Application of sodium butyrate in preparation of medicine for preventing and treating hemorrhagic disease of grass carp

Abstract

The invention discloses an application of sodium butyrate in preparation of a medicine for preventing and treating hemorrhagic disease of grass carp, wherein the structural formula of the sodium butyrate is # imgabs0 #, the molecular formula is C4H7NaO2, and the CAS number is 156-54-7; the invention also provides a pharmaceutical composition, which comprises an effective dose of sodium butyrate as an active component, and also comprises a pharmaceutically acceptable carrier or excipient, the dosage forms comprise tablets, granules, powder, powder, suspension and oral liquid, and the concentration of sodium butyrate is 0.1-20mM. Cell experiments find that sodium butyrate can significantly inhibit the replication of grass carp reovirus in grass carp kidney cells and improve the expression of grass carp kidney cell immune genes, and prove that sodium butyrate has an efficient effect of inhibiting grass carp reovirus infection, and can be used for preparing a drug for treating grass carp reovirus infection. The compound has the advantages of being high in safety and wide in application prospect when being used for preparing the medicine for preventing and treating the grass carp hemorrhagic disease caused by the grass carp reovirus.

Description

Technical Field

[0001] The invention belongs to the technical field of aquaculture and virus prevention and control, relates to the application of sodium butyrate as an antiviral drug for aquatic animals, and specifically relates to the application of sodium butyrate in preparing a drug for preventing and treating grass carp hemorrhagic disease. Background Art

[0002] At present, the annual output of grass carp accounts for about 20% of the total freshwater aquaculture in my country. It is an important species of freshwater fish aquaculture in my country. It has good growth performance and high economic value. However, the outbreak of viral diseases has brought huge economic losses to my country's grass carp aquaculture industry. The viral disease is mainly caused by grass carp hemorrhagic disease caused by grass carp reovirus. When grass carp hemorrhagic disease breaks out, the mortality rate of farmed fish is high and the spread speed is very fast, which brings huge economic losses to my country's aquaculture industry and seriously affects the development of grass carp aquaculture industry. In addition, there is a lack of safe and effective prevention and control drugs and vaccines for grass carp hemorrhagic disease. At present, there is an urgent need to develop a broad-spectrum, efficient, safe, pollution-free and low-cost anti-grass carp reovirus drug.

[0003] Sodium butyrate is a short-chain fatty acid and a deacetylase inhibitor that can inhibit the activity of acetylase. It is also a healthy, safe, growth-promoting, low-cost feed additive for aquaculture, with advantages such as high safety, environmental friendliness, and low cost. However, there are no reports on the use of sodium butyrate to prevent and treat grass carp hemorrhagic disease. Summary of the invention

[0004] In order to solve the problems in the prior art of high incidence, rapid spread and lack of effective prevention and control measures of grass carp hemorrhagic disease in aquaculture, the purpose of the present invention is to provide the use of sodium butyrate in the preparation of a drug for preventing and treating grass carp hemorrhagic disease.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] The present invention provides the use of sodium butyrate in preparing a drug for preventing and treating grass carp hemorrhagic disease, wherein the structural formula of the sodium butyrate is The molecular formula is C 4 H 7 NaO 2 , CAS number is 156-54-7.

[0007] The present invention also provides a pharmaceutical composition for preventing and treating grass carp hemorrhagic disease, which comprises an effective dose of sodium butyrate as an active ingredient, and the structural formula of sodium butyrate is The molecular formula is C 4 H 7 NaO 2 , CAS number is 156-54-7.

[0008] Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient, and the dosage forms include tablets, granules, powders, granules, suspensions, and oral solutions.

[0009] Preferably, the concentration of sodium butyrate is 0.1-20 mM.

[0010] More preferably, the concentration of sodium butyrate is 0.5-10 mM.

[0011] Preferably, the sodium butyrate is in powder form, the mother liquor is first dissolved with PBS and then filtered through a 0.22 μm filter membrane, and the filtrate is frozen at -80°C for later use.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] Aiming at the problem that the outbreak of viral diseases in grass carp breeding causes the death of grass carp and economic losses, but there is still a lack of effective prevention and treatment methods, the present invention finds through cell experiments that sodium butyrate can effectively inhibit the replication of grass carp reovirus in grass carp kidney cells and increase the expression of immune genes, that is, sodium butyrate can effectively resist the infection of grass carp reovirus, increase the expression of immune genes, and inhibit the proliferation of grass carp reovirus, thereby achieving the effect of resisting grass carp reovirus, and the preparation of drugs for preventing and treating grass carp hemorrhagic disease caused by grass carp reovirus has the advantages of high safety and broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The cell viability of CIK cells was detected 30 hours after adding different concentrations of sodium butyrate to the culture medium in the example; among them: (a) 0 mM; (b) 0.5 mM; (c) 1 mM; (d) 2.5 mM; (e) 5 mM; (f) 10 mM.

[0015] Figure 2 This is the level of viral replication in cells infected with grass carp reovirus after sodium butyrate was added to the culture medium in the example.

[0016] Figure 3 The expression of CIK cell immune genes was detected after sodium butyrate was added to the culture medium in the example. DETAILED DESCRIPTION

[0017] The technical scheme of the present invention is further described below by way of examples. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other implementation methods obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0018] Example 1

[0019] This example verifies the inhibitory effect of sodium butyrate on grass carp reovirus infection through cell experiments, and the specific steps are as follows:

[0020] 1. Cell recovery and viral infection

[0021] The frozen CIK cells were taken out of liquid nitrogen, thawed quickly, centrifuged to remove the supernatant, resuspended in fresh sterile M199 culture medium containing 10% fetal bovine serum, and cultured in a 27°C incubator. The revived cells were passaged to the third generation and then spread into six-well plates. The next day, they were pretreated with different concentrations of sodium butyrate for 4 hours, added with GCRV virus, and placed in a 25°C incubator for infection. The virus was adsorbed for 1 hour, the supernatant was removed, and the cells were washed with PBS three times. Then, drug culture medium with the same original concentration was added, and the cells were cultured at 25°C for 24 hours. The supernatant and cell samples were collected using Trizol.

[0022] 2. Cell Viability Test

[0023] Using MuseTM Count and Viability Kit (Millipore), when CIK cells grew to 90%, the cell culture medium was replaced with maintenance medium containing different concentrations of sodium butyrate, and the cells were returned to the incubator at 27°C for 30 hours, and then samples were taken for analysis. The cell viability value exceeded 90%, indicating that the test drug was non-toxic.

[0024] 3. Immune gene testing

[0025] When the CIK cells grew to 90%, the cell culture medium was replaced with a maintenance medium containing sodium butyrate, and the cells were returned to the incubator at 27°C for 24 hours, and then samples were taken for analysis.

[0026] 4. RNA Extraction

[0027] (1) Add 100uL of chloroform to every 0.5mL of sample, mix thoroughly, and let stand for 5 minutes;

[0028] (2) Centrifugation at 12,000 rpm for 15 min at 4°C;

[0029] (3) Take the upper layer of liquid and mix it thoroughly with pre-cooled isopropanol in a ratio of 1:1 and let it stand for 10 minutes;

[0030] (4) Centrifugation at 12,000 rpm for 10 min at 4°C;

[0031] (5) Remove the supernatant and wash the precipitate with 75% enzyme-free ethanol;

[0032] (6) Centrifugation at 12,000 rpm for 10 min at 4°C;

[0033] (7) Completely remove the supernatant and open the lid to dry thoroughly;

[0034] (8) Dissolve the precipitate in DEPC water and measure the concentration.

[0035] 5. Reverse transcription

[0036] (1) Prepare the reaction solution on ice. The system is shown in Table 1:

[0037] Table 1

[0038] Reagents Usage Oligo dT Primer 1μL dNTP Mixture 1μL RNA 2μg <![CDATA[RNase free dH 2 The]]> Make up to 10 μL

[0039] (2) Incubate at 65°C for 5 min and cool on ice.

[0040] (3) Prepare the reaction solution, the system is shown in Table 2:

[0041] Table 2

[0042]

[0043]

[0044] (4) After mixing, centrifuge, incubate at 30°C for 10 min, incubate at 42°C for 60 min, incubate at 95°C for 5 min, and finally cool on ice.

[0045] 6. Fluorescence quantitative detection of target gene mRNA expression level

[0046] (1) Fluorescence quantitative primers:

[0047] GCRV-JX01-vp7F:CAAGACCATTCAAGACTC

[0048] GCRV-JX01-vp7R:TCACTCACTTCGACTAAT

[0049] GCRV-JX01-NS31 F:ACCCCTCTGACGACACCC

[0050] GCRV-JX01-NS31 R:GAGCCTGAAGCCAGCACA

[0051] Gc-IFN1 F: GTCAATGCTCTGCTTGCGAAT

[0052] Gc-IFN1 R: CAAGAAACTTCACCTGGTCCT

[0053] Gc-ISG15 F:GTCTGTCACCTCTTCATGCA

[0054] Gc-ISG15R:CAGGAGAGCAGAAATCACAC

[0055] Gc-IRF11 F:AAGCAGTGCTGAAGATTGTGGA

[0056] Gc-IRF11 R:GTAACCTGAAGATTCCATCGTC

[0057] Gc-IRF7F: CGCCTGTGTTCGTCACTCGT

[0058] Gc-IRF7R: GGTGGTTGGAAAGCGTATTGG

[0059] Gc-STAT1 b F:ATGAGCACTACAGCCGTCTCA

[0060] Gc-STAT1 bR:CTTGAAGTCGTATTCGTCTTGC

[0061] Gc-TNFαF: AAGTCATAGGTCGAGGTCAGGG

[0062] Gc-TNFαR:CGTTTTTCACCTTCAATTAGCAGA

[0063] Gc-β-actin F: GGATGAAATTGCCGCACTGG

[0064] Gc-β-actin-R: ACCGACCATGACGCCCTGATGT

[0065] (2) Fluorescence Quantification The reaction system was prepared according to the ratio shown in Table 3, and the reaction system was 25 μL:

[0066] Table 3

[0067] SYBR Premix Ex Taq 12.5μL Upstream primer 0.5μL Downstream primer 0.5μL cDNA 2μL <![CDATA[ddH 2 The]]> 9.5μL

[0068] (3) After the quantitative PCR program was completed, the data were processed and the significant differences were analyzed using Graphpad Prism software.

[0069] like Figure 1 As shown, after adding sodium butyrate at concentrations of 0 mM, 0.5 mM, 1 mM, 2.5 mM, 5 mM, and 10 mM to the culture medium, the cell viability of CIK was detected 30 hours later, and it was found that the cell activity was all above 90%, indicating that sodium butyrate is safe and non-toxic.

[0070] like Figure 2 As shown, 0.5-10 mM sodium butyrate treatment can significantly inhibit the replication of GCRV-JX01 in CIK cells.

[0071] like Figure 3 As shown, the expression of immune genes in CIK cells was detected after adding sodium butyrate, and it was found that sodium butyrate treatment could significantly increase the expression of immune genes.

[0072] In summary, the present invention discovered for the first time through cell experiments that sodium butyrate can inhibit grass carp reovirus and has a good anti-GCRV virus effect. Because of its low raw material cost, it is friendly to fish growth, green and safe, and has little environmental pollution, it meets the current aquaculture industry's demand for green fish medicine.

[0073] The above are only preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. The use of sodium butyrate in the preparation of a drug for preventing and treating grass carp hemorrhagic disease, wherein the structural formula of sodium butyrate is The molecular formula is C4H7NaO2 and the CAS number is 156-54-7.

2. A pharmaceutical composition for preventing and treating grass carp hemorrhagic disease, characterized in that: It includes an effective dose of sodium butyrate as an active ingredient, wherein the structural formula of the sodium butyrate is The molecular formula is C4H7NaO2 and the CAS number is 156-54-7.

3. The pharmaceutical composition for preventing and treating grass carp hemorrhagic disease according to claim 2, characterized in that: The pharmaceutical composition also includes a pharmaceutically acceptable carrier or excipient, and the dosage forms include tablets, granules, powders, granules, suspensions, and oral solutions.

4. The pharmaceutical composition for preventing and treating grass carp hemorrhagic disease according to claim 2, characterized in that: The concentration of sodium butyrate was 0.1-20 mM.

5. The pharmaceutical composition for preventing and treating grass carp hemorrhagic disease according to claim 4, characterized in that: The concentration of sodium butyrate is 0.5-10 mM.

6. The pharmaceutical composition for preventing and treating grass carp hemorrhagic disease according to claim 2, characterized in that: The sodium butyrate is in powder form. The mother solution is first dissolved with PBS and then filtered through a 0.22 μm filter membrane. The filtrate is frozen at -80°C for later use.

Images