Methods and compounds

Abstract

Provided herein is a method of modifying a polynucleotide, or an analog or derivative thereof, comprising reacting a polynucleotide, or an analog or derivative thereof, with a compound of formula (I): # imgabs0 # wherein RH, L1, # imgabs1 # R, n, and RP are as defined herein. Related methods of purifying polynucleotides or analogs or derivatives thereof, uses of compounds of formula (I) and such compounds themselves are also provided.

Description

Technical Field

[0001] The present invention relates to methods for modifying polynucleotides or analogs or derivatives thereof. The present invention also relates to compounds for use in such methods and modified polynucleotides produced thereby. The present invention also relates to methods for purifying polynucleotides using the modification methods disclosed herein, and the use of compounds defined herein to modify and / or purify polynucleotides. The present invention also relates to polynucleotides or derivatives or analogs thereof obtainable by such methods. Background Art

[0002] Polynucleotides are biopolymers composed of nucleotide monomer units and have applications in many different areas, including therapy, diagnostics, and research. Polynucleotides with customized nucleotide sequences can be synthesized in vitro, for example, using solution phase or solid phase synthesis methods.

[0003] Solid phase chemical synthesis was developed in the 1960s and has many advantages over solution phase synthesis. For example, large excess amounts of solution phase reagents can be used to drive the reaction to completion quickly; impurities and excess reagents can be washed away to facilitate the separation of growing polynucleotides without the need for purification between reaction steps; and the process is easily automated on a computer-controlled solid phase synthesizer. Typically in solid phase polynucleotide synthesis, polynucleotides or initial nucleoside / nucleotide monomers are attached to a solid phase support and a series of reactions are performed to increase the chain length of the polynucleotide / initial monomer attached to the support, thereby synthesizing on the solid phase support. The solid phase support is typically fixed between filters in a synthesis column. Solution phase reagents and solvents can freely pass through such a column, while the solid phase support and the compound attached to it are fixed in place. The polynucleotide or initial nucleoside / nucleotide monomer is typically connected to the solid phase support using a linker.

[0004] Although solid-phase chemical synthesis of polynucleotides is well established and in commercial use, significant problems remain.

[0005] A key problem encountered in traditional synthetic routes is to ensure that the purity of the synthesized polymer is high enough. There are many potential sources of impurities in the polynucleotide synthesis pathway, and even with careful treatment, it is usually impossible to eliminate these impurities.

[0006] For example, one problem that may be encountered is inefficient coupling of nucleotide monomers to the growing monomer chain. The inefficiency of the coupling reaction increases with chain length. It is common practice to address the problem of unreacted nucleotides at each step of the polymerization cycle by capping (typically using acetic anhydride in N-methylimidazole); this prevents further reaction. Capping techniques mean that failures early in the polymerization reaction can result in significant changes in the quality of the final product: short oligonucleotides produced by failure after only a few monomers have been incorporated into the chain can be easily separated from longer full-length oligomers. However, as the chain becomes longer, it becomes more difficult to separate the capped truncated oligomers from the full-length desired product. In particular, there is an increasing probability that the terminal residue on a long polynucleotide chain is not the expected residue.

[0007] A further problem that may be encountered during polynucleotide synthesis is degradation. Degradation may be the result of a variety of mechanisms, including the presence of degrading agents (whether chemical or biological, such as nucleases) in the reaction or product mixture.

[0008] A key source of degradation is the need to use protected functional groups in traditional synthesis. Such groups include, for example, DMT (4,4'-dimethoxytrityl). DMT is commonly used in solid phase polynucleotide synthesis (typically approached in a 3'→5' direction, although not universally) to protect the 5'-OH groups of nucleotide monomers as they are added to the growing polynucleotide chain. However, harsh conditions are typically used to remove the DMT group - the typical reagent for detritylation is trichloroacetic acid in dichloromethane. These conditions always result in some degradation of the polynucleotide product.

[0009] To overcome this problem, two basic approaches have been taken. However, both have problems.

[0010] One method involves removing the DMT protecting group before the final purification of the synthesized polynucleotides. This means in principle that potential degradation products are removed, but in practice, it is difficult to cleanly purify the deprotected polynucleotides, particularly relatively long-chain oligonucleotides or polynucleotides that may have slight damage. Even using methods such as reverse phase or anion exchange HPLC (such methods are typically the best methods available in a commercial environment), the final purity is also very low.

[0011] An alternative approach is known as "DMT-on" purification. In this approach, oligonucleotides or polynucleotides are synthesized with the terminal 5'-DMT group retained for purification. The presence of the 5'-DMT group increases the hydrophobicity of the full-length oligonucleotide relative to all failed sequences (which are typically capped with acetic anhydride during synthesis, as described above, so there is no 5'-DMT group), allowing for more efficient purification (e.g., by reverse phase HPLC). However, while purification is effective, subsequent removal of the DMT group (which is required in most applications) may result in further degradation of the desired product. For example, the acidic conditions used may result in depurination.

[0012] Therefore, there is a need for improved methods of purifying polynucleotides.

[0013] Another challenge in polynucleotide synthesis is to effectively control the chemical properties of the terminal polynucleotides in the synthetic polymer. Depending on the application of the polynucleotide, many different terminal modifications are required. In particular, for applications that require extremely high purity products (e.g., therapeutic applications), traditional methods are not sufficient.

[0014] For example, some applications require a terminal (e.g., 5') OH group. While such groups are readily achievable by conventional synthesis, as discussed above, the available purity levels may be insufficient. Other applications, such as gene editing, require a terminal phosphate group. While biological reagents (e.g., kinases) can be used to convert the terminal OH group to a terminal phosphate, the need for such a further reaction step after solid phase synthesis is complete is inefficient and may again lead to purity issues (e.g., if any contaminants are present in the kinase reagent mixture). Still further applications require "non-natural" end groups, such as alkyl and alkoxy groups. For example, a common group used in many technological applications is "C n "spacer" (wherein n is an integer, such as 3, 9, 12 or 18), which is a nucleotide analog of the following structure:

[0015]

[0016] Wherein "DNA" refers to the remainder of the polynucleotide chain to which the C3 spacer is linked, for example, via a 5' phosphate.

[0017] The need for multiple chemistries at the termini of synthetic nucleotides is technically challenging. In particular, methods are needed to control terminal chemistry (e.g., -OH, -phosphate or other, e.g., -C3 spacer) that is compatible with very high purity synthesis.

[0018] A further approach that has been proposed is the use of photolyzable groups. Photolyzable or "photolabile" linkers are known to cleave upon photoexcitation. Photolyzable linkers have the advantage of relatively mild cleavage conditions that generally do not alter the structure of the polynucleotide product and are orthogonal to typical reaction conditions used during polynucleotide synthesis.

[0019] Previous attempts have focused on photolyzable linkers that include carboxyl groups. Such linkers typically focus on the use of ester or carbonate groups.

[0020] Although such groups can be photochemically cleaved, significant problems remain. For example, diester-containing linkers, such as succinyl linkers, have the disadvantage that photocleavage of the linker typically does not produce free nucleotides in a single reaction step, but rather produces succinyl-functionalized nucleotides. Similarly, carbonate-containing linkers produce carbonate-functionalized nucleotides.

[0021] In some embodiments, the present invention relates to the synthesis of free (poly) nucleotides.Therefore, further reactions steps are needed to produce free (poly) nucleotides, which increases the required complexity, cost and time of building-up process.Severe reaction conditions are typically required to remove succinyl or carbonate groups from succinyl-or carbonate-functionalized nucleotides.Therefore, carbonate-containing photodegradable joints have similar shortcomings as succinyl joints, because using severe reaction conditions has increased the complexity of the required equipment arrangement for building-up reactions, and also can limit the scope of the polynucleotides that can be synthesized.For example, (poly) nucleotides with protected core bases may not be produced, because in the process of removing succinyl or carbonate groups, the core base protecting group will be removed at least in part.

[0022] Some attempts also attempt to utilize photodegradable groups in RNA synthesis. For example, one method envisions using a photodegradable linker based on an acetal bridge to be connected to a nitrophenyl conjugated to an alkyl diamide linker to selectively connect the terminal 2'-OH group of the RNA polymer to biotin to attach to streptavidin functionalized beads to confirm successful chain synthesis. However, the problem remains. In particular, biotin-streptavidin capture is not suitable for large-scale oligonucleotide synthesis because it cannot be scaled up and is costly. Therefore, there is still a need for a method for improving purification in solid phase polynucleotide synthesis that is suitable for industrial levels.

[0023] The present invention is directed to meeting some or all of these needs. Summary of the invention

[0024] The inventors have recognised that current methods of solid phase polynucleotide synthesis need improvement. The inventors have discovered that the above technical problems can be solved by incorporating cleavable purification tags into the terminal monomers used in polynucleotide synthesis.

[0025] The inventors have appreciated that incorporation of suitable purification tags is a significant challenge. To achieve sufficient purity, for example by HPLC, the incorporated tag needs to be firmly attached to the polynucleotide and typically needs to be quite large in order to have a sufficient effect on the physical properties of the modified polynucleotide so that separation of the modified polynucleotide from the unmodified polynucleotide can be effectively achieved.

[0026] However, even if purification tags can be incorporated, problems still exist. Such tags typically cannot be left on the purified polynucleotides without interfering with downstream applications, which is generally unacceptable commercially and technically. However, removing such tags by chemical or enzymatic methods is also problematic because this process typically results in degradation of the purified polynucleotides, as described above. Therefore, to date, the problem of achieving satisfactory purification of controllably modified polynucleotides on a commercially relevant scale has not been solved.

[0027] In the course of extensive research, the inventors have recognized that certain photolyzable compounds can be used to modify polynucleotides. The inventors have designed compounds that allow polynucleotides to be efficiently and effectively modified in order to both control the terminal chemistry of the polynucleotides and to reversibly incorporate hydrophobic groups that can be used to improve purification, for example, by techniques such as HPLC. Although the present invention is made in the context of polynucleotide purification, many other applications are also possible, as the modifications that can be made to polynucleotides according to the present invention are not limited.

[0028] Thus, as explained in more detail below, the present invention provides a method for modifying a polynucleotide or an analogue or derivative thereof, comprising reacting a polynucleotide or an analogue or derivative thereof with a compound of formula (I):

[0029]

[0030] in:

[0031] -R H It is a hydrophobic group;

[0032] -L 1 is the linker:

[0033] - It is a photolabile group;

[0034] -R is a modifying group;

[0035] - n is an integer selected from 0 and 1; and

[0036] -R P It is a phosphorus-based group;

[0037] In the process of making the reactive functional group of the polynucleotide or its analog or derivative and the phosphorus group R P Under the reaction conditions, the hydrophobic group R H In some embodiments, the method comprises connecting the free hydroxyl group at the 5' position of the polynucleotide or its analog or derivative to the phosphorus group R P In some embodiments, the method comprises reacting a free hydroxyl group at the 3' position of a polynucleotide or an analog or derivative thereof with a phosphorus group R P reaction.

[0038] In some embodiments, R H Select from C1 to C 20 Alkyl, C2 to C 20 Alkenyl, C2 to C 20 Alkynyl, C5 to C 10 Carbocyclic group, C6 to C 18 aryl, 5- to 10-membered heteroaryl, and 5- to 10-membered heterocyclyl, wherein R H is optionally substituted. In some embodiments, R H Selected from C4 to C 16 Alkyl, C4 to C 16 Alkenyl, C4 to C 16 Alkynyl, C5 to C 10 Carbocyclic and C6 to C 10 Aryl, preferably C5 to C 12 Alkyl; wherein R H is optionally substituted and preferably unsubstituted.

[0039] In some embodiments, L 1 selected from: (i) a chemical bond; and (ii) a linker comprising C1 to C 20 Alkylene, C2 to C 20 Alkenylene and / or C2 to C 20 wherein the alkylene, alkenylene or alkynylene is optionally substituted by one or more selected from heteroatoms, phosphite groups, phosphate groups, carbonyl groups, C6 to C 10 Aryl, C5 to C 10 The group is interrupted and / or terminated by carbocyclyl, 5- to 10-membered heteroaryl, and 5- to 10-membered saturated or partially unsaturated heterocyclyl, wherein the linker is optionally further substituted. 1 is a linker comprising (or selected from) C1 to C6 alkylene, C2 to C6 alkenylene and / or C2 to C6 alkynylene, wherein the alkylene, alkenylene or alkynylene is optionally substituted by one or more heteroatoms (preferably wherein the heteroatoms are one or more selected from -O-, -S-, -SO-, -SO2-, -NR z-、-C(O)NR z A group in which R z The linking group is interrupted and / or terminated by a group comprising 5 to 6 membered heteroaryl, 5 to 6 membered saturated or partially unsaturated heterocyclic groups, wherein the linking group is optionally further substituted.

[0040] In some embodiments, R P is a phosphoramidite, a phosphoramide, an alkylphosphinamide, or an alkylphosphinamide. P It is a phosphoramidite or an alkylphosphinamide, preferably a phosphoramidite or a methylphosphinamide, more preferably 2-cyanoethyl N,N-diisopropylphosphinamide or N,N-diisopropylmethylphosphinamide.

[0041] (i) In some embodiments, R is selected from: a nucleoside or a derivative or analog thereof, preferably a nucleoside;

[0042] (ii) Includes C1 to C 20 Alkylene, C2 to C 20 Alkenylene and / or C2 to C 20 The alkynylene group, wherein the alkylene, alkenylene or alkynylene group is optionally substituted by one or more selected from: heteroatoms; phosphite; phosphate; carbonyl; C6 to C 10 Aryl; C5 to C 10 carbocyclyl; 5- to 10-membered heteroaryl; and 5- to 10-membered heterocyclyl groups interrupted and / or terminated; and wherein R is optionally further substituted;

[0043] Preferably, the group includes C2 to C6 alkylene, C2 to C6 alkenylene and / or C2 to C6 alkynylene, wherein the alkylene, alkenylene or alkynylene is optionally substituted by one or more heteroatoms (preferably wherein the heteroatom is -O-, -S-, -SO-, -SO2-, -NR z -、-C(O)NR z , where R z is H or methyl), carbonyl, phenyl, cyclopentyl or cyclohexyl, 5- to 6-membered heteroaryl, and 5- to 6-membered saturated or partially unsaturated heterocyclic radicals, wherein R is optionally further substituted;

[0044] and

[0045] (iii) a second polynucleotide or a derivative or analogue thereof, preferably a second polynucleotide.

[0046] In some embodiments, the photolabile group Yes , so the compound of formula (I) is a compound of formula (II):

[0047]

[0048] Where R H , L 1 and R are as defined herein, and wherein:

[0049] - is 2-nitrobenzyl, wherein the 2-nitrobenzyl is optionally substituted with 1, 2 or 3 groups independently selected from halogen, optionally substituted C1 to C4 alkyl, -OR a ,–SR a ,–NR a R a , –C(O)OR a 、-C(O)NR a R a , –C(O)R b ,

[0050] –OC(O)R b and –NHC(O)R b , where each R a are independently selected from hydrogen, optionally substituted C1 to C2 alkyl and optionally substituted C l to C2 alkoxy, and each R b independently selected from hydrogen and optionally substituted C1 to C4 alkyl;

[0051] -R 3 is methyl, ethyl or C1 to C2 haloalkyl; and

[0052] -W is selected from a group of formula (W-2); an oxygen atom; and a group of formula (W-1):

[0053]

[0054] in:

[0055] -When n is 1, R P is phosphoramidite, phosphoramide, alkylphosphinamide or alkylphosphinamide; when n is 0, R P Together with the oxygen atom to which it is attached, it forms the phosphoryl

[0056] Amines, phosphoramides, alkylphosphinates or alkylphosphonamides;

[0057] The phosphoramidite, phosphoramide, alkylphosphinate or alkylphosphinate is preferably phosphoramidite or methylphosphinate, more preferably 2-cyanoethyl N,N-diisopropylphosphinate or N,N-diisopropylmethylphosphinate; R P ,

[0058] -Q is an oxygen atom or a sulfur atom; and

[0059] - Each R 2 Independently selected from hydrogen, methyl, ethyl, C1 to C2 haloalkyl and halogen groups.

[0060] In some embodiments, W is a group of formula (W-2), and n is 0, such that the compound of formula (II) is a compound of formula (II-3):

[0061]

[0062] Where R H , L 1 , R 2 , R 3 and Q are as defined herein, and R P Together with the oxygen atom to which it is attached, it forms an alkylphosphinamide, preferably methylphosphinamide, more preferably N,N-diisopropylmethylphosphinamide.

[0063] In some embodiments, W is an oxygen atom, and n is 0, such that the compound of formula (II) is a compound of formula (II-1):

[0064]

[0065] Where R H , L 1 , and R 3 As defined herein, and wherein R P Together with the oxygen atom to which it is attached, it forms a phosphoramidite, a phosphoramide, an alkylphosphinamide or an alkylphosphinamide; preferably a phosphoramidite, more preferably 2-cyanoethyl N,N-diisopropylphosphoramidite.

[0066] In some embodiments, W is a group of formula (W-1), and n is 1, such that the compound of formula (II) is a compound of formula (II-2):

[0067]

[0068] Where R H , L 1 , R 2 , R 3 , Q and R are as defined herein, and wherein R P is a phosphoramidite, a phosphoramide, an alkylphosphinamide or an alkylphosphinamide; preferably a phosphoramidite, more preferably 2-cyanoethyl N,N-diisopropylphosphoramidite.

[0069] In some embodiments, L 1 and R H Together they are represented by formula (A-1) or formula (A-2):

[0070]

[0071] Where L 1 and R H As defined herein, and wherein:

[0072] -R 4 , R 5 , R 6 and R 7 are each independently selected from hydrogen, halogen, optionally substituted C1 to C4 alkyl, -OR a ,–SR a ,–NR a R a , –C(O)OR a , –C(O)NR a R a ,

[0073] –C(O)R b 、–OC(O)R b and –NHC(O)R b , preferably R 4 , R 5 , R 6 and R 7 are each independently selected from hydrogen, fluorine, optionally substituted C1 to C4 alkyl, -OR a ,–

[0074] SR a ,–NR a R a 、–OC(O)R b and –NHC(O)R b , more preferably R 4 , R 5 ,

[0075] R 6 and R 7 are hydrogen or methoxy; a and R b As defined herein.

[0076] Also provided is a method for purifying a polynucleotide or an analog or derivative thereof, comprising:

[0077] (i) modifying a polynucleotide or an analogue or derivative thereof in a reaction mixture as defined herein, thereby increasing the hydrophobicity of the polynucleotide or an analogue or derivative thereof;

[0078] (ii) separating the modified polynucleotide or its analog or derivative from other components in the reaction mixture based on the hydrophobicity of the modified polynucleotide or its analog or derivative; and

[0079] (iii) optionally removing a hydrophobic group from the modified polynucleotide or its analog or derivative by irradiating the modified polynucleotide, its analog or derivative with light, preferably by irradiating the modified polynucleotide, its analog or derivative with ultraviolet light having a wavelength of about 300 to about 500 nm.

[0080] In some embodiments, a method for purifying a polynucleotide or a peptide nucleic acid (PNA) analog, a glycerol nucleic acid (GNA) analog, a threose nucleic acid (TNA) analog, or a locked nucleic acid (LNA) analog thereof is provided, comprising:

[0081] (i) modifying a polynucleotide or a peptide nucleic acid (PNA) analogue, a glycerol nucleic acid (GNA) analogue, a threose nucleic acid (TNA) analogue or a locked nucleic acid (LNA) analogue thereof in a reaction mixture according to the method described herein, thereby increasing the hydrophobicity of the polynucleotide or a peptide nucleic acid (PNA) analogue, a glycerol nucleic acid (GNA) analogue, a threose nucleic acid (TNA) analogue or a locked nucleic acid (LNA) analogue thereof;

[0082] (ii) separating the modified polynucleotide or its peptide nucleic acid (PNA) analog, glycerol nucleic acid (GNA) analog, threose nucleic acid (TNA) analog or locked nucleic acid (LNA) analog from other components in the reaction mixture based on the hydrophobicity of the modified polynucleotide or its peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA) analog or locked nucleic acid (LNA) analog; and

[0083] (iii) irradiating the modified polynucleotide, its peptide nucleic acid (PNA), glycerol nucleic acid (GNA) analogue, threose nucleic acid (TNA) analogue or locked nucleic acid (LNA) analogue with light, preferably by irradiating the modified polynucleotide, its peptide nucleic acid (PNA) analogue, glycerol nucleic acid (GNA) analogue, threose nucleic acid (TNA) analogue or locked nucleic acid (LNA) analogue with ultraviolet light having a wavelength of about 300 to about 500 nm, optionally removing the hydrophobic group R from the modified polynucleotide or its peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA) analogue or locked nucleic acid (LNA) analogue; H .

[0084] In some embodiments, step (ii) comprises separating the modified polynucleotide or its analog or derivative (preferably the modified polynucleotide or its peptide nucleic acid (PNA) analog, glycerol nucleic acid (GNA) analog, threose nucleic acid (TNA) analog or locked nucleic acid (LNA) analog) from other components in the reaction mixture using a chromatographic purification technique, preferably high performance liquid chromatography, more preferably reverse phase high performance liquid chromatography.

[0085] Further provided are compounds of formula (I):

[0086]

[0087] Where R H , L 1 , R, n, and R P As defined herein.

[0088] In some aspects, compounds of formula (II) are provided:

[0089]

[0090] Where R H , L 1 , R 3 , W, R, n and R P As defined anywhere herein.

[0091] Also provided is a modified polynucleotide or a derivative or analog thereof, which comprises a group of formula (I*):

[0092]

[0093] Where R H , L 1 , R and n are as defined herein, and wherein:

[0094] -R P* is a phosphorous-based linkage; and

[0095] - The wavy line indicates the point of attachment to the polynucleotide or its derivative or analogue.

[0096] In some embodiments, R P*It is a phosphodiester bond, a phosphotriester bond, a phosphite triester bond, a phosphite diester bond, a phosphorothioate bond, a phosphorodithioate bond, an alkylphosphonate bond or an alkylphosphite bond, preferably a phosphite triester bond or an alkylphosphite bond, more preferably a phosphite triester bond or a methylphosphite bond; and / or the group of formula (I*) is linked to the 3' position or 5' position of the polynucleotide or its analog or derivative, preferably to the 5' position of the polynucleotide or its analog or derivative.

[0097] Also provided is a modified polynucleotide or a peptide nucleic acid (PNA) analog, a glycerol nucleic acid (GNA) analog, a threose nucleic acid (TNA) analog or a locked nucleic acid (LNA) analog thereof, comprising a group of formula (II):

[0098]

[0099] Where R H , L 1 , R 3 , W, R and n are as defined anywhere herein,

[0100] And where R P The polynucleotide is a phosphodiester bond, a phosphotriester bond, a phosphite triester bond, a phosphite diester bond, a phosphorothioate bond, a phosphorodithioate bond, an alkylphosphonate bond or an alkylphosphite bond, preferably a phosphite triester bond or an alkylphosphite bond, more preferably a phosphite triester bond or a methylphosphite bond, connected to the 3' position or the 5' position of the polynucleotide or its peptide nucleic acid (PNA) analog, glycerol nucleic acid (GNA) analog, threose nucleic acid (TNA) analog or locked nucleic acid (LNA) analog, preferably the 5' position

[0101] Still further provided are uses of compounds of formula (I) as defined herein for: (i) modifying a polynucleotide or a derivative or analogue thereof, optionally thereby increasing the hydrophobicity of the polynucleotide or a derivative or analogue thereof; or (ii) purifying a polynucleotide or a derivative or analogue thereof.

[0102] The use may be for: (i) modifying a polynucleotide or a peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA) or locked nucleic acid (LNA) analogue thereof, optionally thereby increasing the hydrophobicity of the polynucleotide or a peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA) or locked nucleic acid (LNA) analogue thereof; or (ii) purifying a polynucleotide or a peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA) or locked nucleic acid (LNA) analogue thereof.

[0103] Further provided is a polynucleotide or a derivative or analogue thereof obtainable by a method as defined herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0104] Figure 1 : Comparison of oligonucleotide purity by UPLC-MS followed by RP-HPLC purification. A: Oligonucleotide synthesized using a terminal monomer unit consisting of the compound of Example 2 (5'-PC C3). B: Oligonucleotide synthesized using a terminal monomer unit consisting of non-photolyzable C3 phosphoramidite. These figures show that significantly improved purity was obtained by using the compound of Example 2 compared to the control. The results are described in the Examples.

[0105] Figure 2 : Comparison of the purity of the purified oligonucleotides. A: Oligonucleotide of SEQ ID NO:1. B: Oligonucleotide of SEQ ID NO:2. C: Oligonucleotide of SEQ ID NO:2, corresponding to SEQ ID NO:1, whose terminal monomer unit consists of the compound of Example 1 (5'-PC PO3). D: Oligonucleotide of SEQ ID NO:4, corresponding to SEQ ID NO:2, whose terminal monomer unit consists of the compound of Example 1 (5'-PC PO3). These figures show that a significant increase in purity was observed for SEQ ID NO:3 compared to SEQ ID NO:1; and for SEQ ID NO:4 compared to SEQ ID NO:2. Therefore, these figures indicate that a significantly increased purity was obtained by using the compound of Example 1 compared to the control group. The results are described in the Examples. DETAILED DESCRIPTION

[0106] definition

[0107] The term "nucleosides, nucleotides, polynucleotides, and derivatives and analogs thereof" includes: nucleosides; derivatives of nucleosides; analogs of nucleosides; nucleotides; derivatives of nucleotides; analogs of nucleotides; polynucleotides; derivatives of polynucleotides; and analogs of polynucleotides.

[0108] As used herein, a "derivative" of a nucleoside, nucleotide or polynucleotide is a modified form of a nucleoside, nucleotide or polynucleotide that includes one or more chemical modifications to the phosphate backbone, sugar ring or nucleobase of a DNA or RNA. Thus, a derivative of a nucleoside can be a chemically modified nucleoside as described in more detail herein.

[0109] As used herein, an "analog" of a nucleoside, nucleotide, or polynucleotide is a compound that is structurally similar to a nucleotide (e.g., DNA and RNA) but contains modifications at one or more positions (e.g., the phosphate backbone, sugar ring, or nucleobase of DNA or RNA). Nucleotide analogs include peptide nucleic acids (PNA), glycerol nucleic acids (GNA), threose nucleic acids (TNA), locked nucleic acids (LNA), and other synthetic polymers with nucleotide side chains.

[0110] Unless otherwise indicated, the term "nucleoside" includes protected nucleosides, i.e., nucleosides that have been modified to include protecting groups in their chemical structure. Unless otherwise indicated, the term "nucleotide" includes protected nucleotides, i.e., nucleotides that have been modified to include protecting groups in their chemical structure. Unless otherwise indicated, the term "polynucleotide" includes protected polynucleotides, i.e., polynucleotides that have been modified to include protecting groups in their chemical structure. Such protecting groups are typically different from modifications made in nucleotide derivatives for functional reasons (e.g., to change the properties of nucleotides or polynucleotides).

[0111] As used herein, unless otherwise stated, the term "protecting group" refers to any suitable protecting group known in the art. Different protecting groups are suitable for protecting different chemical groups. For example, as used herein, unless otherwise stated, the term "hydroxy protecting group" refers to any suitable protecting group for protecting hydroxyl groups known in the art. Similarly, as used herein, unless otherwise stated, the term "amine protecting group" refers to any suitable protecting group for protecting amine groups known in the art. In addition, as used herein, unless otherwise stated, the terms "phosphate protecting group" and "phosphite protecting group" refer to any protecting group known in the art for protecting phosphate or phosphite groups, respectively.

[0112] Suitable hydroxy protecting groups include acetyl (Ac), benzoyl (Bz), benzyl (Bn), β-methoxyethoxymethyl ether (MEM), 4,4'-dimethoxytrityl (DMT), methoxymethyl ether (MOM), 4-monomethoxytrityl (MMT), levulinyl, 9-fluorenylmethoxycarbonyl (Fmoc), p-methoxybenzyl ether (PMB), p-methoxyphenyl ether (PMP), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuran (THF), trityl (Tr), silyl ethers such as trimethylsilyl (TMS), tert-butyldimethylsilyl (TBDMS), triisopropylsiloxymethyl (TOM) and triisopropylsilyl (TIPS), methyl ether, ethoxyethyl ether, allyl ether and tert-butyl ether.

[0113] Suitable amine protecting groups include carbobenzyloxy (Cbz), p-methoxybenzylcarbonyl (Moz), tert-butyloxycarbonyl (BOC), 9-fluorenylmethoxycarbonyl (Fmoc), acetyl (Ac), trifluoroacetyl, benzoyl (Bz), benzyl (Bn), benzyl, trityl (Tr), carbamate, phthalimide, p-methoxybenzyl (PMB), 3,4-dimethoxybenzyl (DMPM), p-methoxyphenyl (PMP), trichloroethyl chloroformate (Troc), tosyl (Ts), nosyl and 2-nitrophenylsulfenyl (Nps).

[0114] Suitable phosphate protecting groups and phosphite protecting groups include: alkyl, such as C1 to C4 alkyl, optionally substituted with 1, 2 or 3 groups independently selected from halogen, -OR a ,–SR a ,–NR a R a , –C(O)OR a , –C(O)NR a R a , –C(O)R b 、–OC(O)R b 、–NHC(O)R b and -CN, in particular methyl, ethyl and 2-cyanoethyl, preferably 2-cyanoethyl; o-chlorophenyl; and p-chlorophenyl.

[0115] As used herein, an alkyl group may be linear, branched or cyclic, but is preferably linear. 20 Alkyl is a straight or branched chain alkyl group containing 1 to 20 carbon atoms. 20 The alkyl group is typically C1 to C 10 Alkyl, for example C1 to C6 alkyl, C1 to C5 alkyl or C1 to C4 alkyl. Suitable C1 to C4 alkyl include methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl and tert-butyl. C1 to C4 alkyl is preferably C1 to C3 alkyl, more preferably ethyl or methyl. Unless otherwise stated, alkyl may be unsubstituted or substituted as described herein. For the avoidance of doubt, when two alkyls are present, the alkyls may be the same or different.

[0116] As used herein, an alkenyl group may be straight chain, branched or cyclic, but is preferably straight chain. An alkenyl group has one or more, for example one or two, typically one double bond. 20 Alkenyl is a straight chain or branched alkenyl group containing 2 to 20 carbon atoms. 20 Alkenyl groups are typically C2 to C10 Alkenyl, for example C2 to C6 alkenyl, C2 to C5 alkenyl or C2 to C4 alkenyl. C2 to C4 alkenyl is preferably C2 to C3 alkenyl. Examples of C2 to C4 alkenyl include vinyl, propenyl and butenyl. Unless otherwise indicated, alkenyl may be unsubstituted or substituted as described herein. For the avoidance of doubt, when there are two alkenyls, the alkenyls may be identical or different.

[0117] As used herein, an alkynyl group may be straight chain, branched or cyclic, but is preferably straight chain. An alkynyl group has one or more, for example one or two, typically one triple bond. 20 Alkynyl is a straight-chain or branched alkynyl group containing 2 to 20 carbon atoms. 20 Alkynyl groups are typically C2 to C 10 Alkynyl, for example C2 to C6 alkynyl, C2 to C5 alkynyl or C2 to C4 alkynyl. C2 to C4 alkynyl is preferably C2 to C3 alkynyl. Examples of C2 to C4 alkynyl include ethynyl, propynyl and butynyl. Unless otherwise indicated, alkynyl may be unsubstituted or substituted as described herein. For the avoidance of doubt, when there are two alkynyl groups, the alkynyl groups may be the same or different.

[0118] As used herein, an alkylene group is a moiety of an unsubstituted or substituted bidentate obtained by removing two hydrogen atoms from an alkane. The two hydrogen atoms may be removed from the same carbon atom or from different carbon atoms. As used herein, an alkylene group may be straight chain, branched chain or cyclic, but is preferably straight chain. 20 Alkylene is a straight or branched chain alkylene group containing 1 to 20 carbon atoms. 20 The alkylene group is typically C1 to C 10 Alkylene, for example C1 to C6 alkylene, C1 to C5 alkylene or C1 to C4 alkylene. Suitable C1 to C4 alkylene includes methylene, ethylene, n-propylene, isopropylene, n-butylene, sec-butylene and tert-butylene. C1 to C4 alkylene is preferably C1 to C3 alkylene, more preferably ethylene or methylene. Unless otherwise specified, alkylene may be unsubstituted or substituted as described herein. For the avoidance of doubt, when two alkylenes are present, the alkylenes may be the same or different.

[0119] As used herein, alkenylene is the moiety of an unsubstituted or substituted bidentate obtained by removing two hydrogen atoms from an alkene. The two hydrogen atoms may be removed from the same carbon atom or from different carbon atoms. As used herein, alkenylene may be straight chain, branched or cyclic, but is preferably straight chain. Alkenylene has one or more, e.g. one or two, typically one double bond. C2 to C 20Alkenylene is a straight chain or branched chain alkenylene group containing 2 to 20 carbon atoms. 20 Alkenylene is typically C2 to C 10 Alkenylene, for example C2 to C6 alkenylene, C2 to C5 alkenylene or C2 to C4 alkenylene. C2 to C4 alkenylene is preferably C2 to C3 alkenylene. Examples of C2 to C4 alkenylene include vinylene, propenylene and butenylene. Unless otherwise indicated, alkenylene may be unsubstituted or substituted as described herein. For the avoidance of doubt, when there are two alkenylene, the alkenylene may be the same or different.

[0120] As used herein, an alkynylene group is a moiety of an unsubstituted or substituted bidentate obtained by removing two hydrogen atoms from an alkyne. As used herein, an alkynylene group may be straight chain, branched chain or cyclic, but is preferably straight chain. An alkynylene group has one or more, such as one or two, typically one triple bond. C2 to C 20 Alkyne is a straight chain or branched chain alkynylene group containing 2 to 20 carbon atoms. 20 Alkyne groups are typically C2 to C 10 Alkyne, for example C2 to C6 alkynyl, C2 to C5 alkynyl or C2 to C4 alkynyl. C2 to C4 alkynyl is preferably C2 to C3 alkynyl. Examples of C2 to C4 alkynyl include ethynyl, propynyl and butynyl. Unless otherwise stated, alkynyl may be unsubstituted or substituted as described herein. For the avoidance of doubt, when there are two alkynyl, the alkynyl may be the same or different.

[0121] As used herein, halogen is typically chlorine, fluorine, bromine or iodine, and is preferably chlorine, fluorine or bromine, more preferably chlorine or fluorine.

[0122] As used herein, C6 to C 10 Aryl is an aromatic group having 6 to 10 carbon atoms, for example phenyl or naphthyl, preferably phenyl. The aryl group or moiety may be substituted or unsubstituted as described herein.

[0123] As used herein, C5 to C 10 The carbocyclic group can be C5, C6, C7, C8, C9 or C 10 Cycloalkyl, and preferably cyclopentyl or cyclohexyl. Typically, cycloalkyl is substituted with up to three substituents (eg, one or two substituents) or unsubstituted.

[0124] As used herein, a 5- to 10-membered heteroaryl is a 5- to 10-membered ring system in which the ring is fully unsaturated and aromatic and contains at least one heteroatom. Typically, the ring contains up to three or four heteroatoms, for example, one or two heteroatoms selected from O, N and S. Thus, a 5- to 10-membered heteroaryl is typically a 5- to 10-membered aromatic ring containing one, two or three heteroatoms selected from O, N and S. Preferably, the heteroatom is selected from O and N. Suitable such heteroaryls include, for example:

[0125] monocyclic 5- to 7-membered heteroaryl rings such as furanyl, oxepinyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridinyl, pyradazinyl, pyrimidinyl, pyrazinyl, triazinyl, azepinyl, thiophenyl, oxepinyl, and thiepinyl; and

[0126] Bicyclic 8- to 10-membered heteroaromatic rings, such as benzofuranyl, indolyl, isoindolyl, indolizinyl, indazolyl, benzimidazolyl, azaindolyl, azaindazolyl, purinyl, benzooxazolyl, benzoisooxazolyl, benzothiazolyl, benzoisothiazolyl, benzoi quinolinyl, isoquinolinyl, quinolizinyl, quinoxalinyl, phthalazinyl, quinazolinyl, cinnolinyl, naphthylridinyl, pteridinyl and benzothiophenyl, preferably benzofuranyl, indolyl, isoindolyl, quinolinyl and isoquinolinyl.

[0127] Preferably, the 5- to 10-membered heteroaryl group is a monocyclic 5- to 7-membered heteroaryl ring selected from furanyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, oxazolyl, isoxazolyl, pyridinyl, pyridazinyl, pyrimidinyl and pyrazinyl.

[0128] As used herein, a 5- to 10-membered saturated heterocyclyl is a saturated 5- to 10-membered ring system, wherein the ring contains at least one heteroatom. Typically, the ring contains up to three or four heteroatoms, for example, one or two heteroatoms selected from O, S and N. Thus, a 5- to 10-membered saturated heterocyclyl is typically a 5- to 10-membered ring containing one, two or three heteroatoms selected from O, S and N. Suitable such saturated heterocyclic groups include, for example, a monocyclic saturated 5- to 8-membered ring, more preferably a 5- to 7-membered ring, such as tetrahydrofuranyl, piperidinyl, oxazolidinyl, morpholinyl, thiomorpholinyl, pyrrolidinyl, dioxolanyl, piperidonyl, azepanyl, oxepanyl, piperazinyl, tetrahydropyranyl and 1,4-diazepanyl, more preferably pyrrolidinyl, morpholinyl, piperazinyl, tetrahydropyranyl, piperidinyl, azepanyl and 1,4-diazepanyl.

[0129] As used herein, a 5- to 10-membered partially unsaturated heterocyclyl is a 5- to 10-membered ring system wherein the ring contains at least one unsaturated bond and at least one heteroatom, but the ring is not fully unsaturated or aromatic. Typically, the ring contains up to three or four heteroatoms, for example, one or two heteroatoms selected from O, N and S. Thus, a 5- to 10-membered partially unsaturated heterocyclyl is typically a 5- to 10-membered ring containing one, two or three heteroatoms selected from O, N and S. Preferably, the heteroatom is selected from O and N. Suitable such partially unsaturated heterocyclyls include, for example:

[0130] Monocyclic partially unsaturated 5- to 7-membered heterocyclic rings, for example dihydrofuranyl, pyranyl, dihydropyranyl, dioxinyl, dihydrooxepinyl, tetrahydrooxepinyl, pyrrolinyl, pyrazolinyl, imidazolinyl, dihydrooxazolyl, dihydroisoxazolyl, dihydrothiazolyl, dihydroisothiazolyl, dihydropyridinyl, tetrahydropyridinyl, dihydropyridazinyl, tetrahydropyridazinyl, ahydropyridazinyl, dihydropyrimidinyl, tetrahydropyrimidinyl, dihydropyrazinyl, tetrahydropyrazinyl, oxazinyl, dihydrooxazinyl, thiazinyl, dihydrothiazinyl, dihydroazepinyl, tetrahydroazepinyl, dihydrothiophenyl, thiopyranyl, dihydrothiopyranyl, dihydrothiepinyl, and tetrahydrothiepinyl; and

[0131] Bicyclic partially unsaturated 8- to 10-membered heterocycles, for example dihydrobenzofuranyl, dihydroisobenzofuranyl, benzopyranyl, dihydrobenzopyranyl, benzodioxolyl, indolinyl, isoindolinyl, dihydroquinolinyl, tetrahydroquinolinyl, benzooxazinyl, dihydrobenzothiophenyl and benzodithiole; preferably dihydrobenzofuranyl, benzopyranyl, dihydrobenzopyranyl, benzodioxolyl, indolinyl, isoindolinyl, dihydroquinolinyl and tetrahydroquinolinyl.

[0132] Preferably, the 5- to 10-membered partially unsaturated heterocyclic group is a monocyclic partially unsaturated 5- to 7-membered ring selected from dihydrofuranyl, pyranyl, pyrrolinyl and oxazinyl.

[0133] The heterocycle and / or heteroaryl group can be substituted or unsubstituted. Each ring atom can be unsubstituted or can carry one or two substituents. The nitrogen atom can be disubstituted, providing a positively charged heteroatom. The sulfur atom can be substituted, providing a positively charged heteroatom. Typically, the heterocycle or heteroaryl group has up to three substituents, such as one or two substituents. The heterocycle or heteroaromatic ring can be connected to the rest of the molecule through a bond to any available ring position on the heterocycle or heteroaromatic ring.

[0134] As used herein, unless otherwise specified, an optionally substituted group may be substituted by a suitable substituent, which may include halogen, such as chlorine and / or fluorine, cyano, -OR x 、-SR x 、-NR x R x 、-C(O)OR x 、-C(O)NR x R x 、-C(O)R x and C1 to C4 alkyl, such as methyl and / or ethyl, wherein the C1 to C4 alkyl substituents themselves may be unsubstituted or substituted by 1 to 3 halogen atoms. xIndependently selected from hydrogen and C1 to C4 alkyl which is unsubstituted or substituted by 1, 2 or 3 halogen groups. The optional substituents are preferably hydroxy, halogen such as chlorine or fluorine, or C1 to C4 alkyl such as methyl or ethyl.

[0135] Unless otherwise indicated, the above includes well-known ionic, salt, solvate and protected forms of these substituents. For example, reference to carboxylic acid, carboxy or carboxyl group (-COOH) also includes the anionic (carboxylate) form (-CO - ), its salts or solvates, and conventional protected forms. Similarly, references to amino groups include protonated forms (-N + HR 1 R 2 ), salts or solvates of amino groups, such as hydrochlorides, and conventional protected forms of amino groups. Similarly, references to hydroxyl or hydroxyl groups (-OH) also include anionic forms (-OH). - ), its salt or solvate, and conventional protected forms. Salts include salts formed with acids and bases. Suitable acids include inorganic acids (e.g., hydrochloric acid, sulfuric acid, phosphoric acid, diphosphoric acid, hydrobromic acid or nitric acid) and organic acids (e.g., oxalic acid, citric acid, fumaric acid, maleic acid, malic acid, ascorbic acid, succinic acid, tartaric acid, benzoic acid, acetic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid or p-toluenesulfonic acid). Suitable bases include alkali metals (e.g., sodium or potassium) and alkaline earth metals (e.g., calcium or magnesium) hydroxides, and organic bases such as alkylamines, arylalkylamines and heterocyclic amines. Preferred are hydrochlorides and acetates, particularly hydrochlorides. When used for pharmaceutical applications, the salts of the compounds provided herein may preferably be pharmaceutically acceptable salts.

[0136] As used herein, a phosphoramidite group is a group of the form -OP(NR2)(OR), wherein each R group may be the same or different and is typically an optionally substituted hydrocarbon group. Typically, the R group of the OR moiety is hydrogen, a lone pair of electrons that creates a negative charge, a phosphate protecting group, or a phosphite protecting group. More commonly, the R group of the OR moiety is hydrogen, a lone pair of electrons that creates a negative charge, o-chlorophenyl, p-chlorophenyl, or a C1 to C4 alkyl group, optionally substituted with 1, 2, or 3 groups independently selected from halogen, -OR a ,–SR a ,–NR a R a , –C(O)OR a , –C(O)NR a R a , –C(O)R b 、–OC(O)R b 、–NHC(O)R band –CN, where R a and R b and independently H or methyl. More preferably, the R group of the OR moiety is hydrogen, a lone pair of electrons generating a negative charge, o-chlorophenyl, p-chlorophenyl, methyl or 2-cyanoethyl. Each R group may alternatively be an optionally substituted C 1-4 Alkyl, C 2-4 Alkenyl or C 2-4 Alkynyl, typically optionally substituted C 1-3 An alkyl group, such as methyl, ethyl or isopropyl, which group may be optionally substituted, for example, by CN. Typically, the phosphoramidite group used herein is of the form -OP(N i OCEP group of Pr2)(OCH2CH2CN).

[0137] As used herein, a phosphoramidite group is an oxidized phosphoramidite of the form -OP(O)(NR2)(OR).

[0138] As used herein, a phosphinamido group is a group of the form -OP(NR2)(R), wherein each R group may be the same or different and is an optionally substituted hydrocarbon group, such as an optionally substituted C 1-4 Alkyl, C 2-4 Alkenyl or C 2-4 Alkynyl, typically optionally substituted C 1-3 An alkyl group, such as methyl, ethyl or isopropyl, which group may be optionally substituted, for example, by CN. Typically, the phosphinamido group used herein is of the form -OP(N i Pr2)(Me)-methylphosphinate.

[0139] As used herein, a phosphonamide group is an oxidized phosphonamide of the form -OP(O)(NR2)(R).

[0140] Certain compounds may exist in one or more specific geometric, optical, enantiomeric, diastereomeric, epimeric, atropic, stereoisomeric, tautomeric, conformational or anomeric forms, including, but not limited to, cis- and trans-forms; E and Z forms; c, t and r forms; endo- and exo-forms; R, S and meso forms; D and L forms; d and l forms; (+) and (-) forms; keto-, enol- and enolate-forms; syn- and anti-forms; synclinal- and anticlinal-forms; α- and β-forms; axial and equatorial forms; boat, chair, torsion, envelope and half-chair forms; and combinations thereof, hereinafter collectively referred to as "isomers" (or "isomeric forms"). Unless otherwise indicated, reference to a particular compound includes all such isomeric forms, including (wholly or partially) racemic and other mixtures thereof. Methods for preparing (e.g., asymmetric synthesis) and separating (e.g., fractional crystallization and chromatography) such isomeric forms are known in the art or are readily obtained by adapting known methods in a known manner.

[0141] Unless otherwise stated, a reference to a particular compound or complex also includes ionic, salt, solvated and protected forms.

[0142] Methods for modifying polynucleotides

[0143] In some embodiments, the present invention provides a method for modifying a polynucleotide or an analog or derivative thereof. The method involves reacting a polynucleotide or an analog or derivative thereof with a compound of formula (I):

[0144]

[0145] in:

[0146] -R H It is a hydrophobic group;

[0147] -L 1 is the linker:

[0148] - It is a photolabile group;

[0149] -R is a modifying group;

[0150] - n is an integer selected from 0 and 1; and

[0151] -R PIt is a phosphorus group;

[0152] In the process of making the reactive functional group of the polynucleotide or its analog or derivative and the phosphorus group R P Under the reaction conditions, the hydrophobic group R H ligated to a polynucleotide or an analog or derivative thereof.

[0153] These methods are not limited in application, but have particular utility in the purification of polynucleotides or their analogs or derivatives. Thus, in some embodiments, the method is a method for purifying polynucleotides or their analogs or derivatives. For example, the hydrophobic group R H It can be used to facilitate purification, for example, by HPLC (eg, reverse phase HPLC) or other methods. This will be described in more detail herein.

[0154] As explained in more detail below, part It is a photolabile group. Photolysis of produces a modified polynucleotide or an analog or derivative thereof, which is modified by the presence of R. Photolysis is described in more detail herein. A polynucleotide or an analog or derivative thereof may be modified by the presence of an R moiety in formula (I) wherein The photo-cleavage of the polynucleotide or its analog or derivative will be retained on the polynucleotide or its analog or derivative. This will be discussed in more detail below.

[0155] The compound of formula (I) used in the method of the present invention is compatible with a variety of well-known polynucleotide synthesis methods, including the phosphoramidite method, the H-phosphonate method and the phosphotriester method. Therefore, the method of the present invention includes the phosphoramidite method of polynucleotide synthesis, the H-phosphonate method of polynucleotide synthesis and the phosphotriester method of polynucleotide synthesis. Preferably, the method of the present invention is the phosphoramidite method of polynucleotide synthesis.

[0156] Also provided are compounds of formula (I) per se.

[0157] Further provided is a modified polynucleotide or an analog or derivative thereof, which comprises a group of formula (I*).

[0158]

[0159] In formula (I*), R H , L 1 , R and n are as defined herein. P* It is a phospho-linked bond to a polynucleotide or its analogs or derivatives.

[0160] Hydrophobic group R H and a linker L 1

[0161] In formula (I), R H It is a hydrophobic group. H It can be any suitable hydrophobic group. For example, R H It can be any group that changes the hydrophobicity of a polynucleotide or its analogue or derivative when a compound of formula (I) is attached to it, such that the modified polynucleotide or its analogue or derivative can be separated from the unmodified polynucleotide or its analogue or derivative, for example, by HPLC.

[0162] R can be any modification group that increases the hydrophobicity of the polynucleotide or its analog or derivative to which it is attached according to the disclosed methods. R can increase the hydrophobicity of the polynucleotide or its analog or derivative to which it is attached by at least 1%, at least 2%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 200%, at least 500% or more.

[0163] When the polynucleotide or its analog or derivative is evaluated by HPLC (eg, reverse phase HPLC (RPHPCL)), R can change the properties of the polynucleotide or its analog or derivative to which it is attached according to the disclosed methods.

[0164] R can increase the interaction strength between the polynucleotide or its analog or derivative connected thereto and the RPHPCL column according to the disclosed method. For example, the RPHPCL column can include a hydrocarbon chain (e.g., C 1-20 A porous silica support modified with alkyl, alkenyl and / or alkynyl chains) is called a stationary phase. The molecules are separated from the mixture applied to the chromatographic column according to their hydrophobicity by elution with a hydrophobic molecule (e.g., acetonitrile) in a hydrophilic phase (e.g., ammonium acetate). The molecules are separated from the mixture applied to the chromatographic column according to their hydrophobicity. The more hydrophobic the molecules are, the slower the elution rate. Therefore, according to the disclosed method, R may cause the polynucleotides or their analogs or derivatives to which it is attached to be separated from the RPHPLC column slower than the corresponding unmodified polynucleotides or their analogs or derivatives. R can improve the separation of modified polynucleotides or their analogs or derivatives from unmodified polynucleotides or their analogs and derivatives by at least 1%, at least 2%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 200%, at least 500% or more.

[0165] R HTypically, it is an organic chemical group having a molecular weight of up to about 5000 g / mol, more typically up to about 1000 g / mol, for example up to about 500 g / mol, for example up to about 300 g / mol. It will be understood by those skilled in the art that, as used herein, R H It is a chemical group and therefore not a particle or nanoparticle, such as a bead.

[0166] Typically, in formula (I), R H Select from C1 to C 20 Alkyl, C2 to C 20 Alkenyl, C2 to C 20 Alkynyl, C5 to C 10 Carbocyclic group, C6 to C 18 aryl, 5- to 10-membered heteroaryl, and 5- to 10-membered heterocyclyl. H may be optionally substituted or may be unsubstituted.

[0167] More typically, R H Selected from C4 to C 16 Alkyl, C4 to C 16 Alkenyl, C4 to C 16 Alkynyl, C5 to C 10 Carbocyclic and C6 to C 10 aryl, and is unsubstituted or optionally substituted, for example as defined herein. More typically, R H Selected from C4 to C 12 Alkyl, C4 to C 12 Alkenyl, C4 to C 12 alkynyl, C5 to C6 carbocyclyl and C6 aryl, and is unsubstituted or optionally substituted, for example as defined herein. Still more typically, R H Selected from C4 to C 12 Alkyl, C4 to C 12 Alkenyl and C4 to C 12 alkynyl, and is unsubstituted or optionally substituted, e.g. as defined herein. More typically, R H Select from C5 to C 12 Alkyl; wherein R H is optionally substituted and is preferably unsubstituted; for example R H It may be an unsubstituted C5 to C9 alkyl group.

[0168] Typically, R H Not the DMT or ODMT group.

[0169] When R H When replaced, R H Typically substituted with 1, 2 or 3 substituents independently selected from halogen, cyano, C1 to C4 alkyl and phenyl.

[0170] In formula (I), L 1 The hydrophobic group R H Attachment to photolabile groups The linker. 1 Any suitable linking group may be used.

[0171] In one embodiment, L 1 is a chemical bond, such as a covalent bond. In some embodiments, wherein L 1 is a chemical bond (e.g., a covalent bond), the hydrophobic group R H Direct attachment to a photolabile group. In some embodiments, this may help simplify the synthesis and / or reduce reagent costs.

[0172] In one embodiment, L 1 is a linker. Any suitable linker may be used. For example, L 1 The linker may include or consist of the following: 20 Alkylene, C2 to C 20 Alkenylene and / or C2 to C 20 wherein the alkylene, alkenylene or alkynylene is optionally substituted by one or more selected from heteroatoms, phosphite groups, phosphate groups, carbonyl groups, C6 to C 10 Aryl, C5 to C 10 The group is interrupted and / or terminated by carbocyclyl, 5 to 10 membered heteroaryl and 5 to 10 membered saturated or partially unsaturated heterocyclyl. The linker may be unsubstituted or may be optionally further substituted. In some embodiments, the use of a chemical linker, such as one of the aforementioned linkers, can be used to increase the hydrophobicity of the hydrophobic group and / or provide a strong scaffold for attaching many different hydrophobic groups depending on the desired application without changing the chemical nature of the photolabile group.

[0173] Typically, L 1 is or comprises a linker comprising C1 to C6 alkylene, C2 to C6 alkenylene and / or C2 to C6 alkynylene, wherein the alkylene, alkenylene or alkynylene is optionally interrupted and / or terminated by one or more groups selected from heteroatoms, carbonyls, phenyls, cyclopentyls or cyclohexyls, 5 to 6 membered heteroaryls and 5 to 6 membered saturated or partially unsaturated heterocyclyls, wherein the linker is optionally further substituted.

[0174] Suitable heteroatoms and heterogroups include -O-, -S-, -SO-, -SO2-, -NR z -、-C(O)NR z etc., where R zis H or methyl, preferably H. An exemplary alkylene group interrupted and / or terminated by an -O- atom is an alkylene glycol group, and thus the linking group may comprise or consist of a polyalkylene glycol, such as polyethylene glycol (PEG). Typically, the linking group is not linked to a biotin or streptavidin moiety. Sometimes L 1 is or comprises a linker comprising a C1 to C6 alkylene, a C2 to C6 alkenylene and / or a C2 to C6 alkynylene, wherein the alkylene, alkenylene or alkynylene is not interrupted or terminated by one or more oxo groups.

[0175] When the linker is substituted, the linker is typically substituted with 1, 2 or 3 substituents independently selected from halogen, cyano, -OR x 、-SR x 、-NR x R x 、-C(O)OR x 、-C(O)NR x R x 、-C(O)R x and C1 to C4 alkyl, wherein R x is hydrogen or unsubstituted C1 to C4 alkyl.

[0176] More typically, L 1 is C1 to C6 alkylene, C2 to C6 alkenylene and / or C2 to C6 alkynylene, wherein the alkylene, alkenylene or alkynylene is optionally substituted by one or more heteroatoms selected from -O-, -S-, -SO-, -SO2-, -NR z - and -C(O)NR z The groups are interrupted and / or terminated, wherein R z is H or methyl; carbonyl, phenyl, cyclopentyl or cyclohexyl, 5- to 6-membered heteroaryl and 5- to 6-membered saturated or partially unsaturated heterocyclic group.

[0177] Typically, when the linker includes a 5- to 6-membered heteroaryl group, the heteroaryl group is a triazole or an imidazole, preferably a triazole.

[0178] More typically, L 1 is C1 to C3 alkylene, C2 to C3 alkenylene and / or C2 to C3 alkynylene, wherein the alkylene, alkenylene or alkynylene is optionally substituted by one or more selected from -O-, -NR z - and -C(O)NR z The groups are interrupted and / or terminated, wherein R z is H; carbonyl, phenyl, triazole or imidazole.

[0179] In some embodiments, L 1is or includes a moiety of the form: -AB-, wherein A is a C1 to C5 alkylene group, which is unsubstituted or substituted as described herein, preferably unsubstituted; and B is a cyclic group selected from C6 aryl; C5 to C6 carbocyclyl; 5- to 6-membered heteroaryl; and 5- to 6-membered saturated or partially unsaturated heterocyclyl.

[0180] Preferably, when the linking group comprises a moiety of the form: AB-, A is an unsubstituted C1 to C4 alkylene; and B is a cyclic group selected from C6 aryl; C5 to C6 carbocyclic group; 5 to 6 membered heteroaryl; and 5 to 6 membered saturated or partially unsaturated heterocyclic group.

[0181] More preferably, when the linking group comprises a moiety of the form: -AB-, A is an unsubstituted C1 to C3 alkylene; and B is a cyclic group selected from triazole, benzene, cyclohexane, piperidine, pyridazine, pyridine, thiazole and imidazole, preferably triazole.

[0182] In some embodiments, the linking group includes a moiety of the form:

[0183]

[0184] The wavy line indicates the point of attachment to the rest of the molecule.

[0185] In some embodiments, the linking group is a moiety of the form: -C-, wherein C is a C2 to C5 alkynylene, which is unsubstituted or substituted as described herein, preferably unsubstituted. In some embodiments, C is an unsubstituted C2 to C3 alkynylene. In some embodiments, the linking group is a moiety of the form:

[0186]

[0187] The wavy line indicates the point of attachment to the rest of the molecule.

[0188] Phosphorus group R P

[0189] In formula (I), R P is a phosphorus-based group, which is suitable for reacting with a polynucleotide or an analog or derivative thereof, thereby modifying the polynucleotide or an analog or derivative thereof with a compound of formula (I).

[0190] In the disclosed method, the reactive functional group of the polynucleotide modified with the compound of formula (I) or its analog or derivative is combined with the group R P Reaction, thereby the hydrophobic group R of the compound of formula (I) HAttach to a polynucleotide or an analog or derivative thereof, and thereby modify the polynucleotide or an analog or derivative thereof.

[0191] The disclosed method may include reacting a reactive functional group at the 5' or 3' position of a polynucleotide or an analog or derivative thereof with R P Thus, the compounds of formula (I) can be used to modify polynucleotides or analogs or derivatives thereof, whether synthesized in the 3' to 5' direction or in the 5' to 3' direction.

[0192] Typically, the disclosed methods comprise reacting a reactive functional group at the 5' position of a polynucleotide or an analog or derivative thereof with R P Typically, the disclosed method comprises reacting a free hydroxyl group at the 5' position of a polynucleotide or an analog or derivative thereof with a phosphorus group R P This is particularly useful for the synthesis of polynucleotide chains in the 3' to 5' direction, which are typically cheaper and more versatile, and thus typically leave a free hydroxyl group at the 5' position for reaction with R of formula (I). P Group reaction.

[0193] However, in some embodiments, the disclosed methods include reacting a reactive functional group at the 3' position of a polynucleotide or an analog or derivative thereof with R P Typically, in such embodiments, the disclosed methods comprise reacting a free hydroxyl group at the 3' position of a polynucleotide or an analog or derivative thereof with a phosphorus group R P reaction.

[0194] Typically, compounds of formula (I) do not react with functional groups that may be present in positions other than the 5' or 3' position of a polynucleotide or analog or derivative thereof. In some embodiments, no such functional groups are present. In some embodiments, such functional groups are protected or masked to prevent such reactions.

[0195] Typically, the terminal monomer unit of the polynucleotide or its analog or derivative that reacts with the compound of formula (I) is represented by formula (N-1) or formula (N-2), preferably represented by formula (N-1).

[0196]

[0197] The wavy line indicates the point of attachment to the rest of the polynucleotide or its analog or derivative.

[0198] In formulas (N-1) and (N-2), X is an oxygen atom, a nitrogen atom, a sulfur atom or -C(R a R a Preferably, X is an oxygen atom.

[0199] Each R1 and R 1 ' is independently selected from hydrogen, OH, halogen, optionally substituted C1 to C4 alkyl, -OR a ,–SR a ,–NR a R a , –C(O)OR a , –C(O)NR a R a and –C(O)R b For example, between the 2' and 4' positions of the ring, an R 1 The group can be combined with R 1 ' is connected to form a bridging motif, such as a -CH2-O- bridge. Preferably, each R 1 is independently selected from hydrogen, OH, halogen, C1 to C2 alkyl, C1 to C2 haloalkyl and C1 to C2 alkoxy. More preferably, each R 1 is selected from hydrogen, fluorine, methyl and methoxy. Further preferably, each R 1 Preferably, R 1’ is hydrogen, OH, halogen, C1 to C2 alkyl, C1 to C2 haloalkyl and C1 to C2 alkoxy. More preferably, R 1’ is selected from hydrogen, OH, fluorine, methyl and methoxy. Further preferably, R 1’ It is H or OH.

[0200] R B It is a natural or non-natural nucleobase or its derivative or analog that is optionally substituted.Natural nucleobases include adenine, cytosine, guanine, thymine and uracil.Non-natural nucleobases are well known in the art and include, for example, analogs of natural nucleobases, for example 2-thiothymine, isomers of natural nucleobases, for example isoguanine, isocyanine and 5-aza-7-deazaguanine, and other groups used as synthetic nucleobases in the art, for example xanthine. For example, the unnatural nucleobase comprises 2-thiothymine, isoguanine, isocytosine, 1-methylcytosine, 5-aza-7-deazaguanine, 6-amino-5-nitropyridin-2-one, 1-methylcytosine, xanthine, hypoxanthine, 7-methylguanine, 5,6-dihydrouracil, 5-methylcytosine, 5-hydroxymethylcytosine and 2,6-diaminopurine, 6,8-diaminopurine, flucytosine, fluorouracil, mercaptopurine, thioguanine, 5-hydroxymethyluracil and 5-carboxycytosine, as well as fluorescent nucleobases such as 2-aminopurine and tricyclic cytosine tC, tCO and tCnitro. Preferably, R Bis a protected natural or non-natural nucleobase. More preferably, R B It is a protected natural nucleobase.

[0201] Y is a reactive functional group on the polynucleotide and represents a P Typically, Y is -OH or -O - A group, or an activated derivative thereof, most typically -OH. Typically, Y is present in the group R P Or its activated form of the phosphorus atom nucleophilic attack with the compound of formula (I). This will be described in more detail herein.

[0202] Typically, in formula (I), R P is a phosphoramidite, a phosphoramide, an alkylphosphinamide or an alkylphosphinamide. More typically, R P is a phosphoramidite or an alkylphosphinamide. For example, R P It can be a phosphoramidite or a methylphosphinamide. Most commonly, R P It is 2-cyanoethyl N,N-diisopropylphosphoramidite or N,N-diisopropylmethylphosphoramidite.

[0203] Photolabile groups

[0204] As mentioned above, Is a photolabile group. Photolabile groups can be cleaved by photolysis excitation (e.g., by exposure to ultraviolet light). Photolabile groups are typically cleaved under mild conditions that are orthogonal to the reaction conditions typically used in polynucleotide synthesis. This article will describe this in more detail.

[0205] Photolabile groups typically do not include hydrolyzable motifs, such as esters or carbonate groups. Therefore, it is typically stable under the reaction conditions used for deprotecting synthetic polynucleotides, for example, for removing the deprotection conditions of hydrolyzable protecting groups from the protected core bases present in the synthetic polynucleotides. For example, typically photodegradable joints are stable relative to concentrated ammonium hydroxide and / or ammonia. This advantageously allows various protecting groups to be removed from the synthetic polynucleotides while retaining the photolabile groups in situ. Therefore, typically the synthetic polynucleotides or their analogs or derivatives can be modified with formula (I) compounds, and then before purifying the deprotected polynucleotides described herein or their analogs or derivatives, any protected functional groups on the polynucleotides are deprotected.

[0206] The photolabile group is advantageously cleaved in a single, typically coordinated reaction step to provide a modified nucleoside, nucleotide, polynucleotide, or derivative or analog thereof. This is a particular advantage compared to some photolyzable groups known in the art (under different contexts), which include, for example, diester moieties and which cleave to leave residual succinyl functionalization that may not be desired; or which include carbonate moieties and which may cleave to leave residual carbonate functionalization, which may also not be desired. Avoiding such groups is particularly useful because harsh reaction conditions are typically required to remove succinyl or carbonate groups from succinyl or carbonate functionalized polynucleotides, which may cause degradation. In addition, the byproducts of cleavage are typically volatile and therefore easily removed. The photolabile group is typically stable under common hydrolysis conditions.

[0207] In some embodiments, is part of the following formula

[0208]

[0209] In such an embodiment, the compound of formula (I) is thus a compound of formula (II):

[0210]

[0211] Where R H , L 1 , R, n and R P As described in this article.

[0212] In formula (II), is 2-nitrobenzyl, wherein the 2-nitrobenzyl is optionally substituted with 1, 2 or 3 groups independently selected from halogen, optionally substituted C1 to C4 alkyl, -OR a ,–SR a ,–NR a R a , –C(O)OR a 、-C(O)NR a R a , –C(O)R b 、–OC(O)R b and –NHC(O)R b .

[0213] Each R a is independently selected from hydrogen, optionally substituted C1 to C2 alkyl and optionally substituted C1 to C2 alkoxy. Preferably, each R a are independently selected from hydrogen or methyl, more preferably each R a It's hydrogen.

[0214] Each R b is independently selected from hydrogen and optionally substituted C1 to C4 alkyl. Preferably, each R b are independently selected from hydrogen or methyl, more preferably each R b It's hydrogen.

[0215] As used herein, the term "2-nitrobenzyl" refers to nitrobenzyl groups attached to adjacent carbon atoms of formula (I) such that the nitro group is located at the -C(R) position of formula (I). 3 )-2-position of the W-part, as shown below (for clarity, L 1 -R H moieties and optional further substituents are not shown).

[0216]

[0217] That is to say, In the 2-nitrobenzyl represented by the formula (I), the nitro group is ortho to the adjacent carbon atom of the formula (I); that is, the nitro group is ortho to the -C(R 3 )-carbon atom ortho. Those skilled in the art will understand that The 2-nitrobenzyl group represented by may also be referred to as 2-nitrophenyl.

[0218] Therefore, in formula (II), is 2-nitrobenzyl, where -L 1 -R H and –CHR 3 W(R) n R P The substituent is a substituent of the benzene ring; that is, the benzene ring is replaced by –CHR at the 1-position 3 W(R) n R P Substituents; nitro at the 2' position; -L at further positions (eg, at the 3-, 4-, 5- or 6-positions) 1 -R H substituted; and optionally further substituted as described herein; i.e.:

[0219]

[0220] Thus, it will be appreciated by those skilled in the art that compounds of formula (I) have photolysable groups, such as 2-nitrobenzyl groups "inline". This is in contrast to compounds in which the 2'nitrobenzyl group is pendant from the backbone; for example, in which the phosphorus group is linked to the hydrophobic group via an alkylene chain, which may optionally be interrupted by one or more heteroatoms, and in which the alkylene chain may be substituted with aryl groups, which may be further substituted with nitro groups. Such compounds are not examples of compounds of formula (I).

[0221] As mentioned above, nitrophenyl may be unsubstituted (except for -CR shown in formula (II) 3 -W- and –L 1 -H 1 part, or may be further substituted. When further substituted, it may be substituted with 1, 2 or 3 substituents independently selected from, for example, electron donating groups. may be substituted by 1, 2 or 3 groups independently selected from halogen, optionally substituted C1 to C4 alkyl, -OR a ,–SR a ,–NR a R a , –C(O)OR a , –C(O)NR a R a , –C(O)R b 、–OC(O)R b and –NHC(O)R b , where R a and R b As defined above. Preferably, when When substituted, it is substituted by 1, 2 or 3, preferably 1 or 2, groups selected from C1 to C4 alkyl, -OR a ,–SR a ,–NR a R a 、–OC(O)R b and –NHC(O)R b More preferably, when When substituted, it is substituted by 1 or 2, preferably 1, groups selected from OR a and –OC(O)R b , preferably methoxy. Most preferably, Remove the nitro group of nitrobenzene and –CR as described above 3 -W- and –L 1 -H 1 Some parts have not been replaced.

[0222] Typically, in formula (II), L 1 and R H Together they are represented by formula (A-1) or formula (A-2):

[0223]

[0224] Where L 1 and R H As defined herein.

[0225] In formulas (A-1) and (A-2), R 4 , R 5 , R 6 and R 7 Each is independently selected from hydrogen and a substituent, which may be an electron donating group. In formulas (A-1) and (A-2), R 4 , R 5 , R 6 and R 7 Typically each is independently selected from hydrogen, halogen, optionally substituted C1 to C4 alkyl, -OR a ,–SR a ,–NR a R a , –C(O)OR a , –C(O)NR a R a , –C(O)R b 、–OC(O)R b and –NHC(O)R b , where R a and R b As defined above.

[0226] Preferably, R 4 , R 5 , R 6 and R 7 are each independently selected from hydrogen, fluorine, optionally substituted C1 to C4 alkyl, -OR a ,–SR a ,–NR a R a 、–OC(O)R b and –NHC(O)R b More preferably, R 4 , R 5 , R 6 and R 7 are each independently selected from hydrogen, –OR a ,–SR a ,–NR a R a 、–OC(O)R b and –NHC(O)R b Even more preferably, R 4 , R 5 , R 6 and R 7 are each independently selected from hydrogen, –OR a and –OC(O)R b More preferably, R 4 , R 5 , R 6 and R7 Each is independently selected from hydrogen and methoxy. Without being bound by theory, the inventors believe that when R 4 , R 5 , R 6 and R 7 When one or more of R is an electron donating group, the linker is more easily cleaved using photoexcitation. 4 , R 5 , R 6 and / or R 7 When it is hydrogen, the synthesis of the compound of formula (I) may be easier.

[0227] Preferably, R 4 , R 5 , R 6 and / or R 7 At least one of is hydrogen. For example, R 4 , R 5 , R 6 and / or R 7 Preferably, one, two or three of R 4 and R 7 One of them is hydrogen, R 4 and R 7 The other of which is selected from hydrogen, –OR a and –OC(O)R b Preferably, R 5 or R 6 is hydrogen. For example, in some embodiments, R 4 and R 7 One of them is hydrogen, R 4 and R 7 The other of which is selected from hydrogen, –OR a and –OC(O)R b , R 5 or R 6 is hydrogen or methoxy.

[0228] In formula (II), R 3 is methyl, ethyl or C1 to C2 haloalkyl. 3 is methyl, ethyl or C1 to C2 fluoroalkyl. More preferably, R 3 is methyl or ethyl. Or, R 3 It can be methyl or CF3. Most preferably, R 3 is a methyl group. 3 When it is one of these groups, the photolabile group can be cleaved more easily using photoexcitation.

[0229] In formula (II), W is selected from a group of formula (W-2); an oxygen atom; and a group of formula (W-1):

[0230]

[0231] in:

[0232] -When n is 1, R P is phosphoramidite, phosphoramide, alkylphosphinamide or alkylphosphinamide; when n is 0, R P Together with the oxygen atom to which it is attached, it forms a phosphoramidite, phosphoramide, alkylphosphinamide or alkylphosphinamide;

[0233] The phosphoramidite, phosphoramide, alkylphosphinate or alkylphosphinate is preferably phosphoramidite or methylphosphinate, more preferably 2-cyanoethyl N,N-diisopropylphosphinate or N,N-diisopropylmethylphosphinate;

[0234] -Q is an oxygen atom or a sulfur atom; and

[0235] - Each R 2 Independently selected from hydrogen, methyl, ethyl, C1 to C2 haloalkyl and halogen groups.

[0236] Typically, in formula (W-2) and (W-1), Q is an oxygen atom.

[0237] Typically, in formulas (W-2) and (W-1), each R 2 is independently selected from hydrogen, methyl, ethyl, C1 to C2 haloalkyl and halogen. More typically, each R 2 are independently selected from hydrogen, methyl and ethyl.

[0238] When two R 2 When groups are attached to the same carbon atom, typically one R 2 The group is hydrogen, and one R 2 The group is selected from hydrogen, methyl, ethyl, C1 to C2 haloalkyl and halogen groups, typically selected from hydrogen, methyl and ethyl.

[0239] Typically, each R 2 are independently hydrogen or methyl. More typically, when two R 2 When the groups are attached to the same carbon atom, one R 2 The group is hydrogen, and the other R 2 The radical is hydrogen or methyl.

[0240] Typically, each R 2 is hydrogen. This can make the synthesis of the compound of formula (I) easier.

[0241] Typically, W is a group of formula (W-2) or an oxygen atom. Most typically, W is a group of formula (W-2).

[0242] When W is a group of formula (W-2), n is typically 0, so that the compound of formula (II) is a compound of formula (II-3):

[0243]

[0244] Where R H , L 1 , R 3 , Q, R 2 As defined herein.

[0245] Typically, in formula (II-3), R P Together with the oxygen atom to which it is attached, it forms an alkylphosphinamide. Typically, R P Together with the oxygen atom to which it is attached, it forms C 1-4 More typically, R P Together with the oxygen atom to which it is attached, it forms a methylphosphinamide. Most typically, R P Together with the oxygen atom to which it is attached, it forms N,N-diisopropylmethylphosphinamide, so that the part of formula (II) is as follows:

[0246]

[0247] The curved line indicates Partial connection point.

[0248] Thus, in some embodiments, the compound of formula (II) is:

[0249]

[0250] Where R H , L 1 , R 3 and R 2 As defined herein.

[0251] In some embodiments, the compound of formula (II) is:

[0252]

[0253] Where R H and L 1 As defined herein.

[0254] Typically, L 1 -R H for

[0255]

[0256] The wavy line indicates the point of attachment to the rest of the molecule. H C5 to C 12 Alkyl; wherein R H is optionally substituted and preferably unsubstituted; for example R H It may be an unsubstituted C5-C9 alkyl group.

[0257] Just to help understanding, and not to be bound by theory in any way, the inventors believe that the compound of formula (II-3) can undergo photolytic cleavage, as shown in the following specific example,

[0258]

[0259] wherein pnt is a polynucleotide modified at an oxygen atom with a compound of formula (I) or an analog or derivative thereof, HB is an acid, and B is a base. However, the present invention is not limited to this specific compound or methods of using this specific compound.

[0260] When W is an oxygen atom, n is typically 0, so that the compound of formula (II) is a compound of formula (II-1):

[0261]

[0262] Where R H , L 1 , and R 3 As defined herein.

[0263] Typically, in formula (II-1), R P Together with the oxygen atom to which it is attached, it forms a phosphoramidite. Typically, R P Together with the oxygen atom to which it is attached, it forms a substituted C 1-4 Alkyl phosphoramidites. Most typically, R P Together with the oxygen atom to which it is attached, it forms 2-cyanoethyl N,N-diisopropylphosphoramidite, so that the part of formula (II) is as shown in the following figure:

[0264]

[0265] The curved line indicates Partial connection point.

[0266] Thus, in some embodiments, the compound of formula (II) is:

[0267]

[0268] Where R H , L 1 , R3 , and R 2 As defined herein.

[0269] In some embodiments, the compound of formula (II) is:

[0270]

[0271] Where R H and L 1 As defined herein.

[0272] Typically, L 1 -R H for

[0273]

[0274] The wavy line indicates the point of attachment to the rest of the molecule. H C5 to C 12 Alkyl; wherein R H is optionally substituted and preferably unsubstituted; for example R H It may be an unsubstituted C5-C9 alkyl group.

[0275] Just to help understanding, and not to be bound by theory in any way, the inventors believe that the compound of formula (II-1) can undergo photolytic cleavage, as shown in the following specific example,

[0276]

[0277] wherein pnt is a polynucleotide modified with a compound of formula (I) or an analog or derivative thereof, HB is an acid, and B is a base. However, the present invention is not limited to this specific compound or methods of using this specific compound.

[0278] When W is a group of formula (W-1), n ​​is typically 1, so that the compound of formula (II) is a compound of formula (II-2):

[0279]

[0280] Where R H , L 1 , R 3 , Q and R 2 As defined herein.

[0281] Typically, in formula (II-2), R P is a phosphoramidite. Typically, R P is replaced by C 1-4 Alkyl phosphoramidites. Most typically, R Pis 2-cyanoethyl N,N-diisopropylphosphoramidite, so that the portion of formula (II) is as follows:

[0282]

[0283] The curved line indicates Partial connection point.

[0284] Thus, in some embodiments, the compound of formula (II) is:

[0285]

[0286] Where R H , L 1 , R 3 , R 2 and R are as defined herein.

[0287] In some embodiments, the compound of formula (II) is:

[0288]

[0289] Among them, R H and L 1 As defined herein.

[0290] Typically, L 1 -R H for

[0291]

[0292] The wavy line indicates the point of attachment to the rest of the molecule. H C5 to C 12 Alkyl; wherein R H is optionally substituted and preferably unsubstituted; for example R H It may be an unsubstituted C5-C9 alkyl group.

[0293] Just to help understanding, and not to be bound by theory in any way, the inventors believe that the compound of formula (II-2) can undergo photolytic cleavage, as shown in the following specific example,

[0294]

[0295] wherein pnt is a polynucleotide modified with a compound of formula (I) or an analog or derivative thereof, HB is an acid, and B is a base. However, the present invention is not limited to this specific compound or methods of using this specific compound.

[0296] Modification group R

[0297] In formula (I), R is a modifying group and n is 0 or 1. Thus, R may be present optionally. For example, R may be present (i.e., n may be 1), particularly when is a part of the following formula as defined herein

[0298]

[0299] and W is a group of formula (W-1) as defined herein.

[0300] In formula (I), R may be any suitable modification group. Suitable modification groups may be, for example, groups introduced at the terminus, for example, the 5' terminus, of a synthetic polynucleotide.

[0301] For example, R can be selected from:

[0302] (i) a nucleoside or a derivative or analogue thereof;

[0303] (ii) a group comprising or consisting of: C1 to C 20 Alkylene, C2 to C 20 Alkenylene and / or C2 to C 20 wherein the alkylene, alkenylene or alkynylene group is optionally substituted by one or more selected from heteroatoms; phosphite; phosphate; carbonyl; C6 to C 10 Aryl; C5 to C 10 carbocyclyl; 5- to 10-membered heteroaryl; and 5- to 10-membered heterocyclyl groups interrupted and / or terminated; and wherein R is optionally further substituted; and

[0304] (iii) a second polynucleotide or a derivative or analogue thereof.

[0305] When R is a nucleoside or a derivative or analog, R is typically a ribose or deoxyribonucleoside. R may be a nucleoside having a purine or pyrimidine base. R may be an abasic nucleoside.

[0306] In some embodiments, R can be selected from adenosine, guanosine, thymidine, uridine, 5-methylcytidine, 5-hydroxymethylcytidine, cytidine, cyclic adenosine, cyclic guanosine, deoxyadenosine, deoxyguanosine, deoxythymidine, deoxyuridine, deoxycytidine, and deoxymethylcytidine.

[0307] In some embodiments, R may include or consist of nitroindole, inosine, acridine, 2-aminopurine, 2-6-diaminopurine, 5-bromodeoxyuridine, inverted thymidine (inverted dT), inverted dideoxy-thymidine (ddT), dideoxycytidine (ddC), 5-hydroxymethylcytidine, 2'-O-methyl RNA base, isodeoxycytidine (Iso-dC), isodeoxyguanosine (Iso-dG).

[0308] In some embodiments, R is a nucleoside analog, such as an abasic nucleoside or a peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), or locked nucleic acid (LNA) analog of adenosine, guanosine, thymidine, uridine, 5-methylcytidine, 5-hydroxymethylcytidine, cytidine, cyclic adenosine, cyclic guanosine, deoxyadenosine, deoxyguanosine, deoxythymidine, deoxyuridine, deoxycytidine, and deoxymethylcytidine.

[0309] An example of the synthesis and use of a deoxythymidine (dT) modified compound of formula (I) is provided in Examples 3 and 8.

[0310] In some embodiments, R comprises or consists of: C1 to C 20 Alkylene, C2 to C 20 Alkenylene and / or C2 to C 20 Alkyne, wherein the alkylene, alkenylene or alkynylene is optionally substituted by one or more selected from heteroatoms; phosphite; phosphate; carbonyl; C6 to C 10 Aryl; C5 to C 10 carbocyclyl; 5- to 10-membered heteroaryl; and 5- to 10-membered heterocyclyl groups are interrupted and / or terminated; and wherein R is optionally further substituted.

[0311] In some embodiments, R comprises or consists of: C2 to C6 alkylene, C2 to C6 alkenylene and / or C2 to C6 alkynylene, wherein the alkylene, alkenylene or alkynylene is optionally interrupted and / or terminated by one or more groups selected from heteroatoms, carbonyls, phenyls, cyclopentyls or cyclohexyls, 5 to 6 membered heteroaryls, and 5 to 6 membered saturated or partially unsaturated heterocyclyls, wherein R is optionally further substituted.

[0312] In some embodiments, R comprises or consists of: unsubstituted C2 to C6 alkylene. For example, in some embodiments, R comprises or consists of: C3 alkylene. Thus, R and the R to which it is attached P The groups together may include a C3 spacer. An example of the synthesis and use of a compound of formula (I) providing a C3 spacer modification is provided in Examples 2 and 6.

[0313] In some embodiments, R comprises or consists of: one or more PEG(CH2CH2O) moieties. For example, in some embodiments, R comprises or consists of: (OCH2CH2) n wherein n is an integer between 1 and 10, for example, between 3 and 6. Thus, R and the R to which it is connected P The groups together may include an iSp9 spacer (Spacer 9) or an iSp18 spacer (Spacer 18).

[0314] In some embodiments, R is a second polynucleotide or a derivative or analog thereof. In some embodiments, R is a polynucleotide comprising 2 to 100 nucleotide monomers, such as 2 to 10 monomers, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 monomers.

[0315] Preferred aspects

[0316] In some preferred aspects of the disclosed methods and compounds, the method is a method for modifying a polynucleotide or a peptide nucleic acid (PNA) analog, a glycerol nucleic acid (GNA) analog, a threose nucleic acid (TNA) analog or a locked nucleic acid (LNA) analog thereof, comprising reacting a polynucleotide or a peptide nucleic acid (PNA) analog, a glycerol nucleic acid (GNA) analog, a threose nucleic acid (TNA) analog or a locked nucleic acid (LNA) analog thereof with a compound of formula (II):

[0317]

[0318] in:

[0319] - is 2-nitrobenzyl, wherein the 2-nitrobenzyl is optionally substituted by 1, 2 or 3 groups independently selected from halogen, optionally substituted C1 to C4 alkyl, -OR a 、-SR a 、-NR a R a 、-C(O)OR a 、-C(O)NR a R a 、-C(O)R b 、-OC(O)R b and -NHC(O)R b , where each R a are independently selected from hydrogen, optionally substituted C1 to C2 alkyl and optionally substituted C l to C2 alkoxy, and each R b independently selected from hydrogen and optionally substituted C1 to C4 alkyl;

[0320] -R3 is methyl, ethyl or C1 to C2 haloalkyl;

[0321] W is selected from a group of formula (W-2); an oxygen atom; and a group of formula (W-1):

[0322]

[0323] -n is an integer selected from 0 and 1;

[0324] -When n is 1, R P is a phosphoramidite, a phosphoramide, an alkylphosphinamide or an alkylphosphinamide;

[0325] -When n is 0, R P Together with the oxygen atom to which it is attached, it forms a phosphoramidite, phosphoramide, alkylphosphinamide or alkylphosphinamide;

[0326] -Q is an oxygen atom or a sulfur atom;

[0327] - Each R 2 independently selected from hydrogen, methyl, ethyl, C1 to C2 haloalkyl and halogen groups;

[0328] -R is selected from:

[0329] (i) Nucleoside or its peptide nucleic acid (PNA) analogue, glycerol nucleic acid (GNA)

[0330] analogs, threose nucleic acid (TNA) analogs, or locked nucleic acids (LNA)

[0331] analog;

[0332] (ii) Includes C1 to C 20 Alkylene, C2 to C 20 Alkenylene and / or C2 to C 20 alkynylene groups, wherein the alkylene, alkenylene or alkynylene groups are optionally interrupted and / or terminated by one or more groups selected from:

[0333] -O-, -S-, -SO-, -SO2-, -NR z -、-C(O)NR z , where R z is H or methyl; phosphite group; phosphate group; carbonyl group; C6 to C 10 Aryl; C5 to C 10 carbocyclyl; 5 to 10 membered heteroaryl; and 5 to 10 membered heterocyclyl; and wherein R is optionally further substituted; and

[0334] (iii) a second polynucleotide or a peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA) or locked nucleic acid (LNA) analog thereof;

[0335] -R H Select from C1 to C 20 Alkyl, C2 to C 20 Alkenyl, C2 to C 20 Alkynyl, C5 to C 10 Carbocyclic group, C6 to C 18 aryl, 5- to 10-membered heteroaryl, and 5- to 10-membered heterocyclyl, wherein R H is optionally substituted; and

[0336] -L 1 selected from: (i) a chemical bond; and (ii) a linker comprising C1 to C 20 Alkylene, C2 to C 20 Alkenylene and / or C2 to C 20 Alkyne, wherein the alkylene, alkenylene or alkynylene is optionally substituted by one or more selected from -O-, -S-, -SO-, -SO2-, -NR z -, and -C(O)NR z The groups are interrupted and / or terminated, wherein R z is H or methyl, phosphite, phosphate, carbonyl, C6 to C 10 Aryl, C5 to C 10 carbocyclyl, 5- to 10-membered heteroaryl and 5- to 10-membered saturated or partially unsaturated heterocyclyl, wherein the linker is optionally further substituted;

[0337] Under such conditions, the free hydroxyl group at the 5' or 3' position of the polynucleotide or its peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA) or locked nucleic acid (LNA) analogues is bound to R P reaction, thereby R H Linked to a polynucleotide or a peptide nucleic acid (PNA) analog, a glycerol nucleic acid (GNA) analog, a threose nucleic acid (TNA) analog, or a locked nucleic acid (LNA) analog thereof.

[0338] As mentioned above, those skilled in the art will understand that The 2-nitrobenzyl represented by may also be referred to as 2-nitrophenyl. Therefore, in some preferred aspects of the disclosed methods and compounds, the method is a method for modifying a polynucleotide or a peptide nucleic acid (PNA) analog, a glycerol nucleic acid (GNA) analog, a threose nucleic acid (TNA) analog or a locked nucleic acid (LNA) analog thereof, comprising reacting a polynucleotide or a peptide nucleic acid (PNA) analog, a glycerol nucleic acid (GNA) analog, a threose nucleic acid (TNA) analog or a locked nucleic acid (LNA) analog thereof with a compound of formula (II):

[0339]

[0340] in:

[0341] - is 2-nitrophenyl, wherein the 2-nitrophenyl is optionally substituted by 1, 2 or 3 groups independently selected from halogen, optionally substituted C1 to C4 alkyl, -OR a ,–SR a ,–NR a R a , –C(O)OR a 、-C(O)NR a R a , –C(O)R b 、–OC(O)R b and –NHC(O)R b , where each R a are independently selected from hydrogen, optionally substituted C1 to C2 alkyl and optionally substituted C l to C2 alkoxy, and each R b independently selected from hydrogen and optionally substituted C1 to C4 alkyl; -R 3 is methyl, ethyl or C1 to C2 haloalkyl;

[0342] -W is selected from a group of formula (W-2); an oxygen atom; and a group of formula (W-1):

[0343]

[0344] -n is an integer selected from 0 and 1;

[0345] -When n is 1, R P is a phosphoramidite, a phosphoramide, an alkylphosphinamide or an alkylphosphinamide;

[0346] -When n is 0, R P Together with the oxygen atom to which it is attached, it forms a phosphoramidite, phosphoramide, alkylphosphinamide or alkylphosphinamide;

[0347] -Q is an oxygen atom or a sulfur atom;

[0348] - Each R 2 independently selected from hydrogen, methyl, ethyl, C1 to C2 haloalkyl and halogen groups;

[0349] -R is selected from:

[0350] (iii) a nucleoside or a peptide nucleic acid (PNA) analog thereof, a glycerol nucleic acid (GNA) analog, a threose nucleic acid (TNA) analog, or a locked nucleic acid (LNA) analog;

[0351] (iv) Includes C1 to C 20 Alkylene, C2 to C 20 Alkenylene and / or C2 to C 20 wherein the alkylene, alkenylene or alkynylene group is optionally interrupted and / or terminated by one or more groups selected from: -O-, -S-, -SO-, -SO2-, -NR z -、-C(O)NR z , where R z is H or methyl; phosphite group; phosphate group; carbonyl group; C6 to C 10 Aryl; C5 to C 10 carbocyclyl; 5 to 10 membered heteroaryl; and 5 to 10 membered heterocyclyl; and wherein R is optionally further substituted; and

[0352] (iii) a second polynucleotide or a peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA) or locked nucleic acid (LNA) analog thereof;

[0353] -R H Select from C1 to C 20 Alkyl, C2 to C 20 Alkenyl, C2 to C 20 Alkynyl, C5 to C 10 Carbocyclic group, C6 to C 18 aryl, 5- to 10-membered heteroaryl, and 5- to 10-membered heterocyclyl, wherein R H is optionally substituted; and

[0354] -L 1 selected from: (i) a chemical bond; and (ii) a linker comprising C1 to C 20 Alkylene, C2 to C 20 Alkenylene and / or C2 to C 20 Alkyne, wherein the alkylene, alkenylene or alkynylene is optionally substituted by one or more selected from -O-, -S-, -SO-, -SO2-, -NR z -, and -C(O)NR z The groups are interrupted and / or terminated, wherein R zis H or methyl, phosphite, phosphate, carbonyl, C6 to C 10 Aryl, C5 to C 10 Carbocyclyl, 5- to 10-membered heteroaryl, and 5- to 10-membered saturated or partially unsaturated heterocyclyl, wherein the linking group is optionally further substituted;

[0355] Under such conditions, the free hydroxyl group at the 5' or 3' position of the polynucleotide or its peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA) or locked nucleic acid (LNA) analogues is bound to R P reaction, thereby R H Linked to a polynucleotide or a peptide nucleic acid (PNA) analog, a glycerol nucleic acid (GNA) analog, a threose nucleic acid (TNA) analog, or a locked nucleic acid (LNA) analog thereof.

[0356] Preferably, in the disclosed methods, the method is a method of modifying a polynucleotide.

[0357] In some preferred aspects of the disclosed methods or compounds, R is selected from

[0358] (i) nucleosides;

[0359] (ii) C1 to C 20 Alkylene, C2 to C 20 Alkenylene or C2 to C 20 Alkyne, wherein the alkylene, alkenylene or alkynylene is optionally interrupted by one or more groups and / or

[0360] Or terminated, the group is selected from: -O-, -S-, -SO-, -SO2-, -NR z -and

[0361] -C(O)NR z , where R z is H or methyl; phosphite group; phosphate group; carbonyl group; C6 to C 10 Aryl; C5 to C 10 carbocyclyl; 5 to 10 membered heteroaryl; and 5 to 10 membered heterocyclyl; and wherein R is optionally further substituted by a halogen group, a cyano group, -OR x ,

[0362] -SR x 、-NR x R x 、-C(O)OR x 、-C(O)NR x R x 、-C(O)R x or C1 to C4 alkyl, wherein the C1 to C4 alkyl is not substituted or is substituted by 1 to 3 halogen atoms, and each R xindependently selected from hydrogen and C1 to C4 alkyl which is unsubstituted or substituted with 1, 2 or 3 halogen groups; and

[0363] (iii) another polynucleotide.

[0364] In some preferred aspects of the disclosed methods or compounds, when i) R H and ii) L 1 (Where L 1 are independently substituted, they are independently substituted by halogen groups, cyano groups, -OR x 、-SR x 、-NR x R x 、-C(O)OR x 、-C(O)NR x R x 、-C(O)R x or C1 to C4 alkyl, wherein the C1 to C4 alkyl is not substituted or is substituted by 1 to 3 halogen atoms, and each R x Independently selected from hydrogen and C1 to C4 alkyl which is unsubstituted or substituted with 1, 2 or 3 halogen groups.

[0365] In some preferred aspects of the disclosed methods or compounds, is 2-nitrobenzyl (or 2-nitrophenyl), and the 2-nitrobenzyl is optionally substituted by 1, 2 or 3 independently selected from halogen, C1 to C4 alkyl, -OR a 、-SR a 、-NR a R a 、-C(O)OR a 、-C(O)NR a R a 、-C(O)R b 、-OC(O)R b and -NHC(O)R b substituted with a group, wherein each R a independently selected from hydrogen, C1 to C2 alkyl and C1 to C2 alkoxy and each R b Independently selected from hydrogen and C1 to C4 alkyl.

[0366] Preferably, in the disclosed methods and compounds:

[0367] - The compound of formula (I) is a compound of formula (II)

[0368]

[0369] - L 1 and R Hare collectively represented by formula (A-1):

[0370]

[0371] -R 4 , R 5 , R 6 and R 7 are each independently selected from hydrogen, -OR a 、-SR a 、-NR a R a 、-OC(O)R b and -NHC(O)R b ;

[0372] -L 1 is C1 to C3 alkylene, C2 to C3 alkenylene and / or C2 to C3 alkynylene; or is a moiety of the form: -AB-, wherein A is unsubstituted C1 to C4 alkylene; and B is a ring group selected from C6 aryl, C5 to C6 carbocyclyl, 5 to 6-membered heteroaryl and 5 to 6-membered saturated or partially unsaturated heterocyclyl;

[0373] -R H Selected from C4 to C 16 Alkyl, C4 to C 16 Alkenyl, C4 to C 16 Alkynyl, C5 to C 10 Carbocyclic and C6 to C 10 Aryl;

[0374] -R 3 is methyl, ethyl or C1 to C2 haloalkyl;

[0375] -W is selected from a group of formula (W-2), an oxygen atom and a group of formula (W-1):

[0376]

[0377] -When n is 1, R P is phosphoramidite or alkylphosphinamide, when n is 0, R P Together with the oxygen atom connected thereto, it forms a phosphoramidite or an alkylphosphinamide;

[0378] -Q is an oxygen atom or a sulfur atom; and

[0379] -Each R 2 are independently selected from hydrogen, methyl, ethyl, C1 to C2 haloalkyl and halogen groups; and

[0380] -R is a nucleoside or a derivative or analog thereof; or is a C2 to C6 alkylene, C2 to C6 alkenylene and / or C2 to C6 alkynylene, wherein the alkylene, alkenylene or alkynylene is optionally interrupted and / or terminated by one or more groups selected from heteroatoms, carbonyls, phenyls, cyclopentyls or cyclohexyls, 5 to 6-membered heteroaryls and 5 to 6-membered saturated or partially unsaturated heterocyclic groups.

[0381] In a first preferred aspect,

[0382] - The compound of formula (I) is a compound of the following formula:

[0383]

[0384] - L 1 and R H are collectively represented by formula (A-1):

[0385]

[0386] -R 4 , R 5 , R 6 and R 7 are each independently selected from hydrogen, -OR a 、-SR a 、-NR a R a 、-OC(O)R b and -NHC(O)R b ; Preferably hydrogen;

[0387] -L 1 is C1 to C3 alkylene, C2 to C3 alkenylene or C2 to C3 alkynylene; or is a moiety of the form: -AB-, wherein A is unsubstituted C1 to C3 alkylene; and B is a cyclic group selected from triazole, benzene, cyclohexane, piperidine, pyridazine, pyridine, thiazole and imidazole;

[0388] -R H Selected from C4 to C 12 Alkyl, C4 to C 12 Alkenyl and C4 to C 12 Alkynyl;

[0389] -R 3 is methyl;

[0390] -Each R 2 are independently hydrogen or methyl.

[0391] In a second preferred aspect,

[0392] - The compound of formula (I) is a compound of the following formula:

[0393]

[0394] - L 1 and R H are collectively represented by formula (A-1):

[0395]

[0396] -R 4 , R 5 , R 6 and R 7 are each independently selected from hydrogen, -OR a 、-SR a 、-NR a R a 、-OC(O)R b and -NHC(O)R b ; Preferably hydrogen;

[0397] -L 1 is C1 to C3 alkylene, C2 to C3 alkenylene or C2 to C3 alkynylene; or is a moiety of the form: -AB-, wherein A is unsubstituted C1 to C3 alkylene; and B is a cyclic group selected from triazole, benzene, cyclohexane, piperidine, pyridazine, pyridine, thiazole and imidazole;

[0398] -R H Selected from C4 to C 12 Alkyl, C4 to C 12 Alkenyl and C4 to C 12 Alkynyl;

[0399] -R 3 It is methyl.

[0400] In a third preferred aspect,

[0401] - The compound of formula (I) is a compound of the following formula:

[0402]

[0403] - L 1 and R H are collectively represented by formula (A-1):

[0404]

[0405] -R 4 , R 5 , R 6 and R 7 are each independently selected from hydrogen, -OR a 、-SR a 、-NRa R a ,

[0406] -OC(O)R b and -NHC(O)R b ; Preferably hydrogen;

[0407] -L 1 is C1 to C3 alkylene, C2 to C3 alkenylene or C2 to C3 alkynylene; or is a moiety of the form: -AB-, wherein A is unsubstituted C1 to C3 alkylene; and B is a cyclic group selected from triazole, benzene, cyclohexane, piperidine, pyridazine, pyridine, thiazole and imidazole;

[0408] -R H Selected from C4 to C 12 Alkyl, C4 to C 12 Alkenyl and C4 to C 12 Alkynyl;

[0409] -R 3 is methyl;

[0410] - Each R 2 are independently hydrogen or methyl; and

[0411] -R is a nucleoside or a derivative or analog thereof; or is a C2 to C6 alkylene, C2 to C6 alkenylene and / or C2 to C6 alkynylene, wherein the alkylene, alkenylene or alkynylene is optionally interrupted and / or terminated by one or more groups selected from heteroatoms, carbonyls, phenyls, cyclopentyls or cyclohexyls, 5 to 6-membered heteroaryls and 5 to 6-membered saturated or partially unsaturated heterocyclic groups.

[0412] Polynucleotides or their analogs or derivatives

[0413] As explained herein, provided methods include modifying a polynucleotide or an analog or derivative thereof by reaction with a compound of formula (I).

[0414] The polynucleotide or its analog or derivative can be selected from any suitable natural, non-natural, functionalized and / or modified polynucleotide.Such derivatives and analogs of polynucleotides are well known in the art.

[0415] Polynucleotides and their analogs may be modified with protecting groups at any of their groups. In particular, polynucleotides typically carry protecting groups on their sugar rings, nucleobases and / or phospho bonds. Commonly used protecting groups are well known in the art.

[0416] For example, the amine groups present in the nucleobase (e.g., adenine, guanine, cytosine and derivatives and analogs thereof) can be protected by amine protecting groups known in the art, including acyl groups such as acetyl, oxygen acetyl (including phenoxyacetyl and tert-butylphenoxyacetyl), propionyl, isobutyryl, benzoyl and benzylidene. Also, guanyl groups such as dimethylguanyl and di-n-butylguanyl can be used.

[0417] Phosphate bonds can be protected by phosphate protecting groups such as ethyl or 2-cyanoethyl, and phosphite bonds can be protected by phosphite protecting groups such as ethyl or 2-cyanoethyl. For example, the phosphodiester backbone with protecting groups can be connected as phosphotriester, for example as 2-cyanoethyl phosphotriester.

[0418] The compound of formula (I) can react with a derivative of a polynucleotide comprising one or more monomers, wherein the sugar ring is a non-natural sugar (e.g., arabinose or "locked ribose") or a sugar ring analog (e.g., imino sugar, thio sugar, or carbocyclic sugar, wherein the oxygen atom normally present in the sugar ring is replaced by a nitrogen atom, a sulfur atom, or a methylene structure, respectively). "Locked ribose" is a modified ribose moiety having an additional bridge connecting the 2' oxygen and the 4' carbon. An example of a locked ribose moiety is provided below.

[0419]

[0420] Nucleic acids containing a "locked ribose" sugar ring are called "locked nucleic acids" or LNA. LNA have increased stability to enzymatic degradation and are commercially important nucleic acid analogs of RNA and DNA.

[0421] The polynucleotide or its analog or derivative modified according to the disclosed method preferably comprises a monomer unit in which the sugar ring is a ribose ring or a deoxyribose ring. Therefore, the polynucleotide or its analog or derivative is preferably a polyribonucleotide or a polydeoxyribonucleotide. Preferably, the polynucleotide or its analog or derivative is a polydeoxyribonucleotide or its derivative or analog.

[0422] The polynucleotides modified according to the disclosed method or their analogs or derivatives may comprise one or more phosphorus-based bonds between adjacent nucleoside monomer units, selected from phosphodiester bonds, phosphotriester bonds such as alkylphosphotriester bonds, phosphite triester bonds such as alkylphosphite triester bonds, phosphorothioate bonds, phosphorodithioate bonds and / or alkylphosphonate bonds such as methylphosphonate. In particular, the phosphoramidite method is a common method for polynucleotide synthesis and first produces polynucleotides in which the phosphorus-based bond is a phosphite triester bond. Such phosphite triester bonds can be oxidized to produce phosphotriester bonds, which can be deprotected to produce phosphodiester bonds.

[0423] Photolabile groups Cleavage

[0424] The photolabile group of the compound of formula (I) Can be cleaved by photolysis.

[0425] Typically, the photolabile group can be cleaved by irradiating the compound of formula (I) with ultraviolet light. Therefore, the photolabile group of the compound of formula (I) can be cleaved by irradiating the photolabile group with ultraviolet light.

[0426] Typically, the wavelength of ultraviolet light used to cleave the photolabile group is about 300 to about 500 nm, preferably about 325 to about 475 nm, more preferably about 350 to about 450 nm. For example, an ultraviolet lamp that generates ultraviolet light with a wavelength of about 365 nm can be used.

[0427] Illumination can be carried out any suitable time range according to the power of the light source used. For example, a power of about 1W to about 5000W (for example, about 2W to about 1000W, such as about 2W to about 25W) can be applied. Generally, the greater the power of the light source, the shorter the required irradiation time. For example, a light source of about 2W to about 10W (for example, about 3W to about 6W, such as about 4 or 5W) is provided and can be used to irradiate the sample in deionized water for about 0.5 hour to about 2 hours (for example, about 40 to about 60 minutes), and near quantitative cracking can be produced. Alternatively, a more powerful light source can be used to irradiate the sample for example from about 1 minute to about 30 minutes. In general, the sample can be irradiated for about 1 minute to about any suitable time of 10 hours, for example, from about 10 minutes to about 1 hour, such as about 30 minutes. This light source can provide about 15W to about 100W, for example, from about 15W to 25W. Mercury (Hg) lamp can be used to provide ultraviolet irradiation.

[0428] Thus, in some embodiments of the invention, the modified polynucleotide or analog or derivative thereof comprises a photolabile group that can be cleaved by ultraviolet irradiation at a power of about 2 W to about 25 W and a frequency of about 300 nm to about 500 nm for about 1 minute to about 2 hours.

[0429] The selection of appropriate irradiation conditions is routine for those skilled in the art. Appropriate irradiation conditions can be determined by monitoring the degree of cleavage and selecting conditions that result in a large amount or complete cleavage without damaging the synthesized polynucleotides in the shortest possible time, depending on the equipment used. The products synthesized by polynucleotides can be evaluated by techniques such as NMR and mass spectrometry (e.g., UPLC-MS) to monitor the reaction.

[0430] Purification of modified polynucleotides

[0431] As can be seen from the discussion herein, modified polynucleotides or analogs or derivatives thereof prepared according to the present disclosure using compounds of formula (I) can be more easily purified by separating the modified polynucleotides or analogs or derivatives thereof from other contaminants based on their hydrophobicity.

[0432] Thus, provided herein is a method for purifying a polynucleotide or an analog or derivative thereof, comprising:

[0433] (i) modifying a polynucleotide or an analog or derivative thereof in a reaction mixture as described herein, thereby increasing the hydrophobicity of the polynucleotide or an analog or derivative thereof; and

[0434] (ii) separating the modified polynucleotide or its analog or derivative from other components in the reaction mixture based on the hydrophobicity of the modified polynucleotide or its analog or derivative.

[0435] A preferred purification method is chromatography. Chromatography is a technique for separating components in a mixture by differential adsorption to an adsorbent surface (stationary phase). The components are then eluted with a solvent or a mixture of solvents (mobile phase).

[0436] A pure chromatographic method is gel filtration. The primary method by which gel filtration can separate components in a mixture is based on molecular size. Modification of polynucleotides or their analogs or derivatives with compounds of formula (I) will increase the size of the polynucleotides or their analogs or derivatives, resulting in modified polynucleotides or their analogs or derivatives having different migration characteristics through a gel matrix compared to unmodified contaminants such as truncated sequences. Therefore, gel filtration can be used to purify modified polynucleotides or their analogs or derivatives from contaminants.

[0437] However, high performance liquid chromatography (HPLC) is more commonly used to separate modified polynucleotides from unmodified contaminants and other components in the reaction mixture. An HPLC system typically consists of an injector, a pump for delivering solvent through the column, interchangeable HPLC columns, a column oven, a solvent mixing system, and a detector (usually UV / visible), all controlled by a personal computer.

[0438] Typically, purification of the modified polynucleotides or analogs or derivatives thereof of the present disclosure may involve reverse phase HPLC (RPHPLC). Reverse phase HPLC separates oligonucleotides and contaminants based on differences in hydrophobicity. Typically, in RPHPLC, a mixture containing the desired modified polynucleotides or analogs or derivatives thereof and other components (e.g., unmodified truncated sequences and other impurities) is applied to a column. The column typically comprises a porous silica support having pores of about to about For example, about to about For example, about to about For example, about The carrier is usually modified with hydrocarbon groups, such as C 1-30 Alkyl, alkenyl and / or alkynyl chains, such as C 5-20 Alkyl, alkenyl and / or alkynyl chains. C8 and C 18 Alkyl, alkenyl and / or alkynyl chains. This support is often called a stationary phase.

[0439] The modified polynucleotide or its analog or derivative can be eluted with a hydrophilic (usually aqueous) mobile phase. Generally, ammonium acetate (e.g., tetraethylammonium acetate, TEAA) can be used. The aqueous phase forces the modified oligonucleotide to interact strongly with the reversed-phase column. Further elution with an acetonitrile gradient dissolved in an aqueous ammonium acetate solution causes the individual components in the mixture to enter a mobile phase that increases hydrophobicity as the acetonitrile percentage increases. The larger hydrophobic molecule elutes more slowly, which causes the component separation in the mixture.

[0440] The user can control the operating temperature to optimize the purification effect achieved according to the characteristics and structure of the polynucleotide or its analogs or derivatives. For example, secondary structures (such as hairpin loops) can cause oligonucleotides to elute into broad peaks or even a series of peaks. In some embodiments, the HPLC column can be heated (e.g., at about 30 to about 100° C., such as about 40 to about 80° C., such as about 50 to about 70° C., such as about 60° C.) for a period of 1 minute to about 1 hour to overcome this problem.

[0441] The user can adjust the operating pH and salt concentration. For example, a pH of about pH 4 to about pH 10, such as about pH 6 to about pH 8, such as about pH 7 can be used. A salt concentration of about 0.01M to about 1M, such as about 0.05M to about 0.5M, such as about 0.1M salt (e.g., about 0.01M to about 1M, such as about 0.05M to about 0.5M, such as about 0.1M TEAA) can be used.

[0442] Other purification techniques that can be used to separate the modified polynucleotides of the present disclosure or analogs or derivatives thereof from other components in the reaction mixture include anion exchange HPLC, fluorine affinity chromatography, and polyacrylamide gel electrophoresis (PAGE).

[0443] The selection of appropriate purification or separation techniques is routine for those skilled in the art. Suitable conditions can be determined by monitoring the purification profile and selecting conditions that result in a large amount or complete purification without damaging the synthesized polynucleotides in the shortest possible time, depending on the equipment used. The products synthesized by the polynucleotides can be evaluated by techniques such as NMR and mass spectrometry (e.g., UPLC-MS) to monitor the reaction.

[0444] Optionally, the purification method further comprises removing the hydrophobic group from the modified polynucleotide or its analog or derivative after purification.

[0445] Thus, provided herein is a method for purifying a polynucleotide or an analog or derivative thereof, comprising:

[0446] (i) modifying a polynucleotide or an analog or derivative thereof in a reaction mixture as described herein, thereby increasing the hydrophobicity of the polynucleotide or an analog or derivative thereof;

[0447] (ii) separating the modified polynucleotide or its analog or derivative from other components in the reaction mixture based on the hydrophobicity of the modified polynucleotide or its analog or derivative;

[0448] as well as

[0449] (iii) optionally removing the hydrophobic group from the modified polynucleotide or its analog or derivative by irradiating the modified polynucleotide, its analog or derivative with light (preferably by irradiating the modified polynucleotide, its analog or derivative with ultraviolet light having a wavelength of about 300 to about 500 nm).

[0450] Method for preparing polynucleotides or analogs or derivatives thereof

[0451] Also provided is a first variant of a method of preparing a polynucleotide or an analog or derivative thereof comprising:

[0452] (i) providing a polynucleotide or a derivative or analog thereof to be linked to a vector;

[0453] (ii) optionally by introducing one or more additional nucleoside units, nucleotide units and / or

[0454] or its analogs or derivatives to increase the chain length of the nucleoside, nucleotide, polynucleotide or its derivatives or analogs to which the carrier is attached;

[0455] (x) modifying a polynucleotide or an analog or derivative thereof by reacting a reactive functional group of the polynucleotide or an analog or derivative thereof with a compound of formula (I) as described herein;

[0456] (iii) cleaving the polynucleotide or its analog or derivative from the solid support;

[0457] (iv) purifying the modified polynucleotide or its analog or derivative; and

[0458] (v) optionally cleaving a photolabile group of the compound of formula (I) by irradiating the modified polynucleotide, analog or derivative thereof with light.

[0459] A second variant of the method is also provided, which is a method for preparing a polynucleotide or an analog or derivative thereof, comprising:

[0460] (i) providing a polynucleotide or a derivative or analog thereof to be linked to a vector;

[0461] (ii) optionally by introducing one or more additional nucleoside units, nucleotide units and / or

[0462] or its analogs or derivatives to increase the chain length of the nucleoside, nucleotide, polynucleotide or its derivatives or analogs to which the carrier is attached;

[0463] (iii) cleaving the polynucleotide or its analog or derivative from the solid support;

[0464] (x) modifying a polynucleotide or an analog or derivative thereof by reacting a reactive functional group of the polynucleotide or an analog or derivative thereof with a compound of formula (I) as described herein;

[0465] (iv) purifying the modified polynucleotide or its analog or derivative; and

[0466] (v) optionally cleaving a photolabile group of the compound of formula (I) by irradiating the modified polynucleotide, analog or derivative thereof with light.

[0467] Step (i) of these methods may comprise providing a pre-prepared support-attached polynucleotide or an analog or derivative thereof. Alternatively, step (i) may comprise attaching the polynucleotide or an analog or derivative thereof to a solid support.

[0468] Any suitable solid support can be used. Preferably, the solid support comprises glass, silica, ceramic or polymeric resin. More preferably, the solid support comprises controlled pore glass (CPG) or polystyrene. CPG can be introduced into one or more functional groups by suitable surface treatment. Suitable surface treatments include silanes, such as (3-aminopropyl) triethoxysilane to produce aminopropyl CPG. Such functionalized CPG can be derivatized by reacting the amino portion of the aminopropyl group with a suitable portion such as an ester group. Suitable polystyrene materials are generally low swelling and / or cross-linked. For example, polystyrene can be obtained by polymerization of divinylbenzene, styrene and 4-chloromethylstyrene in the presence of a porogen. The resulting macroporous chloromethyl MPPS can be converted into aminomethyl MPPS. Typically, the solid support is not functionalized with proteins such as streptavidin.

[0469] Preferably, the solid support comprises particles having a diameter of about 1 μm to about 10000 μm, more preferably about 5 μm to about 1000 μm, further preferably about 10 μm to about 500 μm, for example about 50 μm to about 250 μm. Preferably, the solid support material particles are porous. Preferably, when the solid support material is porous, the pore size is about 1 to about 1000 nm, for example about 10 to about 100 nm, such as about 50 nm.

[0470] Preferably, the support material is or comprises beads. Such beads may be magnetic, for example may comprise a magnetic material. The beads may be ferrimagnetic or paramagnetic. The beads may comprise an iron oxide core.

[0471] Preferably, the support material is packed in a column. The bed volume of the column may be from about 100 μL to about 100 L, such as from about 1 mL to about 1 L. Any suitable bed volume may be used depending on the intended scale of synthesis.

[0472] Step (ii) of these methods generally comprises carrying out one or more of the following steps: contacting the carrier-linked polynucleotide or analog or derivative thereof with a nucleoside or derivative thereof, thereby forming a phospho-linked bond.

[0473] The nucleoside or its derivative may be a nucleoside phosphoramidite, a nucleoside H-phosphonate or a nucleoside phosphotriester, preferably an activated nucleoside phosphoramidite, an activated nucleoside H-phosphonate or an activated nucleoside phosphotriester. The nucleoside phosphoramidite may be activated by reacting with a tetrazole or a derivative thereof as an activator; for example, the group of the phosphoramidite (e.g., the diisopropylamino group of the phosphoramidite) may be protonated by an acidic tetrazole or a derivative thereof. The nucleoside H-phosphonate may be activated by reacting with a chlorinating agent such as pivaloyl chloride. The nucleoside phosphotriester may be activated by reacting with a coupling agent such as 1-(mesitylenesulfonyl)-3-nitro-1H-1,2,4-triazole.

[0474] Preferably, in step (ii), the nucleoside or its derivative is an activated nucleoside phosphoramidite. Preferably, the activated nucleoside phosphoramidite has an activated phosphoramidite group at the 3′ position or the 5′ position. More preferably, the activated nucleoside phosphoramidite has an activated phosphoramidite group at the 3′ position. Typically, the activated nucleoside phosphoramidite having an activated phosphoramidite group at the 3′ position has a hydroxyl protecting group at the 5′ position. Typically, the activated phosphoramidite group is represented by the formula (PH-A):

[0475]

[0476] Where R pp is hydrogen, a lone pair of electrons generating a negative charge, o-chlorophenyl, p-chlorophenyl, methyl or 2-cyanoethyl; preferably 2-cyanoethyl; and

[0477] The phosphorus-based bond can be a phosphodiester bond, a phosphotriester bond such as an alkylphosphotriester bond, a phosphite triester bond such as an alkylphosphite triester bond, a phosphorothioate bond, a phosphorodithioate bond or an alkylphosphonate bond such as a methylphosphonate bond. Preferably, the phosphorus-based bond is a phosphite triester bond. More preferably, the phosphorus-based bond is a 2-cyanoethylphosphite triester bond.

[0478] Preferably, step (ii) comprises performing one or more of the following steps: providing a nucleoside phosphoramidite; activating the nucleoside phosphoramidite; and contacting the carrier-linked nucleoside, nucleotide, polynucleotide, or derivative or analog thereof with the activated nucleoside phosphoramidite to form a phosphite triester bond.

[0479] The nucleoside phosphoramidite preferably has a phosphoramidite group at the 3′ position or the 5′ position. More preferably, the nucleoside phosphoramidite has a phosphoramidite group at the 3′ position. Preferably, the nucleoside phosphoramidite having a phosphoramidite group at the 3′ position has a hydroxyl protecting group at the 5′ position. Preferably, the phosphoramidite group is represented by formula (PH):

[0480]

[0481] Where R pp is hydrogen, a lone pair of electrons generating a negative charge, o-chlorophenyl, p-chlorophenyl, methyl or 2-cyanoethyl; preferably 2-cyanoethyl; and each R a H or C 1-3 alkyl.

[0482] Step (ii) may optionally further comprise oxidizing the phosphite triester bonds to form phosphotriester bonds.

[0483] Step (ii) may optionally further comprise the removal of a hydroxy protecting group.

[0484] More preferably, step (ii) comprises performing one or more of the following steps (a) to (e):

[0485] (a) providing a nucleoside having: (i) a phosphoramidite group at the 3′ position and a hydroxyl protecting group at the 5′ position;

[0486] (b) activating the nucleoside phosphoramidite of step (a);

[0487] (c) contacting the carrier-linked polynucleotide or an analog or derivative thereof with an activated nucleoside phosphoramidite to form a phosphite triester bond;

[0488] (d) oxidizing a phosphite triester bond to form a phosphotriester bond; and

[0489] (e) removing the hydroxy protecting group from the terminal nucleoside of the resulting vector-linked polynucleotide.

[0490] Step (b) typically comprises contacting the nucleoside phosphoramidite with a suitable activator. Any suitable activator may be used. Typically the activator is tetrazole or a derivative thereof. Typically the activator is contacted with the nucleoside phosphoramidite in an organic solvent such as acetonitrile.

[0491] Step (c) may be performed by passing the activated nucleoside phosphoramidite of step (b) through a column containing a carrier-linked nucleoside, nucleotide, polynucleotide, or a derivative or analog thereof.

[0492] Step (d) typically comprises oxidizing the triester phosphite with a suitable oxidant. Any suitable oxidant may be used. Typically the oxidant is iodine. Iodine may be used in a reaction with a suitable solvent such as water and pyridine (e.g., at a concentration of about 0.01 to 0.02 M iodine in water / pyridine / THF 2 / 20 / 78).

[0493] Step (e) can be carried out by contacting the polynucleotide linked to the carrier obtained in step (d) with a suitable reagent. Typically, deprotection comprises contacting the polynucleotide linked to the carrier with a concentrated aqueous base solution such as aqueous ammonia. The aqueous solution can be removed by evaporation.

[0494] Step (ii) can comprise repeating the reaction steps at least 1 time, at least 2 times, at least 5 times, at least 10 times, at least 20 times, at least 30 times, at least 40 times, at least 50 times, at least 100 times, at least 150 times, at least 200 times, at least 500 times, at least 1000 times, or more times. Therefore, step (ii) can comprise forming a length of at least 2, at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 100, at least 150, at least 200, at least 500, at least 1000 monomeric units or more polynucleotide. It will be appreciated by those skilled in the art that the nucleoside or its derivatives thereof that are connected to the nucleoside connected by the carrier provided in step (i) in each repetition can be identical or different. Therefore, the sequence of the polynucleotide synthesized in the method can depend on the user of the method, for example, the operator of the equipment configured for the synthesis of polynucleotides.

[0495] Step (x) comprises reacting the polynucleotide or its analogue or derivative with a compound of formula (I) while attached to the support or after cleavage from the support (see below) to modify the polynucleotide or its analogue or derivative. The reaction of the polynucleotide or its analogue or derivative with the compound of formula (I) is generally carried out as described or substantially as described in step (ii) above.

[0496] Preferably, the disclosed method comprises one or more steps of deprotecting a polynucleotide or its analog or derivative. Preferably, deprotecting a polynucleotide or its analog or derivative comprises removing a protecting group from one or more nucleobases and / or one or more phospho bonds present in a polynucleotide attached to a carrier. Deprotection can be achieved by treating the polynucleotide or its analog or derivative with a suitable reagent according to the protecting group used. For example, benzoyl, isobutyryl and dimethylformamidyl protecting groups commonly used to protect nucleobases can be removed with concentrated ammonium hydroxide. UltraMild protecting groups commonly used to protect nucleobases such as phenoxyacetyl, acetyl and isopropylphenoxyacetyl can be removed with a mixture of potassium carbonate methanol solution or ammonia and methylamine aqueous solution. Cyanoethyl phosphotriester groups can be used to protect the phosphodiester backbone and can be removed with concentrated ammonium hydroxide. Phosphate groups can be protected as methyl triesters and removed with thiophenol.

[0497] In step (iii) the polynucleotide or its analogue or derivative is cleaved from the solid support. The polynucleotide or its analogue or derivative is usually attached to the solid support using a succinyl linker which can be easily cleaved by treatment with concentrated ammonium hydroxide at room temperature for one hour.

[0498] In step (iv), the modified polynucleotide or its analog or derivative is purified. The modified polynucleotide or its analog or derivative is usually purified by separation from other components in the reaction mixture (e.g., truncated polynucleotides, unreacted monomers, and removed protecting groups). The modified polynucleotide or its analog or derivative is usually separated from these groups according to the hydrophobicity of the modified polynucleotide or its analog or derivative. The modified polynucleotide or its analog or derivative is usually separated from other components in the reaction mixture by chromatography (e.g., by high performance liquid chromatography (HPLC)). The modified polynucleotide or its analog or derivative can be purified by reverse phase (RP) HPLC as described in more detail herein.

[0499] In optional step (v), the modified polynucleotide or analog or derivative thereof is photolyzed to cleave the hydrophobic modification R from the purified polynucleotide or analog or derivative thereof. H Photolytic cleavage generally involves irradiating the modified polynucleotide or its analogue or derivative with light. Thus, photolytic cleavage generally involves irradiating a photolabile group of a compound of formula (I). The modified polynucleotide or its analogue or derivative is generally irradiated with ultraviolet light as described herein.

[0500] The methods disclosed herein can be implemented under any suitable temperature and conventional solvent conditions readily available to those skilled in the art. Typically, the reaction is carried out at about 10°C to about 100°C (e.g., about 20°C to about 50°C, e.g., about 25°C to about 30°C). Typically the reaction can be carried out at room temperature.

[0501] Products of the disclosed method

[0502] The disclosed methods can be used to prepare modified polynucleotides or analogs or derivatives thereof. Therefore, the present invention also provides polynucleotides or derivatives or analogs thereof obtainable or obtained by the methods provided herein.

[0503] The term "polynucleotide" when referring to a polynucleotide that is or has been modified according to the present disclosure, refers to a single or double-stranded covalently linked sequence of nucleotides, depending on the context, in which the 3' and 5' ends of each nucleotide are linked by a phosphorus-based bond. The phosphorus-based bond present in the product of the disclosed method may be a phosphodiester bond (as in a natural polynucleotide) or may be a non-natural phosphorus-based bond, for example: a phosphotriester bond, for example an alkylphosphotriester bond, such as a methylphosphotriester bond and an ethylphosphotriester bond; a phosphorothioate bond; a phosphorodithioate bond; and an alkylphosphonate bond, for example a methylphosphonate bond.

[0504] Polynucleotides may be composed of deoxyribonucleotide bases or ribonucleotide bases. Nucleic acids may also include modified DNA or RNA (e.g., DNA or RNA that has been methylated) or RNA that has been post-translationally modified (e.g., 5′-capping with 7-methylguanosine, 3′-processing such as cleavage and polyadenylation, and splicing). Nucleic acids may also include synthetic nucleic acids (XNA), such as hexitol nucleic acids (HNA), cyclohexene nucleic acids (CeNA), threose nucleic acids (TNA), glycerol nucleic acids (GNA), locked nucleic acids (LNA), and peptide nucleic acids (PNA). The size of nucleic acids (also referred to herein as "polynucleotides") is usually expressed as the number of base pairs (bp) for double-stranded polynucleotides, or the number of nucleotides (nt) in the case of single-stranded polynucleotides. One thousand bp or nt is equal to one kilobase (kb). Polynucleotides less than about 40 nucleotides in length are usually referred to as "oligonucleotides" and may include primers for DNA manipulations (e.g., by polymerase chain reaction (PCR)).

[0505] A polynucleotide may comprise any combination of any nucleotides. Nucleotides may be naturally occurring or artificial. One or more nucleotides in a polynucleotide may be oxidized or methylated. One or more nucleotides in a polynucleotide may be damaged. For example, a polynucleotide may contain a pyrimidine dimer. Such dimers are often associated with UV damage and are the main cause of skin melanoma. One or more nucleotides in a polynucleotide may be modified with, for example, a label or tag, suitable examples of which are known to the skilled person. A polynucleotide may contain one or more spacers. Nucleotides often contain a nucleobase, a sugar, and at least one phosphate group, as described in more detail herein. The nucleobase and the sugar form a nucleoside. Nucleobases are often heterocyclic. Nucleobases include, but are not limited to, purines and pyrimidines and more specifically adenine (A), guanine (G), thymine (T), uracil (U), and cytosine (C). Sugars are often pentoses. The sugars of nucleotides include, but are not limited to, ribose and deoxyribose. The sugar is preferably deoxyribose. Polynucleotides preferably contain the following nucleosides: deoxyadenosine (dA), deoxyuridine (dU) and / or thymidine (dT), deoxyguanosine (dG) and deoxycytidine (dC). Nucleotides are typically ribonucleotides or deoxyribonucleotides. Nucleotides typically contain monophosphates, diphosphates or triphosphates. Nucleotides may contain more than 3 phosphates, such as 4 or 5 phosphates. The phosphates may be attached to the 5' or 3' side of the nucleotide. The nucleotides in a polynucleotide may be linked to each other in any manner. Nucleotides are typically linked by their sugar and phosphate groups, as in nucleic acids. Nucleotides may be linked by their nucleobases, as in pyrimidine dimers.

[0506] The nucleotides contained in the polynucleotide may include, but are not limited to, adenosine monophosphate (AMP), guanosine monophosphate (GMP), thymidine monophosphate (TMP), uridine monophosphate (UMP), 5-methylcytidine monophosphate, 5-hydroxymethylcytidine monophosphate, cytidine monophosphate (CMP), cyclic adenosine monophosphate (cAMP), cyclic guanosine monophosphate (cGMP), deoxyadenosine monophosphate (dAMP), deoxyguanosine monophosphate (dGMP), deoxythymidine monophosphate (dTMP), deoxyuridine monophosphate (dUMP), deoxycytidine monophosphate (dCMP) and deoxymethylcytidine monophosphate. The nucleotide is preferably selected from AMP, TMP, GMP, CMP, UMP, dAMP, dTMP, dGMP, dCMP and dUMP. The nucleotide may be abasic (i.e., lack a nucleobase). The nucleotide may also lack a nucleobase and a sugar (i.e., it may be a C3 spacer).

[0507] Typically the polynucleotide consists of or comprises DNA and / or RNA, preferably DNA.

[0508] The polynucleotide length may be at least 10, at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 400, or at least 500 nucleotides or nucleotide pairs. Thus, for example, the polynucleotide length may be from about 10 to about 1000 or more nucleotides or nucleotide pairs, such as from about 10 to about 500, such as from about 20 to about 500, such as from about 30 to about 250, such as from about 50 to about 150 nucleotides or nucleotide pairs in length.

[0509] The total number of polynucleotides

[0510] Also provide the overall of purified polynucleotides or their analogs or derivatives.This overall has improved performance compared with the overall of polynucleotides prepared by prior art.These advantages occur when polynucleotides are used for high-tech applications (including drugs (e.g., for gene therapy)) and other applications of gene synthesis.It is particularly important to try to eliminate any possibility of contamination caused by the inclusion of impurities in gene constructs (e.g., caused by truncated impurities).However, the existing method of purifying polynucleotides cannot provide the very high purity level required for these applications.This is especially true when the desired polynucleotides are modified by modifying groups such as the group R defined herein.In these cases, there are basically two options.If modified before purification, the limitations of purification technology mean that a homogeneous overall cannot be generated usually.If purified before modification, the inefficiency of the modification chemical reaction means that a homogeneous overall cannot be generated usually.

[0511] Therefore, the present disclosure provides homogeneous populations comprising a plurality of polynucleotides or analogs or derivatives thereof (e.g., comprising a plurality of modified polynucleotides or analogs or derivatives thereof). The purity of the population may be at least 90%, such as at least 91%, such as at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.9% or at least 99.99% or more.

[0512] The disclosure also provides a homogeneous population comprising numerous modified polynucleotides or their analogs or derivatives, wherein at least 90% of the monomers in the population are chemically modified by a group R as defined herein. In some embodiments at least 90% of the monomers in the population, for example at least 91%, for example at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.9% or at least 99.99% or more are modified by modifying groups. In some embodiments, 100% of the monomers in the population are modified by modifying groups. As explained above, previously known methods can not provide this homogeneous population usually because the efficiency of the modification chemical reaction does not usually reach 100%, and the modified monomers are usually difficult to separate or purify from impurities.

[0513] Applications of polynucleotides prepared by the disclosed methods

[0514] The polynucleotides modified and / or purified according to the present disclosure have a variety of potential applications. The applications are not particularly limited, and the polynucleotides provided herein and the methods disclosed herein can be used in any application requiring polynucleotides.

[0515] In some embodiments, the methods provided herein can provide polynucleotides with very high purity. Therefore, the polynucleotides provided herein are particularly useful in applications requiring high purity. Preferably, the purity of the polynucleotides obtained in the disclosed methods is at least 99%, for example at least 99.9%, such as at least 99.99%, more preferably at least 99.999% or higher.

[0516] One application of the polynucleotides provided herein is in PCR (polymerase chain reaction). Methods for performing PCR are well known to those skilled in the art. For example, in one embodiment, performing PCR includes contacting a primer complementary to the target polynucleotide with the target polynucleotide under conditions that allow a polymerase to catalyze chain extension to amplify the target polynucleotide. The polynucleotides provided herein are particularly useful as primers for PCR because of their high purity.

[0517] Another application of the polynucleotides provided herein is in the preparation of therapeutic polynucleotides. Therapeutic polynucleotides are being investigated for use in the treatment of a variety of different pathological conditions, and have particular applications as anticancer agents and as antiviral agents.

[0518] Other applications of the polynucleotides provided herein include in next generation sequencing technologies. For example, the polynucleotides provided herein can be used as barcodes in single cell sequencing technologies such as Drop-seq sequencing.

[0519] In the Drop-seq technique, a microfluidic device is used to generate an emulsion of water droplets in oil, wherein each droplet contains at most a single biological cell (e.g., a mammalian (e.g., human) cell or a bacterial cell) and a barcoded solid support, such as a barcoded bead, to which is attached a polynucleotide sequence defining a polynucleotide "barcode." The polynucleotides provided herein can be used in this manner.

[0520] More specifically, the vector-linked polynucleotides used for Drop-seq sequencing typically contain molecular tags for identifying cellular target polynucleotides, polynucleotide "barcodes", and universal sequences. The vector-linked polynucleotides typically contain a 3'-poly T end, that is, there are several (e.g., about 5 to about 50, such as about 10 to about 40, such as about 30) consecutive nucleotide units with thymine as its nucleobase at the 3' end of the polynucleotide. The molecular tag may contain about 5 to about 15 nucleotides. The barcode may contain about 4 to about 50, such as about 5 to about 30, such as about 6 to about 20, such as about 8 to about 15 monomer units. The universal sequence can be any desired length.

[0521] Cells typically contain mRNA with a 5′-poly A region—that is, several consecutive nucleotides with adenine as their nucleobase at the 5′ end of the mRNA. Typically in Drop-seq technology, cells are lysed and their mRNA is released into their respective droplets. The 5′-poly A region of the mRNA chain hybridizes with the 3′-poly T end of the polynucleotide attached to the carrier, thereby capturing the mRNA chain from a single cell onto a single solid phase carrier. The resulting carrier-attached polynucleotide-mRNA assembly is often referred to as "STAMPs"—a single-cell transcriptome attached to a microparticle. The emulsion can then be broken to release STAMPS, which can be used to construct a transcriptome library. STAMPS can be recognized by the barcode on the solid phase carrier, and then the sequence of the mRNA chain can be determined by reverse transcription, PCR, and sequencing.

[0522] A carrier-attached polynucleotide with a 3′-poly T end for conventional Drop-seq technology can be synthesized directly on a solid support, for example, in a 3′ to 5′ direction, using solid phase polynucleotide synthesis, and the chemical properties of the 5′ end can be changed by modifications herein. Alternatively, the synthesized polynucleotides described herein can be coupled to a solid support for use in the Drop-seq sequencing method. Alternatively, in order to produce a free 3′ end that can be used for hybridization with an mRNA chain, a polynucleotide can be synthesized in a 5′ to 3′ direction. The chemical properties of the 3′ end can be changed by modifications herein. Alternatively, the synthesized polynucleotides described herein can be coupled to a solid support for use in the Drop-seq sequencing method. Subsequent reverse transcription and PCR steps can then be performed “in the droplet” to sequence the mRNA chain present in each individual droplet.

[0523] Therefore, provided herein is a method for sequencing a polynucleotide expressed by a cell. The method includes providing a polynucleotide connected to a vector, wherein the polynucleotide is modified as described herein; contacting the polynucleotide connected to the vector with the target polynucleotide under conditions that allow the polynucleotide connected to the vector to hybridize with the target polynucleotide; enzymatically synthesizing a complementary polynucleotide chain complementary to the target polynucleotide; and sequencing the synthesized complementary polynucleotide chain or a polynucleotide chain complementary thereto, thereby determining the sequence of the target polynucleotide.

[0524] Other aspects of the invention

[0525] As discussed in more detail herein, the present invention provides methods comprising the use of compounds of formula (I). The present invention also provides compounds of formula (I) per se.

[0526] Thus, provided herein are compounds of formula (I):

[0527]

[0528] Where R H , L 1 , R, n, and R P As defined herein.

[0529] It can be seen that the compounds can be used in the methods provided herein.

[0530] Also provided are modified polynucleotides or derivatives or analogs thereof comprising a group of formula (I*):

[0531]

[0532] Where R H , L 1 , R and n are as defined herein, and wherein:

[0533] -R P * is a phosphorus-based bond; and

[0534] - The wavy line indicates the point of attachment to the polynucleotide or its derivative or analogue.

[0535] Usually, R P * is a phosphodiester bond, a phosphotriester bond, a phosphite triester bond, a phosphite diester bond, a phosphorothioate bond, a phosphorodithioate bond, an alkylphosphonate bond, or an alkylphosphite bond. More typically, R P * is a phosphite triester bond or an alkylphosphite bond or a phosphodiester bond or an alkylphosphonate bond. More typically, R P * is a phosphite triester bond or an alkylphosphonite bond. Still more typically, R P* is a phosphite triester bond or a methylphosphonite bond.

[0536] Typically, the group of formula (I*) is attached to the 3' position or 5' position of a polynucleotide or an analog or derivative thereof, resulting in the polynucleotide or an analog or derivative thereof being modified by the group. Most typically, the group of formula (I*) is attached to the 5' position of a polynucleotide or an analog or derivative thereof. Typically, the group of formula (I*) is attached to the 5' position of a polynucleotide or an analog or derivative thereof via a bond to an oxygen atom.

[0537] Also provided herein is the use of a compound of formula (I) for modifying a polynucleotide or a derivative or analog thereof,

[0538]

[0539] Where R H , L 1 , R, n, and R P As defined herein. Typically, the use is to increase the hydrophobicity of a polynucleotide or a derivative or analogue thereof.

[0540] Also provided is the use of a compound of formula (I) as defined herein for purifying a polynucleotide or a derivative or analog thereof. Typically the use is for purifying a polynucleotide or a derivative or analog thereof by a hydrophobic chromatography based on the modified polynucleotide or its analog or derivative (e.g. by HPLC, such as by RPHPLC as described in more detail herein).

[0541] Other embodiments of the present invention

[0542] Also provided is an apparatus for performing polynucleotide synthesis, the apparatus comprising:

[0543] - a solid support attached to a polynucleotide; wherein the polynucleotide is modified with a compound of formula (I) as defined herein; and

[0544] - a light source for irradiating the solid support so as to cleave the photolabile groups of the compound of formula (I).

[0545] Preferably, the solid support, light source and photocleavable linker are as defined herein.

[0546] A system is also provided, comprising:

[0547] - a solid support linked to a polynucleotide having a reactive functional group for reacting with a compound of formula (I);

[0548] - a compound of formula (I) for reacting with a polynucleotide; and

[0549] - a light source for irradiating the solid support so as to cleave the photolabile groups of the compound of formula (I).

[0550] Preferably, the solid support, light source and photocleavable linker are as defined herein.

[0551] method

[0552] The compounds of the present invention can be prepared by any suitable method. Detailed conventional synthetic routes of representative compounds of the present invention are described below and in the examples. Those skilled in the art will be able to easily adapt the detailed synthetic methods provided herein to prepare other compounds disclosed herein. However, in general, the compounds provided herein can generally be prepared by reactions according to one of the following schemes:

[0553] Exemplary compounds of formula (I) as compounds of formula (II-3) can generally be prepared according to the following reaction scheme:

[0554]

[0555] The starting material SM is easily available. A: SM is reacted with, for example, L 1 -R H (For example, compounds such as 1-octyne can be used to provide 1 is a C2 alkynylene group and R H In step B, the ethylene glycol derivative produces a cyclic adduct, and in step C, a hydride such as sodium borohydride is provided to produce a decyclized compound. The terminal hydroxyl group and R P The phosphorus center in (eg bis(diisopropylamino)(methyl)phosphine) reacts to produce the final compound.

[0556] Exemplary compounds of formula (I) as compounds of formula (II-1) can generally be prepared according to the following reaction scheme:

[0557]

[0558] SOCl2 activates carboxylic acids to react with, for example, R 3 The alkyl groups on the (A) groups are then functionalized using, for example, NBS. Other functionalization chemistries are readily accomplished. B: Reduction of carboxylic acids to produce alcohols can be accomplished using, for example, NaBH4. C: Bromine is converted to an alkyl group for conversion to L by, for example, using NaN3. 1 -R H The reaction of the azide (e.g., by conventional affinity substitution reaction) can be achieved with L 1 -R H In step D, the terminal hydroxyl group and R P The phosphorus center in (eg 2-cyanoethoxy-N,N-diisopropylaminophosphine chloride) reacts to produce the final compound.

[0559] Exemplary compounds of formula (I) as compounds of formula (II-2) can generally be prepared according to the following reaction scheme:

[0560]

[0561] SOCl2 activates carboxylic acids to react with, for example, R 3 The alkyl groups on the (A) groups are then functionalized using, for example, NBS. Other functionalization chemistries are readily accomplished. B: Reduction of carboxylic acids to produce alcohols (when Q is O) can be accomplished using, for example, NaBH4. Alcohols can be converted to other functional groups using standard transformations when Q is not O. C: Bromine can be converted to the alkyl groups used for conversion to L by, for example, using NaN3 1 -R H The reaction of the azide (e.g., by conventional affinity substitution reaction) can be achieved with L 1 -R H or precursor. In step D, with sulfur-containing CR 2 2 derivatives place reactive groups for (E): reaction with R derivatives such as HO-R-OH moieties. F: terminal hydroxyl and R P The phosphorus center in (eg 2-cyanoethoxy-N,N-diisopropylaminophosphine chloride) reacts to produce the final compound.

[0562] Detailed synthetic routes of exemplary compounds of the present invention are described below.

[0563] It should be understood that although specific embodiments, specific configurations, and materials and / or molecules of the inventive method are discussed herein, various changes or modifications may be made in form and detail without departing from the scope and spirit of the invention. The following examples are provided to better illustrate specific embodiments and should not be considered as limitations of the present application. The present application is limited only by the claims.

[0564] Example

[0565] Experimental procedures

[0566] All reagents were purchased from Sigma-Aldrich, Alfa Aesar, Fisher Scientific, Fluorochem, Carbosynth, TCI, or Link Technologies and used without additional purification. Anhydrous pyridine, triethylamine, diisopropylethylamine, and dichloromethane were freshly distilled from calcium hydride. All air / moisture sensitive reactions were performed in oven-dried glassware under argon. Merck silica gel 60 F 254The reaction was monitored by thin layer chromatography on an aluminum plate. The compounds were visualized by UV irradiation at 254 / 260 nm and staining with appropriate solutions (p-anisaldehyde, potassium permanganate, ninhydrin, Mary's reagent). Flash chromatography was performed on a Duo cartridge or manually using Merck silica gel 60 (40-63 μm). NMR spectra were measured using a Bruker AVII400 FT-NMR spectrometer or a Bruker AVIIIHD400 FT-NMR spectrometer. Chemical shifts are given in ppm and are corrected using the appropriate solvent signal as an internal reference. Coupling constants (J) are given in Hertz (Hz) and are calculated by COSY, 13 C, HMBC, DEPT experiments assisted attribution. Chemical names were generated using ChemDraw (PerkinElmer).

[0567] Example 1: Synthesis of 5'-PC PO3

[0568] This example describes the synthesis of a compound of formula (I) as a compound of formula (II-1).

[0569] 1-(5-Methyl-2-nitrophenyl)ethan-1-one

[0570]

[0571] To a solution of 5-methyl-2-nitrobenzoic acid (5 g, 27.6 mmol) in anhydrous toluene (30 mL) was added thionyl chloride (6 mL, 82.8 mmol), and the mixture was refluxed at 80° C. under argon for 3 hours. The mixture was concentrated to give 5-methyl-2-nitrobenzoyl chloride (5.5 g) as a yellow oil, which was carried on to the next step without additional purification.

[0572] To a suspension of anhydrous magnesium chloride (2.36 g, 24.8 mmol) and diethyl malonate (5 mL, 33 mmol) in anhydrous ethyl acetate (80 mL) at 0°C was slowly added anhydrous triethylamine (16 mL). After stirring for 45 minutes, a solution of 5-methyl-2-nitrobenzoyl chloride (5.5 g) in anhydrous ethyl acetate (10 mL) was added. The mixture was then heated to 60°C and stirred for 30 minutes. Upon completion, the reaction mixture was extracted with ethyl acetate, washed with dilute hydrochloric acid (1 M), water, dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. A solution of glacial acetic acid (30 mL) and concentrated sulfuric acid (6 mL) was added and the mixture was refluxed for 12 hours. The reaction mixture was cooled in an ice bath and basified with sodium hydroxide, the product was extracted with dichloromethane and purified by flash chromatography (0-50% ethyl acetate in hexanes) to give the title compound (3.79 g, 21.2 mmol, 77%).

[0573] 1 H NMR (400MHz, CDCl3) δppm 8.03 (d, 1H, J = 8.4Hz, C H Ar),7.38(m,1H,C H Ar),7.18(m,1H,C H Ar),2.54(s,1H,C H 3CO),2.48(s,1H,C H 3).

[0574] 1-(5-(Bromomethyl)-2-nitrophenyl)ethan-1-one

[0575]

[0576] To a solution of 1-(5-methyl-2-nitrophenyl)ethan-1-one (3.79 g, 21.2 mmol) in anhydrous acetonitrile (25 mL) were added N-bromosuccinimide (4.14 g, 23.3 mmol) and 1,1′-azobis(cyclohexanecarbonitrile) (0.52 g, 2.12 mmol), and the mixture was refluxed for 12 hours. After cooling to room temperature, the solvent was removed, and the residue was dissolved in toluene (25 mL) and filtered. The filtrate was concentrated and purified by flash chromatography (0-50% ethyl acetate in hexanes) to give the target compound (3.74 g, 14.5 mmol, 68%).

[0577] 1 H NMR (400MHz, CDCl3) δppm 8.09 (d, 1H, J = 8.4Hz, C H Ar),7.62(dd,1H,J=8.5,2.0Hz,C H Ar), 7.43(d,1H,J=2.0Hz,C H Ar),4.50(s,2H,C H 2Br),2.57(s,1H,C H 3CO).

[0578] 1-(5-(Bromomethyl)-2-nitrophenyl)ethan-1-ol

[0579]

[0580] 1-(5-(Bromomethyl)-2-nitrophenyl)ethan-1-one (3.74 g, 14.5 mmol) was dissolved in a mixture of anhydrous methanol (38 mL) and anhydrous dioxane (25 mL), then sodium borohydride (0.822 g, 21.7 mmol) was slowly added at 0°C and allowed to warm to room temperature over 12 hours. Water (60 mL) and 1M hydrochloric acid (15 mL) were added and the suspension was extracted with ethyl acetate, dried over anhydrous sodium sulfate, filtered and concentrated, and purified by flash chromatography (0-50% ethyl acetate in hexanes) to give the title compound (3.38 g, 13.0 mmol, 90%).

[0581] 1 H NMR (400MHz, CDCl3) δppm 7.91 (d, 1H, J = 8.4Hz, C H Ar), 7.87 ppm (d, 1H, J = 2.0 Hz, C H Ar),7.45(m,1H,C H Ar), 5.46(q,1H,J=6.4Hz,CH3C H ),4.51(s,1H,C H 2Br),2.27(br.s,1H,O H ),1.58(d,3H,J=6.4Hz,C H 3CH).

[0582] 1-(5-(Azidomethyl)-2-nitrophenyl)ethan-1-ol

[0583]

[0584] To a solution of 1-(5-(bromomethyl)-2-nitrophenyl)ethan-1-ol (2.49 g, 9.57 mmol) in anhydrous dimethylformamide (30 mL) was added sodium azide (0.93 g, 14.4 mmol) and the mixture was stirred at room temperature for 3 hours. The concentrated mixture was extracted with water from ethyl acetate, dried over anhydrous sodium sulfate, filtered and concentrated, and purified by flash chromatography (0-50% ethyl acetate in hexanes) to give the title compound (1.95 g, 8.77 mmol, 92%).

[0585] 1 H NMR (400MHz, CDCl3) δppm 7.95 (d, 1H, J = 8.4Hz, C H Ar), 7.81(d,1H,J=2.0Hz,C H Ar),7.39(dd,1H,J=8.4,2.0Hz,C HAr), 5.48 (q, 1H, J = 6.4 Hz, CH3C H ),4.49(s,2H,C H 2N3),2.17(br.s,1H,O H ),1.59(d,3H,J=6.4Hz,C H 3CH).

[0586] 1-(5-(4-(Hexyl)-1H-1,2,3-triazol-1-ylmethyl)-2-nitrophenyl)ethan-1-ol

[0587]

[0588] 1-(5-(Azidomethyl)-2-nitrophenyl)ethan-1-ol (0.95 g, 4.3 mmol) and 1-octyne (0.96 mL, 6.5 mmol) were added to a 3:1:1 mixture of tetrahydrofuran / tert-butyl alcohol / water (54 mL / 18 mL / 18 mL). 7.5% aqueous copper(II) sulfate (8.8 mL) and 1M aqueous (+)-L-sodium ascorbate (9.7 mL) were added and the reaction was stirred at room temperature for 2 hours. The mixture was diluted with ethyl acetate and the organic phase was washed with saturated sodium bicarbonate and brine (10% diluted with water), dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by flash chromatography (0-100% ethyl acetate in hexanes) to give the title compound (1 g, 3 mmol, 70%).

[0589] 1 H NMR (400MHz, CDCl3) δppm 7.9 (d, 1H, J = 8.3Hz, C H Ar), 7.78(d,1H,J=2.0Hz,C H Ar),7.29(br s,1H,C H triazole), 7.2 (dd, 1H, J = 8.3 Hz, 2.0 Hz, C H Ar),5.59(s,2H,C H 2N),5.46(q,1H,J=6.4Hz,C H CH3), 2.7(t, 2H, J = 7.7 Hz, triazole C H 2CH2),1.71-1.62(m,2H,triazoleCH2C H 2),1.56(d,3H,J=6.4Hz,CHC H 3),1.40-1.25(m,6H,C H 2C H 2C H2CH3),0.91-0.84(m,3H,CH2CH2CH2C H 3).

[0590] 2-Cyanoethyl(1-(5-((4-hexyl-1H-1,2,3-triazol-1-yl)methyl)-2-nitrophenyl)ethyl)diisopropylphosphoramidite

[0591]

[0592] A solution of 1-(5-(4-(hexyl)-1H-1,2,3-triazol-1-ylmethyl)-2-nitrophenyl)ethan-1-ol (0.43 g, 1.3 mmol) in anhydrous dichloromethane (10 mL) was degassed under argon for 5 minutes, and then anhydrous diisopropylethylamine (0.68 mL, 3.9 mmol) was added. 2-Cyanoethoxy-N,N-diisopropylaminophosphine chloride (0.35 mL, 1.55 mmol) was added dropwise and the reaction was stirred at room temperature for 1 hour. The reaction mixture was diluted with anhydrous dichloromethane (2×20 mL) and washed with degassed saturated potassium chloride (30 mL), passed through anhydrous sodium sulfate, concentrated and dried under high vacuum. The crude product was purified by flash chromatography (80% ethyl acetate in (0.2% pyridine in hexanes)) under argon to afford the title compound (0.6 g, 1.13 mmol, 87%) as a colorless oil which was dissolved in degassed anhydrous acetonitrile and filtered through a 0.45 μm syringe filter, concentrated and aliquoted.

[0593] 1 H NMR (400MHz, CD3CN) δppm 7.89 (t, 1H, J = 8.5Hz, C H Ar), 7.72(d, 0.5H, J = 2.0Hz, C H Ar), 7.67(d, 0.5H, J = 2.1 Hz, C H Ar),7.57(s,0.5H,C H triazole), 7.55(s,0.5H,C H triazole), 7.33 (dd, 1H, J = 8.4 Hz, 2.0 Hz, C H Ar), 5.62-5.58(m,2H,C H 2N),5.48-5.36(m,1H,C H CH3), 3.85-3.40(m,4H,C H 2CH2CN,2×C H (CH3)2), 2.69-2.63 (m, 3H, CH2C H 2CN, triazole C H2CH2), 2.53(t,1H,J=5.8Hz, triazole C H 2CH2),1.67-1.58(m,triazoleCH2C H 2),1.52(t,3H,J=6.4Hz,CHC H 3),1.37-1.26(m,6H C H 2C H 2C H 2CH3),1.17-1.09(m,9H,2×CH(C H 3)2),0.9-0.85(m,3H,CH2CH2CH2C H 3),0.83(d,3H,J=6.7Hz,2×CH(C H 3)2).

[0594] 31 P{ 1 H}NMR (162MHz, CD3CN) δppm 148.5, 148.3.

[0595] Example 2: Synthesis of 5'-PC C3

[0596] This example describes the synthesis of a compound of formula (I) as a compound of formula (II-2).

[0597] ((1-(5-(4-(Hexyl)-1H-1,2,3-triazol-1-ylmethyl)-2-nitrophenyl)ethoxy)methyl)(methyl)sulfane

[0598]

[0599] To a solution of 1-(5-(4-(hexyl)-1H-1,2,3-triazol-1-ylmethyl)-2-nitrophenyl)ethan-1-ol (0.5 g, 1.5 mmol) in dimethyl sulfoxide (8 mL) were added acetic anhydride (12 mL) and glacial acetic acid (8 mL) and the reaction mixture was stirred at room temperature for 20 hours. The reaction mixture was poured into a saturated aqueous sodium carbonate solution cooled in an ice bath, stirred for an additional 30 minutes, and then extracted with ethyl acetate. The combined organic layers were washed with saturated aqueous sodium carbonate solution, water, and brine, dried over anhydrous sodium sulfate, and concentrated. The crude product was purified by flash chromatography (0-30% ethyl acetate in hexanes) to give the title compound (0.36 g, 0.92 mmol, 61%).

[0600] 1 H NMR (400MHz, CDCl3) 7.92 (d, 1H, J = 8.3Hz, C H Ar), 7.65(d,1H,J=2.1Hz,CH Ar),7.27(br.s,1H,C H triazole), 7.23 (dd, 1H, J = 8.4 Hz, 2.1 Hz, C H Ar), 5.65-5.55(m,2H,C H 2N),5.41(q,1H,J=6.3Hz,C H CH3),4.6(d,1H,J=11.5Hz,C H 2SCH3),4.3(d,1H,J=11.5Hz,C H 2SCH3), 2.75-2.7(m, 2H, triazole C H 2CH2),2.1(s,3H,CH2SC H 3),1.72-1.62(m,2H,triazoleCH2C H 2),1.52(d,3H,J=6.4Hz,CHC H 3),1.40-1.27(m,6H,C H 2C H 2C H 2CH3),0.91-0.85(m,3H,CH2CH2CH2C H 3).

[0601] ((1-(5-(4-(Hexyl)-1H-1,2,3-triazol-1-ylmethyl)-2-nitrophenyl)ethoxy)methoxy)propan-1-ol

[0602]

[0603] To a solution of ((1-(5-(4-(hexyl)-1H-1,2,3-triazol-1-ylmethyl)-2-nitrophenyl)ethoxy)methyl)(methyl)sulfane (0.16 g, 0.4 mmol) and 1,3-propanediol (0.57 mL, 8 mmol) in anhydrous tetrahydrofuran (2 mL) at -40°C was added N-iodosuccinimide (0.09 g, 0.4 mmol) and Molecular sieves, trifluoromethanesulfonic acid (0.035mL, 0.4mmol) was added and the mixture was stirred for 30 minutes. The reaction was quenched with triethylamine and filtered through celite and concentrated in vacuo. The residue was dissolved in ethyl acetate and washed with saturated aqueous sodium thiosulfate. The combined organic layers were washed with saturated sodium carbonate, water and brine, dried over anhydrous sodium sulfate, filtered and concentrated in vacuo, and purified by flash chromatography (0-100% ethyl acetate dissolved in hexane) to produce the target compound (0.08g, 0.19mmol, 48%).

[0604] 1H NMR (400MHz, CDCl3) 7.92 (d, 1H, J = 8.4Hz, C H Ar), 7.67(d,1H,J=1.8Hz,C H Ar),7.34(br.s,1H,C H triazole), 7.22 (dd, 1H, J = 8.4 Hz, 2.0 Hz, C H Ar), 5.65-5.57(m,2H,C H 2N),5.33-5.27(m,1H,C H CH3), 4.67(d,1H,J=6.7Hz,C H 2OCH2),4.55(d,1H,J=6.7Hz,C H 2OCH2),3.71-3.64(m,3H,C H 2CH2C H 2OH),3.55-3.47(m,1H,C H 2CH2CH2OH), 2.77-2.70(m, 2H, triazole C H 2CH2),1.75-1.62(m,4H,CH2C H 2CH2OH, triazole CH2C H 2),1.52(d,3H,J=6.4Hz,CHC H 3),1.39-1.24(m,6H,C H 2C H 2C H 2CH3),0.91-0.86(m,3H,CH2CH2CH2C H 3).

[0605] 2-Cyanoethyl(((1-(5-(4-(hexyl)-1H-1,2,3-triazol-1-ylmethyl)-2-nitrophenyl)ethoxy)methoxy)propyl)diisopropylphosphoramidite

[0606]

[0607] A solution of ((1-(5-(4-(hexyl)-1H-1,2,3-triazol-1-ylmethyl)-2-nitrophenyl)ethoxy)methoxy)propan-1-ol (0.16 g, 0.38 mmol) in anhydrous dichloromethane (2 mL) was degassed under argon for 5 minutes, and then anhydrous diisopropylethylamine (0.199 mL, 1.14 mmol) was added. 2-Cyanoethoxy-N,N-diisopropylaminophosphine chloride (0.12 mL, 0.49 mmol) was added dropwise and the reaction was stirred at room temperature for 1 hour. The reaction mixture was diluted with anhydrous dichloromethane (2×10 mL) and washed with degassed saturated potassium chloride (30 mL), passed through anhydrous sodium sulfate, concentrated and dried under high vacuum. The crude product was purified by flash chromatography under argon (100% 0.2% pyridine in ethyl acetate) to give the title compound (0.16 g, 0.26 mmol, 68%) as a colorless oil which was dissolved in degassed anhydrous acetonitrile and filtered through a 0.45 μm syringe filter, concentrated and aliquoted.

[0608] 1 H NMR(400MHz,CD3CN)δppm 7.92-7.88(m,1H,C H Ar), 7.64-7.57(m,2H,C H Ar,C H triazole), 7.34-7.28 (m, 1H, C H Ar), 5.67-5.57(m,2H,C H 2N),5.23(q,1H,J=6.4Hz,C H CH3),4.65-4.59(m,1H,C H 2OCH2),4.48-4.44(m,1H,C H 2OCH2),3.85-3.70(m,2H,2×C H (CH3)2), 3.69-3.50(m, 5H, C H 2CH2CN,C H 2CH2C H 2OH),3.41-3.32(m,1H,C H 2CH2CH2OH),2.72-2.63(m,4H,CH2C H 2CN, triazole C H 2CH2),1.74-1.59(m,4H,triazoleCH2C H 2,CH2C H 2CH2OH),1.48(d,3H,J=6.5Hz,CHC H 3),1.38-1.27(m,6H,C H2C H 2C H 2CH3),1.22-1.13(m,12H,2×CH(C H 3)2),0.94-0.86(m,3H,CH2CH2CH2C H 3).

[0609] 31 P{ 1 H}NMR (162MHz, CD3CN) δppm 148.6, 148.5.

[0610] Example 3: Synthesis of 5'-PC dT

[0611] This example describes the synthesis of a compound of formula (I) as a compound of formula (II-2).

[0612] 5′-O-(4,4′-dimethoxytrityl)-3′-O-(tert-butyldimethylsilyl)thymidine

[0613]

[0614] To a solution of 5'-O-(4,4'-dimethoxytrityl)thymidine (3.5 g, 6.43 mmol) and imidazole (1.9 g, 28.2 mmol) in anhydrous dichloromethane (10 mL) was added tert-butyldimethylsilyl chloride (4.2 g, 27.87 mmol). The reaction mixture was stirred at room temperature for 20 hours and quenched with methanol (2 mL). The solution was diluted with ethyl acetate, washed with 5% aqueous sodium bicarbonate solution, water and brine, dried over anhydrous sodium sulfate, filtered and concentrated. The product (3.8 g, 5.8 mmol, 90%) was carried on to the next step without additional purification.

[0615] 3′-O-(tert-butyldimethylsilyl)thymidine

[0616]

[0617] A solution of 5'-O-(4,4'-dimethoxytrityl)-3'-O-(tert-butyldimethylsilyl)thymidine (3.8 g, 5.8 mmol) in 80% acetic acid (45 mL) was stirred at 50°C for 30 minutes. The reaction mixture was then diluted with dichloromethane, washed with water and saturated sodium bicarbonate, dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by flash chromatography (0-4% methanol in dichloromethane) to give the title compound (1.96 g, 5.51 mmol, 95%).

[0618] 1H NMR(400MHz,CDCl3)8.59(s,1H,NH),7.36(s,1H,C H 6 ),6.16-6.12(m,1H,C H 1’ ),4.52-4.48(m,1H,C H 4’ ),3.96-3.91(m,2H,C H 3’ ,C H 5’ ),3.79-3.74(m,1H,C H 5’ ),2.41-2.32(m,1H,C H 2’ ),2.26-2.19(m,1H,C H 2’ ),1.92(d,3H,J=1.22Hz,C H 3),0.9(s,9H,(C H 3)3CSi),0.09(s,6H,(C H 3)2Si).

[0619] ((1-(5-(Azidomethyl)-2-nitrophenyl)ethoxy)methyl)(methyl)sulfane

[0620]

[0621] To a solution of 1-(5-(azidomethyl)-2-nitrophenyl)ethan-1-ol (1.65 g, 7.4 mmol) in dimethyl sulfoxide (38 mL) were added acetic anhydride (57 mL) and glacial acetic acid (38 mL), and the reaction mixture was stirred at room temperature for 20 hours. The reaction mixture was poured into a saturated aqueous sodium carbonate solution cooled in an ice bath, stirred for an additional 30 minutes, and then extracted with ethyl acetate. The combined organic layers were washed with saturated aqueous sodium carbonate, water, and brine, dried over anhydrous sodium sulfate, and concentrated. The crude product was purified by flash chromatography (0-30% ethyl acetate in hexanes) to give the title compound (1.7 g, 6 mmol, 81%).

[0622] 1 H NMR (400MHz, CDCl3) δppm 7.96 (d, 1H, J = 8.4Hz, C H Ar), 7.72(d,1H,J=2.0Hz,C H Ar),7.39(dd,1H,J=8.4,2.0Hz,C HAr), 5.45(q,1H,J=6.4Hz,CH3C H ),4.64(d,1H,J=11.5Hz,C H 2SCH3),4.49(s,2H,C H 2N3),4.35(d,1H,J=11.5Hz,C H 2SCH3),2.13(s,3H,CH2SC H 3),1.56(d,3H,J=6.5Hz,C H 3CH).

[0623] 5′-O-((1-(5-(azidomethyl)-2-nitrophenyl)ethoxy)methyl)thymidine

[0624]

[0625] To a solution of ((1-(5-(azidomethyl)-2-nitrophenyl)ethoxy)methyl)(methyl)sulfane (0.45 g, 1.6 mmol) and 3′-O-(tert-butyldimethylsilyl)thymidine (0.54 g, 1.5 mmol) in anhydrous tetrahydrofuran (5 mL) at -40°C were added N-iodosuccinimide (0.36 g, 1.6 mmol) and Molecular sieves are then added with trifluoromethanesulfonic acid (0.14mL, 1.6mmol), and the mixture is stirred for 30 minutes. The reaction is quenched with triethylamine and filtered with diatomaceous earth, and then concentrated in vacuo. The residue is dissolved in ethyl acetate and washed with saturated sodium thiosulfate aqueous solution. The combined organic layer is washed with saturated sodium carbonate, water and brine, then dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue is dissolved in anhydrous methanol (15mL), ammonium fluoride (0.56g, 15.2mmol) is added and the mixture is refluxed for 2 hours, then cooled to room temperature and kept for 12 hours. The reaction mixture is concentrated in vacuo and purified by flash chromatography (0-100% ethyl acetate dissolved in hexane) to produce the target compound (0.35g, 0.74mmol, 46%, a mixture of diastereomers).

[0626] 1 H NMR (400MHz, CDCl3) δppm 8.60 (s, 1H, N H ),7.96-7.91(m,1H,C H Ar), 7.76-7.70(m,1H,C H Ar), 7.43-7.37(m,2H,C H Ar,C H 6 ),6.35-6.26(m,1H,C H1’ ),5.41-5.30(m,1H,C H CH3), 4.86-4.81(m, 0.5H, C H 2OCH2),4.76-4.65(m,1H,C H 2OCH2),4.62-4.58(m,0.5H,C H 2OCH2),4.53-4.49(m,2H,C H 2N3),4.47-4.42(m,0.5H,C H 3’ ),4.17-4.12(m,0.5H,C H 3’ ),4.04(q,1H,J=3.3Hz,C H 4’ ),3.96-3.88(m,1H,C H 4’ ,C H 5’ ),3.78-3.60(m,1.5H,C H 5’ ),2.39-2.27(m,1H,C H 2’ ),2.19-2.05(m,1H,C H 2’ ),1.93-1.91(m,1.5H,C H 3),1.85-1.83(m,1.5H,C H 3),1.60-1.56(m,3H,CHC H 3).

[0627] 5′-O-((1-(5-((4-(hexyl)-1H-1,2,3-triazol-1-yl)methyl)-2-nitrophenyl)ethoxy)methyl)thymidine

[0628]

[0629] 5'-O-((1-(5-(azidomethyl)-2-nitrophenyl)ethoxy)methyl)thymidine (0.35 g, 0.74 mmol) and 1-octyne (0.16 mL, 1.1 mmol) were added to a 3:1:1 mixture of tetrahydrofuran / tert-butyl alcohol / water (10 mL / 3.5 mL / 3.5 mL). 7.5% aqueous copper(II) sulfate (1.63 mL) and 1M aqueous (+)-L-sodium ascorbate (1.85 mL) were added and the reaction was stirred at room temperature for 2 hours. The mixture was diluted with ethyl acetate and the organic phase was washed with saturated sodium bicarbonate and brine (10% diluted with water), dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by flash chromatography (0-3% methanol in (0.1% triethylamine in dichloromethane)) to give the title compound (0.27 g, 0.46 mmol, 62%, mixture of diastereomers).

[0630] 1 H NMR(400MHz,CDCl3)δppm 9.47-9.35(m,1H,N H ),7.90-7.85(m,1H,C H Ar), 7.65-7.61(m,1H,C H Ar),7.43(s,0.5H,C H 6 ),7.39-7.33(m,1.5H,C H 6 ,C H triazole), 7.29-7.22 (m, 1H, C H Ar), 6.30-6.23(m,1H,C H 1’ ),5.64-5.55(m,2H,C H 2N),5.27(q,0.5H,J=6.4Hz,C H CH3), 5.21(q, 0.5H, J = 6.3 Hz, C H CH3), 4.79-4.76(m, 0.5H, C H 2OCH2),4.70-4.66(m,1H,C H 2OCH2),4.65-4.61(m,0.5H,C H 2OCH2),4.42-4.31(m,1H,C H 3’ ,O H ),4.16-4.11(m,0.5H,O H ),3.95(q,0.5H,J=3.1Hz,C H4’ ),3.91(q,0.5H,J=3.9Hz,C H 4’ ),3.84-3.78(m,0.5H,C H 3’ ),3.75-3.69(m,0.5H,C H 5’ ),3.67-3.59(m,1H,C H 5’ ),3.53-3.47(m,0.5H,C H 5’ ),2.70(t,2H,triazole C H 2CH2), 2.39-2.31(m, 0.5H, C H 2’ ),2.28-2.20(m,0.5H,C H 2’ ),2.18-2.10(m,0.5H,C H 2’ ),1.99-1.91(m,0.5H,C H 2’ ),1.87-1.82(m,3H,C H 3),1.69-1.59(m,2H,triazoleCH2C H 2),1.52-1.47(m,3H,CHC H 3),1.38-1.23(m,6H,C H 2C H 2C H 2CH3),0.90-0.82(m,3H,CH2CH2CH2C H 3).

[0631] 5′-O-((1-(5-((4-(hexyl)-1H-1,2,3-triazol-1-yl)methyl)-2-nitrophenyl)ethoxy)methyl)thymidine-3′-O-(2-cyanoethyldiisopropylphosphoramidite)

[0632]

[0633] A solution of 5′-O-((1-(5-((4-(hexyl)-1H-1,2,3-triazol-1-yl)methyl)-2-nitrophenyl)ethoxy)methyl)thymidine (0.27 g, 0.46 mmol) in anhydrous dichloromethane (3 mL) was degassed under argon for 5 minutes, and then anhydrous diisopropylethylamine (0.24 mL, 1.38 mmol) was added. 2-Cyanoethoxy-N,N-diisopropylaminophosphine chloride (0.123 mL, 0.552 mmol) was added dropwise and the reaction was stirred at room temperature for 1 hour. The reaction mixture was diluted with anhydrous dichloromethane (2×10 mL), washed with degassed saturated potassium chloride (30 mL), passed through anhydrous sodium sulfate, concentrated and dried under high vacuum. The crude product was purified by flash chromatography under argon (100% 0.2% pyridine in ethyl acetate) to give the title compound (0.25 g, 0.32 mmol, 70%, mixture of diastereomers) as a colorless oil, which was dissolved in degassed anhydrous acetonitrile and filtered through a 0.45 μm syringe filter, concentrated and aliquoted.

[0634] 1 H NMR(400MHz,CDCl3)δppm 8.89(br.s,1H,N H ),7.91-7.86(m,1H,C H Ar), 7.62-7.56(m,2H,C H Ar,C H triazole), 7.40-7.36 (s, 1H, C H 6 ),7.32-7.27(m,1H,C H Ar), 6.21-6.16(m,1H,C H 1’ ),5.62-5.59(m,2H,C H 2N),5.30-5.22(m,1H,C H CH3), 4.76-4.72(m,0.5H,C H 2OCH2),4.68-4.64(m,0.5H,C H 2OCH2),4.60-4.52(m,1H,C H 2OCH2),4.48-4.40(m,0.5H,C H 3’ ),4.31-4.22(m,0.5H,C H 3’ ),4.1-3.93(m,1H,C H 4’ ),3.86-3.42(m,6H,2×C H(CH3)2,C H 2CH2CN,C H 5’ ),2.68-2.61(m,4H,CH2C H 2CN, triazole C H 2CH2),2.35-2.09(m,2H,C H 2’ ),1.81-1.78(m,1.5H,C H 3),1.81-1.78(m,1.5H,C H 3),1.76-1.74(m,1.5H,C H 3),1.66-1.57(m,2H,triazoleCH2C H 2),1.50-1.44(m,3H,CHC H 3),1.37-1.25(m,6H,C H 2C H 2C H 2CH3),1.21-1.11(2×CH(C H 3)2),0.91-0.84(m,3H,CH2CH2CH2C H 3).

[0635] 31 P{ 1 H}NMR (162MHz, CD3CN) δppm 149.9, 149.8, 149.7, 149.6.

[0636] Example 4: Synthesis of 5'-PC MePhos

[0637] This example describes the synthesis of a compound of formula (I) as a compound of formula (II-3).

[0638] 1-(5-oct-1-ynyl-2-nitrophenyl)ethan-1-one

[0639]

[0640] To a solution of 1-octyne (3.025 mL, 20.5 mmol) and anhydrous triethylamine (30 mL, 41 mmol) in anhydrous dimethylformamide (75 mL) was added 1-(5-bromo-2-nitrophenyl)ethanone (2.5 g, 10.25 mmol) and the mixture was degassed under argon for 5 minutes. Tetrakis(triphenylphosphine)palladium(0) (1.21 g, 1.05 mmol) and copper(I) iodide (0.4 g, 2.05 mmol) were then added and the reaction was heated at 80°C for 1 hour. The reaction mixture was concentrated in vacuo and purified by flash chromatography (0-20% ethyl acetate in hexanes) to give the title compound (1.2 g, 4.4 mmol, 43%) as a colorless oil.

[0641] 1 H NMR (400MHz, CDCl3) δppm 8.04 (d, 1H, J = 8.6Hz, C H Ar),7.54(dd,1H,J=8.6Hz,1.8Hz,C H Ar), 7.37(d,1H,J=1.7Hz,C H Ar),2.55(s,3H,C H 3),2.45(t,2H,J=7.15Hz,CC H 2CH2),1.67-1.58(m,2H,CCH2C H 2),1.50-1.27(m,6H,C H 2C H 2C H 2CH3),0.94-0.89(m,3H,CH2CH2CH2C H 3).

[0642] 2-Methyl(5-oct-1-ynyl-2-nitrophenyl)-1,3-dioxolane

[0643]

[0644] A mixture of 1-(5-oct-1-ynyl-2-nitrophenyl)ethan-1-one (1.2 g, 4.6 mmol), anhydrous ethylene glycol (3.9 mL, 23 mmol) and p-toluenesulfonic acid (0.045 g, 0.23 mmol) in anhydrous toluene (40 mL) was refluxed in a Dean-Stark apparatus for 48 hours. The reaction mixture was washed with saturated sodium bicarbonate and brine, dried over anhydrous sodium sulfate and concentrated. The crude product was purified by flash chromatography (0-11% ethyl acetate in hexanes) to give the title compound (1.45 g, 4.6 mmol, 100%) as a colorless oil.

[0645] 1 H NMR (400MHz, CDCl3) δppm 7.66 (d, 1H, J = 1.6Hz, C H Ar), 7.41-7.33(m,2H,2×C H Ar), 4.06-3.97(m,2H,OC H 2C H 2O),3.71-3.62(m,2H,OC H 2C H 2O),2.55(s,3H,C H 3),2.43(t,2H,J=7.15Hz,CC H 2CH2),1.86(s,3H,C H 3),1.67-1.58(m,2H,CCH2C H 2),1.51-1.26(m,6H,C H 2C H 2C H 2CH3),0.95-0.88(m,3H,CH2CH2CH2C H 3).

[0646] 2-(1-(5-oct-1-ynyl-2-nitrophenyl)ethoxy)ethan-1-ol

[0647]

[0648] To a solution of 2-methyl(5-oct-1-ynyl-2-nitrophenyl)-1,3-dioxolane (0.85 g, 2.7 mmol) in anhydrous acetonitrile (20 mL) was added titanium tetrachloride (0.4 mL, 3.5 mmol) followed by sodium cyanoborohydride (0.2 g, 3.24 mmol) at 0°C. The resulting yellow suspension was stirred at room temperature for 2 hours, then neutralized with saturated sodium bicarbonate, extracted with dichloromethane, dried over anhydrous sodium sulfate, filtered and concentrated. The crude product was purified by flash chromatography (0-43% ethyl acetate in hexanes) to yield the title compound (0.56 g, 1.75 mmol, 65%) as a colorless oil.

[0649] 1 H NMR (400MHz, CDCl3) δppm 7.87 (d, 1H, J = 8.4Hz, C H Ar), 7.74(d,1H,J=1.8Hz,C H Ar),7.39(dd,1H,J=8.5Hz,1.9Hz,C H Ar), 5.07(q, 1H, J = 6.3 Hz, C HCH3), 3.78-3.71(m,2H,CH2C H 2OH),3.49-3.39(m,2H,C H 2CH2OH),2.45(t,2H,J=7.1Hz,CC H 2CH2),1.97-1.90(m,1H,CH2CH2O H ),1.67-1.56(m,2H,CCH2C H 2),1.56-1.53(m,3H,CHC H 3),1.51-1.26(m,6H,C H 2C H 2C H 2CH3),0.95-0.89(m,3H,CH2CH2CH2C H 3).

[0650] Bis(diisopropylamino)(methyl)phosphine

[0651]

[0652] To a solution of bis(diisopropylamino)phosphine chloride (22 g, 82.5 mmol) in anhydrous ether (350 mL) was added dropwise a 3 molar solution of methylmagnesium bromide in ether (33 mL) at 0°C, and the mixture was stirred for 1 hour. The reaction mixture was warmed to room temperature, filtered under argon, and then concentrated. The crude product was distilled under reduced pressure (at 70-75°C at 0.07 mmHg) to produce a colorless oil (19 g, 77 mmol, 93%).

[0653] 1 H NMR (400MHz, CDCl3) δppm 3.46-3.33 (m, 4H, 4×C H (CH3)2),1.22(s,1.5H,PC H 3),1.21-1.16(m,13.5H,PC H 3,2×CH(C H 3)2),1.09(d,12H,J=6.7Hz,2×CH(C H 3)2).

[0654] 31 P{ 1 H}NMR (162MHz, CD3CN) δppm 39.7.

[0655] 2-(1-(5-oct-1-ynyl-2-nitrophenyl)ethoxy)ethoxy[(diisopropylamino)(methyl)phosphine]

[0656]

[0657] To a solution of 2-(1-(5-oct-1-ynyl-2-nitrophenyl)ethoxy)ethan-1-ol (0.12 g, 0.38 mmol) and 4,5-dicyanoimidazole (0.04 g, 0.34 mmol) in degassed anhydrous dichloromethane (5 mL) was added dropwise a mixture of bis(diisopropylamino)(methyl)phosphine (0.128 g, 0.38 mmol) in degassed anhydrous dichloromethane (2 mL), and the mixture was stirred for 40 minutes. The reaction mixture was neutralized with a small amount of anhydrous triethylamine, and the entire mixture was purified by flash chromatography (25% ethyl acetate in (0.2% triethylamine in hexane)) under argon to give the title compound (0.13 g, 0.28 mmol, 74%) as a colorless oil.

[0658] 1 H NMR(400MHz,CDCl3)δppm 7.91-7.86(m,1H,C H Ar), 7.80-7.77(m,1H,C H Ar),7.42(dd,1H,C H Ar), 5.04-4.97(m,1H,C H CH3), 3.71-3.41(m,5H,C H 2C H 2OP,C H (CH3)2), 3.36-3.24(m,1H,C H (CH3)2),2.45(t,2H,J=7.1Hz,CC H 2CH2),1.64-1.56(m,2H,CCH2C H 2),1.50-1.30(m,9H,PC H 3,C H 2C H 2C H 2CH3),1.20-1.06(m,12H,2×C H (CH3)2),0.93-0.88(m,3H,CH2CH2CH2C H 3).

[0659] 31 P{ 1 H}NMR (162MHz, CD3CN) δppm 122.9, 122.2.

[0660] Example 5: Oligonucleotide synthesis and purification method

[0661] Standard DNA phosphoramidites, solid phase supports and reagents were purchased from Link Technologies and Applied Biosystems. Small-scale automated solid phase synthesis of oligonucleotides was performed on a K&A H-8SE DNA / RNA synthesizer. Synthesis was performed at 0.2 micromolar or 1.0 micromolar scale and included cycles of acid-catalyzed detritylation, coupling, capping and iodine oxidation. Standard DNA phosphoramidite coupling was performed for 60 seconds. Coupling efficiency and total synthesis yield were determined by built-in automatic trityl cation conductivity monitoring equipment and were ≥98.0% in all cases. Oligonucleotides were treated with 20% diethylamine and then cleaved from the solid phase support with concentrated ammonium hydroxide at room temperature for 60 minutes on an Applied Biosystems 394 synthesizer, followed by heating at 55°C for 5 hours in a sealed tube to remove protecting groups from the nucleobases and backbone.

[0662] Large-scale automated solid-phase synthesis of oligonucleotides The synthesis was carried out on an oligopilot synthesizer. The synthesis was carried out on a 15 micromolar or 30 micromolar scale and included cycles of acid-catalyzed detritylation, coupling, capping and iodine oxidation. Standard DNA phosphoramidite coupling was performed for 60 s. Coupling efficiency and overall synthesis yield were determined by built-in automatic trityl cation conductivity monitoring equipment and were ≥98.0% in all cases. The oligonucleotides were treated with 20% diethylamine for 10 minutes and then manually cleaved from the solid support with concentrated ammonium hydroxide by heating at 55°C in a sealed tube for 5 h.

[0663] The methylphosphonamide coupling was carried out for 10 minutes. Cleavage and deprotection of methylphosphonate-containing oligonucleotides was achieved by treatment with a solution of 45:45:10 acetonitrile / ethanol / concentrated ammonium hydroxide at room temperature for 30 minutes followed by the addition of an equal amount of ethylenediamine for 6 hours.

[0664] Using Gilson HPLC system on Luna 10μm C8(2) RPHPLC purification of oligonucleotides was performed on an LC column using 0.1 M triethylamine acetate (TEAA) buffer, pH 7.5, and desalting using a prepacked Sephadex G-25 column.

[0665] The ES - Mass spectra of the oligonucleotides were recorded in 4% mode. UV absorbance was measured at 260 nm in water on an Agilent Technologies Cary 60 UV-Vis.

[0666] UV cleavage was performed using a handheld Analytik Jena UVP UVGL-254W UV lamp placed approximately 2 cm from the sample. Samples dissolved in Milli-Q water were irradiated at 365 nm for 50 minutes to produce near quantitative cleavage. Low molecular weight cleavage products and oligonucleotides were separated using pre-packed Sephadex G-25 columns or by organic extraction. Methylphosphonate was then treated with concentrated ammonium hydroxide at room temperature for 2 hours.

[0667] Ultra-performance liquid chromatography-mass spectrometry (UPLC-MS) analysis of oligonucleotides was performed on a Waters ACQUITY H-Class system coupled to a Waters Xevo G2-XSQTof mass spectrometer. ) at 60°C with a flow rate of 0.25 mL / min using gradient buffers A and B: buffer A, 400 mM 1,1,1,3,3,3-hexafluoroisopropanol, 15 mM triethylamine; buffer B, 50% 400 mM 1,1,1,3,3,3-hexafluoroisopropanol, 15 mM triethylamine, 50% methanol. The eluent was injected directly into the mass spectrometer and data were acquired in negative ion mode. The data were analyzed and deconvoluted using the MaxEnt1 algorithm (UNIFI, Waters).

[0668] Capillary electrophoresis (CE) analysis of oligonucleotides was performed on a SCIEX P / ACE MDQ Plus using the ssDNA 100-R kit.

[0669] Example 6: Modification and purification of oligonucleotides using the compounds of Example 2

[0670] A 92-mer oligonucleotide mixture was synthesized at a 15 μmol scale under standard conditions, with the terminal 5' additive spacer C3 phosphoramidite replaced with 5'-PC C3 (2-cyanoethyl (((1-(5-(4-(hexyl)-1H-1,2,3-triazol-1-ylmethyl)-2-nitrophenyl)ethoxy)methoxy)propyl)diisopropylphosphoramidite). The crude oligonucleotide was analyzed by mass spectrometry after cleavage and deprotection. Calculated mass 26846.3. Found mass 26848.1.

[0671] RPHPLC with 0.1 M TEAA at pH 7.5 in Luna 10 μm C8 (2) 1 μmol crude oligonucleotide was purified on LC column with 20-60% gradient in 30 minutes. The collected oligonucleotide was desalted with pre-packed Sephadex G-25 column. The sample was analyzed by mass spectrometry. Calculated mass 26846.3. Measured mass 26847.6.

[0672] The purified oligonucleotide was dissolved in 1 mL of Milli-Q water, irradiated at 365 nm for 50 minutes, and passed through a pre-packed Sephadex G-25 column. The sample was analyzed by mass spectrometry. Calculated mass 26501.9. Measured mass 26503.1. Photolysis was performed quantitatively.

[0673] RPHPLC with 0.1 M TEAA at pH 7.5 in Luna 10 μm C8 (2) The oligonucleotides were repurified on an LC column with a 20-minute 5-45% gradient. The collected oligonucleotides were desalted using a pre-packed Sephadex G-25 column. The sample was analyzed by mass spectrometry. Calculated mass 26501.9. Measured mass 26502.9.

[0674] The purity of the samples was analyzed by UPLC-MS ( Figure 1 A), measured to be 90.05% pure.

[0675] For comparison, the same 92-mer oligonucleotide was synthesized at 1 μmol scale under standard conditions, with the terminal 5' addition replaced by the standard spacer C3 phosphoramidite.

[0676] RPHPLC with 0.1 M TEAA at pH 7.5 in Luna 10 μm C8 (2) The crude oligonucleotides were purified on an LC column using a 20-60% gradient over 30 minutes. The pooled oligonucleotides were desalted using a prepacked Sephadex G-25 column.

[0677] RPHPLC with 0.1 M TEAA at pH 7.5 in Luna 10 μm C8 (2) The oligonucleotides were repurified on an LC column with a 20 minute 5-45% gradient. The collected oligonucleotides were desalted using a prepacked Sephadex G-25 column.

[0678] The purity of the samples was analyzed by UPLC-MS ( Figure 1 B), was measured to be 62.31% pure.

[0679] This example demonstrates that compounds of formula (I) can be incorporated into polynucleotides, can be used to improve purification by, for example, HPLC, and can also be successfully photocleaved to produce the desired product.

[0680] Example 7: Modification and purification of oligonucleotides using the compounds of Example 1

[0681] Two oligonucleotides with or without terminal 5'-PC PO3 (compound of Example 1, i.e., 2-cyanoethyl (1-(5-((4-hexyl-1H-1,2,3-triazol-1-yl)methyl)-2-nitrophenyl)ethyl)diisopropylphosphoramidite) modification were synthesized under standard conditions on a 1 μmol scale. The sequences are shown below. SEQ ID NO:3 is equivalent to SEQ ID NO:1 with the addition of 5'-PC PO3. SEQ ID NO:4 is equivalent to SEQ ID NO:2 with the addition of 5'-PC PO3.

[0682] SEQ ID NO:1:TTGCAGCTCCTTCTCTTGTTCCGTGGAGCA AGCCTTCTTAA

[0683] SEQ ID NO:2: GCCTATTGTAGTGCGGAAGAGAATCGGTCT AAGCTTCCTAATTC

[0684] SEQ ID NO:3:XTTGCAGTCCTTCTCTTGTTCCGTGGAGC AAGCCTTCTTAA

[0685] SEQ ID NO:4:XGCCTATTGTAGTGCGGAAGAGAATCGGTC TAAGCTTCCTAATTC

[0686] [X=5'-PC PO3]

[0687] After cleavage and deprotection, the precipitate was purified by RPHPLC using 0.1 M TEAA at pH 7.5 in Luna 10 μm C8 (2) Oligonucleotides were purified on LC columns using a 20-min 10-40% gradient for Seq.1 and Seq.2 and a 20-min 15-60% gradient for Seq.3 and Seq.4. The collected oligonucleotides were desalted using a pre-packed Sephadex G-25 column. Samples were analyzed by mass spectrometry.

[0688] SEQ ID NO: 1: calculated mass 12484.1, found mass 12484.4

[0689] SEQ ID NO: 2: calculated mass 13561.8, found mass 13562.1

[0690] SEQ ID NO:3: calculated mass 12878.5, found mass 12878.7

[0691] SEQ ID NO:4: calculated mass 13956.2, found mass 13956.7

[0692] The purified oligonucleotides SEQ ID NO:3 and SEQ ID NO:4 were dissolved in 1 mL of Milli-Q water, irradiated at 365 nm for 50 minutes, and passed through a pre-packed Sephadex G-25 column. The samples were analyzed by mass spectrometry. Photolysis was performed quantitatively.

[0693] SEQ ID NO:3: calculated mass 12562.1, found mass 12564.5

[0694] SEQ ID NO: 4: calculated mass 13639.8, found mass 13642.4

[0695] The purity of the oligonucleotides was analyzed by CE. Figure 2 As shown in (A: SEQ ID NO: 1; B: SEQ ID NO: 2; C: SEQ ID NO: 3; D: SEQ ID NO: 4), the calculated purity levels are summarized in the following table:

[0696] sequence purity SEQ ID NO:1 85.4％ SEQ ID NO:2 83.11％ SEQ ID NO:3 93.6％ SEQ ID NO:4 94.5％

[0697] As summarized above and Figure 2 As can be seen, the synthesized oligonucleotides with 5'-PC PO3 showed significantly higher purity and fewer truncated sequences than those synthesized by traditional methods. Figure 3 Comparison of SEQ ID NO: 2 (A) and SEQ ID NO: 4 (B) in Figure 2 The enlarged area of ​​the electropherogram in Figure 2 is shown in Figure 3. It is obvious that the trace of SEQ ID NO: 4 is much cleaner than that of SEQ ID NO: 2, indicating that there are fewer impurities.

[0698] This example shows that compounds of formula (I) can be incorporated into polynucleotides, can be used to improve purification by, for example, HPLC, and can be successfully photocleaved to produce the desired product; and the purity of the resulting polynucleotides is higher than that achievable by conventional methods.

[0699] Example 8: Modification and purification of oligonucleotides using the compound of Example 3

[0700] Oligonucleotides with terminal 5'-PC dT (compound of Example 3, i.e., 5'-O-((1-(5-((4-(hexyl)-1H-1,2,3-triazol-1-yl)methyl)-2-nitrophenyl)ethoxy)methyl)thymidine-3'-O-(2-cyanoethyldiisopropylphosphoramidite)) modification were synthesized on a 1 μmol scale under standard conditions.

[0701] SEQ ID NO:5:XTAATACGACTCACTATAG

[0702] [X = 5'-PC dT]

[0703] After cleavage and deprotection, the precipitate was purified by RPHPLC using 0.1 M TEAA at pH 7.5 in Luna 10 μm C8 (2) The oligonucleotides were purified on an LC column with a 5-45% gradient over 20 minutes. The collected oligonucleotides were desalted using a pre-packed Sephadex G-25 column. The sample was analyzed by mass spectrometry. The calculated mass was 6115.2, and the measured mass was 6116.0.

[0704] The purified oligonucleotide was dissolved in 1 mL of Milli-Q water, irradiated at 365 nm for 50 minutes, and passed through a pre-packed Sephadex G-25 column. The sample was analyzed by mass spectrometry. The calculated mass was 5770.8. The measured mass was 5770.3. Photolysis was performed quantitatively.

[0705] This example demonstrates that compounds of formula (I) can be incorporated into polynucleotides and can be successfully photocleaved to produce the desired products.

[0706] Example 9: Modification and purification of oligonucleotides using the compound of Example 4

[0707] Oligonucleotides with terminal 5'-PC MePhos (compound of Example 4, 2-(1-(5-oct-1-ynyl-2-nitrophenyl)ethoxy)ethoxy[(diisopropylamino)(methyl)phosphine]) modification were synthesized on a 1 μmol scale under standard conditions.

[0708] SEQ ID NO:6: XTTTTTTTTTT

[0709] [X=5'-PC MePhos]

[0710] After cleavage and deprotection, the precipitate was purified by RPHPLC using 0.1 M TEAA at pH 7.5 in Luna 10 μm C8 (2) The oligonucleotides were purified on an LC column with a 5-45% gradient over 20 minutes. The collected oligonucleotides were desalted using a pre-packed Sephadex G-25 column. The sample was analyzed by mass spectrometry. The calculated mass was 3360.14, and the measured mass was 3363.3.

[0711] The purified oligonucleotide was dissolved in 1 mL of Milli-Q water, irradiated at 365 nm for 50 minutes, and passed through a pre-packed Sephadex G-25 column. The sample was analyzed by mass spectrometry. Calculated mass 3103.0. Measured mass 3102.2. Photocleavage was performed quantitatively to generate 5'-hydroxyethylmethylphosphonate oligonucleotide.

[0712] The oligonucleotide was hydrolyzed with concentrated ammonium hydroxide at room temperature for 2 hours, concentrated, and desalted using a pre-packed Sephadex G-25 column. The sample was analyzed by mass spectrometry. The calculated mass was 2979.98, and the measured mass was 2980.3. The hydrolysis was performed quantitatively.

[0713] This example demonstrates that compounds of formula (I) can be incorporated into polynucleotides and can be successfully photocleaved to produce the desired products.

[0714] Example 10: Rapid deprotection of oligonucleotides using increased UV wattage

[0715] This example describes the deprotection of a synthetic oligonucleotide with a 5'-PC dT modification (as synthesized in Example 3).

[0716] Rapid UV cleavage was performed using an EvoluChem PhotoRedOx Box (HepatoChem) equipped with an EvoluChem PhotoRedOx Box LED light source - wavelength 365nm, power 18W, 220V, with the sample fixed in the microscope chamber. Samples dissolved in Milli-Q water were irradiated at 365nm for 2 minutes to produce near quantitative cleavage. Low molecular weight cleavage products and oligonucleotides were separated using pre-packed Sephadex G-25 columns or by organic extraction.

[0717] A 92-mer oligonucleotide mixture was synthesized at a 1 μmol scale under standard conditions, with the terminal 5'-addition dT phosphoramidite replaced by 5'-PC dT (product of Example 3). After cleavage and deprotection, the oligonucleotides were purified by RPHPLC using 0.1 M TEAA at pH 7.5 on a Luna 10 μm C8 (2) 1 μmol crude oligonucleotide was purified on LC column with 20-60% gradient in 30 minutes. The collected oligonucleotide was desalted with pre-packed Sephadex G-25 column. The product was analyzed by mass spectrometry. Calculated mass 27012.45, measured mass 27012.40.

[0718] The purified oligonucleotide was dissolved in 1 mL of Milli-Q water and subjected to rapid UV cleavage, irradiated at 365 nm for 2 minutes, and then passed through a pre-packed Sephadex G-25 column. The product was analyzed by mass spectrometry. The calculated mass was 26668.04. The measured mass was 26668.20. Photolysis was performed quantitatively.

[0719] This example demonstrates that the photocleavable groups described herein can be cleaved from purified oligonucleotides in a very short time (ie, two minutes) using higher wattage UV irradiation.

[0720] Example 11: Rapid Deprotection of Complex and Sensitive Oligonucleotides Using Increased UV Wattage for Deprotection Protection

[0721] This example describes the rapid deprotection of sensitive oligonucleotides, demonstrating that such modifications are stable under higher wattage irradiation deprotection conditions.

[0722] Example 11 was performed using the UV lysis equipment described in Example 10, except that the sample was irradiated for 15 minutes.

[0723] A pure 91-mer mixed sequence containing potentially sensitive modifications (DBCO, FAM, BHQ1) was dissolved in 1 mL of Milli-Q water, irradiated at 365 nm for 15 minutes, and then passed through a pre-packed Sephadex G-25 column. The product was analyzed by mass spectrometry. The calculated mass was 29658.93. The measured mass was 29659.00. Photolysis was performed quantitatively and no decomposition products were detected.

[0724] Thus, this example demonstrates that the method of the present invention can be used to perform rapid deprotection of sensitive oligonucleotides without affecting the stability of such oligonucleotides.

[0725] Example 12: Purification of oligomers with complex modifications

[0726] The following experiments were performed to demonstrate the compatibility of the method of the present invention with various modifications.

[0727] Two complex 21-mer oligonucleotides (Compound 1 and Compound 2) with 5'-PC PO3 modification (as described in Example 1) were synthesized. The synthesis was performed at 1 μmol scale under standard conditions. Each oligonucleotide sequence contained multiple modifications, including multiple phosphorothioate bonds, 2'-fluoro bases, 2'-OMe bases, 2'-MOE bases, and multiple GalNac additions.

[0728] After cleavage and deprotection, the precipitate was purified by RPHPLC using 0.1 M TEAA at pH 7.5 in Luna 10 μm C8 (2) The oligonucleotides were purified on the LC column with a 30-70% gradient over 20 minutes. The collected oligonucleotides were desalted using a pre-packed Sephadex G-25 column. The products were analyzed by mass spectrometry and the results are shown in the table below.

[0729] Compound No. Calculated quality Measured quality Compound 1 9431.07 9431.9 Compound 2 7648.15 7649.0

[0730] The purified oligonucleotide compounds 1 and 2 were dissolved in 1 mL of Milli-Q water, irradiated at 365 nm for 50 minutes, and then passed through a pre-packed Sephadex G-25 column. The products were analyzed by mass spectrometry as shown in the table below. Photolysis was quantitative and no decomposition products were found.

[0731] Compound No. Calculated quality Measured quality Compound 1 9117.5 9117.88 Compound 2 7334.1 7334.16

[0732] This example therefore demonstrates that the method of the invention can be successfully applied to extremely complex and highly modified oligonucleotides.

Claims

1. A method for modifying a polynucleotide or an analog or derivative thereof, comprising: allowing a reactive functional group of the polynucleotide or an analog or derivative thereof to react with a phosphorus group R P Under reaction conditions, the polynucleotide or its analog or derivative is reacted with a compound of formula (I): in: -R H It is a hydrophobic group; -L 1 is a linking group; - It is a photolabile group; -R is a modifying group; - n is an integer selected from 0 and 1; and -R P is a phosphorus-based group; Thus, the hydrophobic group R H to a polynucleotide or an analog or derivative thereof.

2. The method according to claim 1, include: (i) the free hydroxyl group at the 5′ position of the polynucleotide or its analog or derivative is ligated to the phosphorus group R P reaction; or (ii) the free hydroxyl group at the 3′ position of the polynucleotide or its analog or derivative is ligated to the phosphorus group R P reaction.

3. The method according to claim 1 or claim 2, in: -R H Selected from C 1 To C 20 Alkyl, C 2 To C 20 Alkenyl, C 2 To C 20 Alkynyl, C 5 To C 10 Carbocyclic group, C 6 To C 18 aryl, 5- to 10-membered heteroaryl, and 5- to 10-membered heterocyclyl, wherein R H is optionally substituted; and / or -L 1 Selected from: (i) a chemical bond; and (ii) a C 1 To C 20 Alkylene, C 2 To C 20 Alkenylene and / or C 2 To C 20 The alkynylene linker, wherein the alkylene, alkenylene or alkynylene group is optionally interrupted and / or terminated by one or more groups selected from heteroatoms, phosphite groups, phosphate groups, carbonyl groups, C 6 To C 10 Aryl, C 5 To C 10 carbocyclyl, 5- to 10-membered heteroaryl, and 5- to 10-membered saturated or partially unsaturated heterocyclyl, wherein the linker is further optionally substituted; and / or -R P is a phosphoramidite, a phosphoramide, an alkylphosphinamide or an alkylphosphinamide; and / or -R is selected from: (i) a nucleoside or a derivative or analogue thereof; (ii) Contains C 1 To C 20 Alkylene, C 2 To C 20 Alkenylene and / or C 2 To C 20 wherein the alkylene, alkenylene or alkynylene group is optionally interrupted and / or terminated by one or more groups selected from the group consisting of: heteroatoms, phosphite groups, phosphate groups, carbonyl groups, C 6 To C 10 Aryl, C 5 To C 10 carbocyclyl, 5- to 10-membered heteroaryl, and 5- to 10-membered heterocyclyl; and wherein R is further optionally substituted; and (iii) a second polynucleotide or a derivative or analogue thereof.

4. The method according to any one of the preceding claims, in: -R H Selected from C 4 To C 16 Alkyl, C 4 To C 16 Alkenyl, C 4 To C 16 Alkynyl, C 5 To C 10 Carbocyclic and C 6 To C 10 Aryl, preferably C 5 To C 12 Alkyl; wherein R H is optionally substituted and preferably unsubstituted; and / or -L 1 To include C 1 To C 6 Alkylene, C 2 To C 6 Alkenylene and / or C 2 To C 6 an alkynylene linker, wherein the alkylene, alkenylene or alkynylene group is optionally interrupted and / or terminated by one or more groups selected from heteroatoms, carbonyl groups, phenyl groups, cyclopentyl or cyclohexyl groups, 5- to 6-membered heteroaryl groups and 5- to 6-membered saturated or partially unsaturated heterocyclic groups, wherein The linker is also optionally substituted; and / or -R P is a phosphoramidite or an alkylphosphinamide, preferably a phosphoramidite or a methylphosphinamide, more preferably 2-cyanoethyl-N,N-diisopropylphosphinamide or N,N-diisopropylmethylphosphinamide; and / or -R is selected from: (i) a nucleoside or a derivative or analogue thereof; (ii) Contains C 2 To C 6 Alkylene, C 2 To C 6 Alkenylene and / or C 2 To C 6 alkynylene radicals, wherein the alkylene, alkenylene or alkynylene radical is optionally interrupted and / or terminated by one or more radicals selected from heteroatoms, carbonyl, phenyl, cyclopentyl or cyclohexyl, 5- to 6-membered heteroaryl and 5- to 6-membered saturated or partially unsaturated heterocyclyl, wherein R is further optionally substituted; and (iii) a second polynucleotide or a derivative or analogue thereof.

5. The method of any one of the preceding claims, wherein the photolabile group For the formula - -CHR 3 -W- moiety, so that the compound of formula (I) is a compound of formula (II): Where R H , L 1 and R is as defined in any one of claims 1 to 4, and in: - is 2-nitrobenzyl, wherein the 2-nitrobenzyl is optionally substituted by 1, 2 or 3 groups independently selected from halogen, optionally substituted C 1 To C 4 Alkyl, -OR a 、-SR a 、-NR a R a 、-C(O)OR a 、-C(O)NR a R a 、-C(O)R b 、-OC(O)R b and -NHC(O)R b substituted with a group, wherein each R a are independently selected from hydrogen, optionally substituted C 1 To C 2 Alkyl and optionally substituted C 1 To C 2 Alkoxy and each R b are independently selected from hydrogen and optionally substituted C 1 To C 4 alkyl; -R 3 Methyl, ethyl or C 1 To C 2 haloalkyl; and -W is selected from a group of formula (W-2), an oxygen atom and a group of formula (W-1): in: -When n is 1, R P is phosphoramidite, phosphoramide, alkylphosphinamide or alkylphosphinamide; and when n is 0, R P Together with the oxygen atom to which it is attached, it forms a phosphoramidite, a phosphoramide, an alkylphosphinamide or an alkylphosphinamide; The phosphoramidite, phosphoramide, alkylphosphinamide or alkylphosphinamide is preferably phosphoramidite or methylphosphinamide, more preferably 2-cyanoethyl-N,N-diisopropylphosphinamide or N,N-diisopropylmethylphosphinamide; -Q is an oxygen atom or a sulfur atom; and -Each R 2 independently selected from hydrogen, methyl, ethyl, C 1 To C 2 Haloalkyl and halogen groups.

6. The method of claim 5, wherein W is a group of formula (W-2) and n is 0, so that the compound of formula (II) is a compound of formula (II-3): Where R H , L 1 , R 2 , R 3 and Q is as defined in any one of claims 1 to 5, and R P Together with the oxygen atom connected thereto, it forms an alkylphosphinamide, preferably methylphosphinamide, more preferably N,N-diisopropylmethylphosphinamide.

7. The method of claim 5, wherein W is an oxygen atom and n is 0, so that the compound of formula (II) is a compound of formula (II-1): Where R H , L 1 , and R 3 As defined in any one of claims 1 to 5, and wherein R P Together with the oxygen atom connected thereto, it forms a phosphoramidite, a phosphoramide, an alkylphosphinamide or an alkylphosphinamide; preferably phosphoramidite, more preferably 2-cyanoethyl-N,N-diisopropylphosphinamide.

8. The method of claim 5, wherein W is a group of formula (W-1) and n is 1, so that the compound of formula (II) is a compound of formula (II-2): Where R H , L 1 , R 2 , R 3 , Q and R are as defined in any one of claims 1 to 5, and wherein R P It is phosphoramidite, phosphoramide, alkylphosphinamide or alkylphosphinamide; preferably phosphoramidite, more preferably 2-cyanoethyl-N,N-diisopropylphosphoramidite.

9. The method of any one of claims 5 to 8, wherein L 1 and R H are collectively represented by formula (A-1) or formula (A-2): Where L 1 and R H As defined in any one of claims 1 to 4, and in: -R 4 , R 5 , R 6 and R 7 are each independently selected from hydrogen, halogen, optionally substituted C 1 To C 4 Alkyl, -OR a 、-SR a 、-NR a R a 、-C(O)OR a 、-C(O)NR a R a 、-C(O)R b 、-OC(O)R b and -NHC(O)R b , preferably R 4 , R 5 , R 6 and R 7 are each independently selected from hydrogen, fluorine, optionally substituted C 1 To C 4 Alkyl, -OR a 、-SR a 、-NR a R a 、-OC(O)R b and -NHC(O)R b , more preferably R 4 , R 5 , R 6 and R 7 Each is hydrogen or methoxy; wherein R a and R b As defined in claim 5.

10. A method for purifying a polynucleotide or an analog or derivative thereof, wherein include: (i) modifying a polynucleotide or an analog or derivative thereof in a reaction mixture according to the method of any one of claims 1 to 9, thereby increasing the hydrophobicity of the polynucleotide or an analog or derivative thereof; (ii) separating the modified polynucleotide or its analog or derivative from other components in the reaction mixture based on the hydrophobicity of the modified polynucleotide or its analog or derivative; as well as (iii) optionally removing the hydrophobic group from the modified polynucleotide or its analog or derivative by irradiating the modified polynucleotide, its analog or derivative with light, preferably by irradiating the modified polynucleotide, its analog or derivative with ultraviolet light having a wavelength of about 300 to about 500 nm.

11. The method of claim 10, wherein step (ii) comprises separating the modified polynucleotide or its analogs or derivatives from other components in the reaction mixture using a chromatographic purification technique, preferably high performance liquid chromatography, more preferably reverse phase high performance liquid chromatography.

12. Compounds of formula (I): Where R H , L 1 , R, n, and R P As defined in any one of claims 1 to 9.

13. A modified polynucleotide or a derivative or analog thereof, comprising a group of formula (I*): Where R H , L 1 , R and n are as defined in any one of claims 1 to 9, and in: -R P * is a phosphorus-based bond; and - The wavy line indicates the point of attachment to the polynucleotide or its derivative or analogue.

14. The modified polynucleotide or its derivative or analogue according to claim 13, in: -R P * is a phosphodiester bond, a phosphotriester bond, a phosphite triester bond, a phosphite diester bond, a phosphorothioate bond, a phosphorodithioate bond, an alkylphosphonate bond or an alkylphosphite bond, preferably a phosphite triester bond or an alkylphosphite bond, more preferably a phosphite triester bond or a methylphosphite bond; and / or - The group of formula (I*) is attached to the 3' position or 5' position of the polynucleotide or its analogue or derivative, preferably to the 5' position of the polynucleotide or its analogue or derivative.

15. Use of a compound of formula (I) as defined in any one of claims 1 to 9 for: (i) modifying a polynucleotide or a derivative or analogue thereof, optionally thereby increasing the hydrophobicity of the polynucleotide or a derivative or analogue thereof; or (ii) purifying a polynucleotide or a derivative or analogue thereof.

16. A polynucleotide or a derivative or analogue thereof obtainable by a method as defined in any one of claims 1 to 11.

Images