterized in that The step 1 includes the design of random polypeptide fragments and linker primers and the amplification of DNA fragments synthesizing 20 amino acid random polypeptide fragments. The design of random polypeptide fragments and linker primers includes the design of gateway-compatible entry vector linkers, random peptide library fragment design, random polypeptide sequence, random polypeptide single-chain synthesis and amplification primer design. The amplification of DNA fragments synthesizing 20 amino acid random polypeptide fragments includes fragment synthesis, random fragment amplification, and magnetic bead recovery of amplified fragments.

3. A method for constructing a random peptide AD yeast library according to claim 2, It is characterized in that The amplification primers include an upstream amplification primer Primer1 and a downstream amplification primer Primer2, the upstream amplification primer Primer1 is: TCGTCGGGGACAACTTTGTACAAAAAAGTTGGAACC, and the downstream amplification primer Primer2 is: GGCGGCCGCACAACTTTGTACAAGAAAGTTGGGTCTTA.

4. The method for constructing a random peptide AD yeast library according to claim 2, It is characterized in that The fragment synthesis: Fragment 1, Primer 1, and Primer 2 were synthesized and dissolved in sterile water to a final concentration of 10 mM.

5. The method for constructing a random peptide AD yeast library according to claim 2, It is characterized in that The random fragment amplification: a high-fidelity enzyme is used, Fragment1 is used as a template, Primer1 and Primer2 are used as primers for PCR amplification, and the PCR amplification temperature is: 94°C for 30s in the denaturation stage; 28 cycles are used in the annealing stage: 94°C for 30s; 58°C for 45s; 72°C for 30s; and 72°C for 5min in the extension stage.

6. The method for constructing a random peptide AD yeast library according to claim 2, It is characterized in that The amplified fragment magnetic bead recovery: the magnetic bead recovery fragment, the primer is removed, and the fragment length is 134bp.

7. The method for constructing a random peptide AD yeast library according to claim 1, Features: The construction method of step 2 is as follows: amplified fragment BP recombination, recombination product protein removal, recombination product recovery, recombination product Escherichia coli transformation, primary library quality detection, primary library construction library capacity calculation, and primary library preservation.

8. The method for constructing a random peptide AD yeast library according to claim 1, It is characterized in that The construction method of step three is as follows: plasmid extraction of primary library, library plasmid LR reaction recombination, deproteinization of recombinant product, recovery of recombinant product, Escherichia coli transformation of recombinant product, secondary library quality detection, secondary library construction library capacity calculation, secondary library insert fragment detection, and secondary library preservation.

9. The method for constructing a random peptide AD yeast library according to claim 1, It is characterized in that The method for constructing the yeast Y187 hybrid library in step 4 is as follows: plasmid extraction of the secondary library, transformation of the secondary library plasmid into the Y187 yeast strain, and collection of yeast library transformants.

10. Application of random peptide AD yeast library in protein interaction research, signal transduction pathway analysis, drug discovery and protein engineering.

Images