Recombinant engineering bacterium for producing aromatic amino acid as well as construction method and application of recombinant engineering bacterium

Abstract

The invention relates to a recombinant microorganism for producing 3-dehydroshikimic acid (DHS) as well as a construction method and application of the recombinant microorganism. The recombinant microorganism is obtained by enhancing the enzymatic activity of a DNA (Deoxyribose Nucleic Acid) combined transcription dual-regulation factor SoxS and / or the expression level of a coding gene of the DNA combined transcription dual-regulation factor SoxS, or enhancing the enzymatic activity of a DNA combined transcription dual-regulation factor MarA and / or the expression level of a coding gene of the DNA combined transcription dual-regulation factor MarA, so that the yield and the conversion rate of DHS are effectively improved; therefore, the fermentation period is shortened under the condition of a simple fermentation culture medium, and the production cost of DHS is reduced.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a recombinant microorganism for producing 3-dehydroshikimic acid and a construction method thereof, as well as application of the recombinant microorganism in preparing 3-dehydroshikimic acid. Background Art

[0002] 3-dehydroshikimate (DHS) is an important intermediate in the biosynthesis metabolic pathway of aromatic amino acids in microorganisms and plants, and plays an important role in maintaining the normal development of organisms and completing metabolic processes. DHS can be further catalyzed to form shikimate and its aromatic amino acids and derivatives, as well as a series of important chemical products such as protocatechuate, vanillin, catechol, gallate, adipic acid, and salicylic acid. The use of 3-dehydroshikimate to synthesize these chemical products can avoid the use of toxic raw materials such as benzene and toluene, and reduce the impact on human body and environment. At the same time, 3-dehydroshikimate is also a very effective antioxidant, and its activity is even better than some commercial antioxidants such as gallic acid, propyl gallate, hydroquinone (BHQ), butylated hydroxytoluene (BHT), and tocopherol (α-tocopherol), and has important application value. In addition, DHS, as a small molecule chiral compound, can also be used as a very potential synthetic intermediate in drug synthesis. Therefore, studying the production of DHS has important application prospects.

[0003] At present, the most important literature reporting on the production of DHS using microorganisms are the following three prior art documents.

[0004] Prior art literature (Jian Yi et al., Altered Glucose Transport and Shikimate Pathway Product Yields in E. coli, BIOTECHNOLOGY PROGRESS, 2003; 19 (5): 1450-1459.) used a plasmid expression system to overexpress tktA / glf / glk / aroF / aroB in E. coli AB2834 with aroE mutation, and the DHS yield in a 5L fermenter was 69 g / L. The fermentation medium in the aforementioned fermentation process contained the following components: 7.5 g / L of dipotassium hydrogen phosphate, 0.3 g / L of ammonium ferric citrate, 2.1 g / L of citric acid monohydrate, aromatic amino acids and vitamins, trace elements and glucose. It increases the supply of DHS precursor E4P by overexpressing tktA, increases the supply of another DHS precursor PEP by replacing the PTS system with glf / glk, blocks DHS degradation by mutating aroE (maintaining growth by adding complex culture medium components) and overexpresses aroF fbr / aroB strengthens the DHS synthesis pathway.

[0005] However, the technical solution of the prior art document 1 has the following defects: (1) The fermentation medium has complex components (it is necessary to add a variety of essential components such as aromatic amino acids and vitamins): when aroE is mutated in Escherichia coli (equivalent to knocking out aroE), the cells cannot grow normally because they cannot synthesize the aromatic amino acids necessary for growth, and it is necessary to add complex nutrients to maintain cell growth; (2) The fermentation process is cumbersome: due to the need to add additional aromatic amino acids and vitamins, filtration and sterilization operations are required; (3) Genetic instability and increased cell metabolic burden: when the plasmid system overexpresses related genes, the cells will not only maintain normal growth but also bear the metabolic burden brought by the plasmid system; (4) The DHS yield and conversion rate are not high: due to the complexity and rigidity of the intracellular metabolic network, the use of the plasmid system to overexpress related genes will not fully perturb the metabolic network to favor the biosynthesis of DHS, which will result in only a portion of the carbon source-glucose flowing into the DHS synthesis pathway; (5) The production cost is high: a large amount of aromatic amino acids and trace elements need to be added, and the DHS yield and conversion rate are low.

[0006] The prior art document (Cell Factory Design and Culture Process Optimization for Dehydroshikimate Biosynthesis in Escherichia coli, Si-Sun Choiet.al., Front.Bioeng.Biotechnol., 2019; 7: 241-252.) discloses that tyrR / ptsG / pykA were knocked out successively in E. coli AB2834 in which aroE was knocked out, and aroB / aroD / ppsA / galP / aroG / aroF were overexpressed at the genomic level. The yield reached the highest level of 117 g / L reported in the literature after fermentation for 120 hours in a 7L fermenter. The fermentation medium in the aforementioned fermentation process comprises the following components: 30 g / L glucose, 10 g / L glycerol, 15.75 g / L yeast extract, 21.375 g / L tryptone, 5.25 g / L potassium dihydrogen phosphate, 1 g / L magnesium sulfate heptahydrate, 0.8 g / L citric acid, 1 mL / L trace elements and 200 μg / L thiamine hydrochloride. The fermentation medium in the aforementioned fermentation process comprises the following components: 600 g / L glucose, 100 g / L yeast extract, 20 g / L magnesium sulfate heptahydrate, and trace elements, and the conversion rate is 0.39 g / g glucose. It increases the supply of DHS precursor PEP by replacing the PTS system with glf / glk, overexpressing ppsA, knocking out pykA, blocking DHS degradation by knocking out aroE (maintaining growth by adding complex medium components), and strengthening the DHS synthesis pathway by overexpressing aroF / aroG / aroB / aroD.

[0007] Although the technical solution of the prior art document has achieved good results in metabolic engineering, it does not explore the effect of oxygen stress level on DHS biosynthesis: (1) Since DHS itself has extremely strong antioxidant properties, will it cause changes in oxygen stress level during the scale-up fermentation process and affect DHS synthesis? (2) Will the reduction of oxygen stress level promote the efficient synthesis of DHS?

[0008] The technical solution disclosed in the prior art document (CN 107619817A) includes expressing aroE in E. coli ATCC8739 using a hybrid promoter element (P1) (rather than knocking it out to avoid adding complex medium components to the fermentation medium), knocking out tyrR / ptsI, regulating aroF fbrExpression (P2) overexpression of tktA (P3), combined regulation of the expression of the background gene glk / galP in the large intestine, weakening the expression of pykF / pykA / pgi (P1), achieved a production of 94.4 g / L in Escherichia coli in a simple inorganic salt fermentation medium for 52 hours, and a conversion rate of 32.65% M / M. It increased the supply of DHS precursor PEP by replacing the PTS system with glf / glk and weakening pykA / pykF at the same time, increased the supply of DHS precursor E4P by overexpressing tktA in the genome, accumulated DHS by weakening aroE while maintaining cell growth, and regulated aroF fbr Expression enhanced DHS synthesis pathway.

[0009] However, CN 107619817A also did not explore the effect of oxygen stress levels on the efficient synthesis of DHS.

[0010] In summary, although the technical solutions disclosed in the above-mentioned prior art documents can produce DHS, the effect of oxygen stress level on the efficient synthesis of DHS is not explored. Summary of the invention

[0011] In view of the problems existing in the prior art, the present invention provides a new strain capable of producing 3-dehydroshikimic acid and its construction method and application. The present invention deeply excavates and explains the influence of the change of oxygen stress level caused by the DHS synthesis process on the efficient synthesis of DHS through transcriptomics, and improves the DHS production level by reducing the oxygen stress level through metabolic engineering.

[0012] The present invention provides the following technical solutions.

[0013] The present invention provides a recombinant microorganism for producing 3-dehydroshikimic acid, which has the following characteristics compared with the starting strain: enhanced enzyme activity of DNA-binding transcription dual regulatory factor SoxS and / or the expression level of its encoding gene; or enhanced enzyme activity of DNA-binding transcription dual regulatory factor MarA and / or the expression level of its encoding gene.

[0014] Preferably, in the starting strain, the regulatory element P3 is inserted upstream of the enzyme translation start codon of the starting DNA binding transcription dual regulatory factor SoxS to enhance the enzyme activity of the DNA binding transcription dual regulatory factor SoxS and / or the expression level of its encoding gene; or the regulatory element P3 is inserted upstream of the enzyme translation start codon of the starting DNA binding transcription dual regulatory factor MarA to enhance the enzyme activity of the DNA binding transcription dual regulatory factor MarA and / or the expression level of its encoding gene;

[0015] Wherein, the sequence of the regulatory element P3 is shown as SEQ ID NO:1.

[0016] More preferably, the starting strain is Escherichia coli for producing 3-dehydroshikimic acid.

[0017] The present invention also provides a method for preparing a recombinant microorganism for producing 3-dehydroshikimic acid, which comprises the following steps:

[0018] The step of enhancing the enzyme activity of the DNA-binding transcription dual regulatory factor SoxS and / or the expression level of its encoding gene; or the step of enhancing the enzyme activity of the DNA-binding transcription dual regulatory factor MarA and / or the expression level of its encoding gene.

[0019] Preferably, in the starting strain, a regulatory element P3 or a promoter stronger than the endogenous promoter is inserted upstream of the enzyme translation start codon of the starting DNA binding transcription dual regulatory factor SoxS to enhance the enzyme activity of the DNA binding transcription dual regulatory factor SoxS and / or the expression level of its encoding gene; or a regulatory element P3 or a promoter stronger than the endogenous promoter is inserted upstream of the enzyme translation start codon of the starting DNA binding transcription dual regulatory factor MarA to enhance the enzyme activity of the DNA binding transcription dual regulatory factor MarA and / or the expression level of its encoding gene;

[0020] Wherein, the sequence of the regulatory element P3 is shown in SEQ ID NO: 1;

[0021] The starting strain is Escherichia coli for producing 3-dehydroshikimic acid.

[0022] The present invention also provides the use of the recombinant microorganism in producing 3-dehydroshikimic acid.

[0023] The present invention further provides a method for producing 3-dehydroshikimic acid, which comprises the steps of using glucose as a substrate and performing a fermentation reaction using the recombinant microorganism.

[0024] Optionally, the method further comprises the step of adding yeast extract to the culture medium.

[0025] Optionally, the method further comprises the step of separating 3-dehydroshikimic acid from the fermentation reaction liquid after the fermentation reaction is completed.

[0026] In a specific embodiment, the method further comprises the step of separating 3-dehydroshikimic acid from the fermentation reaction liquid after the fermentation reaction is completed.

[0027] The invention increases the expression of DNA binding transcription dual regulatory factor SoxS, thereby reducing the intracellular oxygen stress level, and the prepared strain effectively increases the yield of DHS. By increasing the expression of DNA binding transcription dual regulatory factor MarA, thereby reducing the intracellular oxygen stress level, the prepared strain effectively increases the yield of DHS. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The figure shows the changes in the transcription levels of SoxS and MarA in DHS engineered bacteria compared with the wild type. Figure 1 The meanings of the compounds, enzymes or genes encoding the aforementioned enzymes involved are as follows: soxS: a gene encoding the DNA-binding transcription dual regulatory factor SoxS enzyme (GenBank ID: 948567); marA: a gene encoding the DNA-binding transcription dual regulatory factor MarA enzyme (GenBank ID: 947613).

[0029] Figure 2 Shown are the effects of single knockout of SoxS and MarA on cellular oxidative stress levels.

[0030] Figure 3 The fermentation results of strains GT49, AA78, AA79, AA80 and AA81 by shake flask fermentation are shown. DETAILED DESCRIPTION

[0031] definition

[0032] When used in conjunction with the term "comprising" in the claims and / or the specification, the word "a" or "an" can mean "one", but can also mean "one or more", "at least one" and "one or more than one".

[0033] As used in the claims and description, the words "comprising," "having," "including," or "containing" are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0034] Throughout this application, the term "about" indicates that a value includes the standard deviation of error for the device or method being employed to determine the value.

[0035] Although the disclosure supports a definition of the term "or" as only alternatives as well as "and / or," the term "or" in the claims means "and / or" unless explicitly stated as only alternatives or the alternatives are mutually exclusive.

[0036] When used in the claims or specification, a selected / optional / preferred "numerical range" includes both the numerical endpoints at both ends of the range and all natural numbers covered between the numerical endpoints relative to the aforementioned numerical endpoints.

[0037] As used herein, the term "converting" refers to a chemical transformation from one molecule to another molecule catalyzed primarily by one or more polypeptides (enzymes), although other organic or inorganic catalysts may be used; it may also refer to the ratio (in %) between the molar amount of the desired product and the molar amount of the limiting substrate.

[0038] As used in the present invention, the terms "polypeptide", "enzyme", "polypeptide or enzyme", "polypeptide / enzyme", and "protein" have the same meaning and can be used interchangeably in the present invention. The aforementioned terms refer to a polymer composed of a plurality of amino acids through peptide bonds, and the polymer can be formed by amino acids of any length, which may or may not contain modifications such as phosphate groups and formyl groups.

[0039] As used in the present invention, the term "gene expression cassette" is a recombinant expression element comprising a target gene and a regulatory element that regulates the expression of the target gene. In some embodiments, the target gene is a coding gene for a target polypeptide. In some embodiments, the regulatory element is a promoter element for initiating transcription of the coding gene. In some embodiments, the regulatory element may also include enhancers, silencers, insulators and other elements.

[0040] As used herein, the term "expression" includes any step involved in RNA production and protein production, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification and secretion.

[0041] As used in the present invention, the term "promoter" refers to a nucleic acid molecule that is usually located upstream of the target gene coding sequence, provides a recognition site for RNA polymerase, and is located upstream of the 5' direction of the mRNA transcription start site. It is a non-translated nucleic acid sequence, and RNA polymerase initiates the transcription of the target gene after binding to this nucleic acid sequence. In the synthesis of ribonucleic acid (RNA), the promoter can interact with the transcription factors that regulate gene transcription, control the start time and degree of gene expression (transcription), and contains the core promoter region and the regulatory region, just like a "switch", which determines the activity of the gene and then controls which protein the cell starts to produce.

[0042] According to the level of transcription controlled, promoters can be divided into strong promoters and weak promoters. Strong promoters include but are not limited to the P3 promoter used in the present invention, and T7 promoters and other strong promoters known in the prior art.

[0043] As used in the present invention, the term "microorganism" is a general term for microorganisms that are difficult to observe with the naked eye, including bacteria, fungi, etc. Due to the large surface area to volume ratio of microorganisms, they can quickly exchange substances with the external environment and produce metabolites. The microorganisms in the present invention specifically refer to fermentation microorganisms that can ferment and culture to produce metabolites such as proteins, carbohydrates, lipids, amino acids, and nucleotides.

[0044] As used in the present invention, the term "recombinant microorganism" is a modified microorganism obtained by recombining by genetic engineering methods. The implementation scheme includes, but is not limited to, introducing recombinant genes, knocking out and knocking down the endogenous genes of microorganisms. Among them, the term "recombinant gene" is a gene that is not naturally present, and the recombinant gene includes a protein coding sequence that is operably connected to an expression control sequence. The implementation scheme includes, but is not limited to, introducing exogenous genes into microorganisms, endogenous protein coding sequences that are operably connected to exogenous promoters, and genes with modified protein coding sequences. The recombinant gene is stored in the genome of the microorganism, a free plasmid in the microorganism, or a bacteriophage in the microorganism.

[0045] In some embodiments, the reduced or disappeared protein activity, reduced or disappeared expression level of protein-coding genes, reduced or disappeared enzyme activity, reduced or disappeared expression level of enzyme-coding genes in recombinant microorganisms include recombinant microorganisms transformed by the following genetic engineering methods: introducing weak promoters and weak ribosome binding sites into the cells of microorganisms, knocking out or knocking down protein- and enzyme-coding genes, and inserting random fragments into protein- and enzyme-coding genes to inactivate the activity of proteins and enzymes.

[0046] In some embodiments, the enhanced protein activity, enhanced expression level of protein-coding genes, enhanced enzyme activity, and enhanced expression level of enzyme-coding genes in recombinant microorganisms include recombinant microorganisms transformed by the following genetic engineering methods: introducing strong promoters and strong ribosome binding sites into the cells of the microorganisms, introducing non-integrated recombinant expression vectors of proteins and enzymes, and introducing chromosomally integrated recombinant expression vectors of proteins and enzymes.

[0047] As used in the present invention, the term "starting strain" is the previous strain selected for use in the subsequent genetic engineering modification step. In other words, the "starting strain" refers to the control strain before each modification step. Exemplary, for example, the AA78 strain is constructed by knocking out SoxS expression using GT49 as the starting strain.

[0048] As used in the present invention, the term "wild-type microorganism" refers to an original microorganism that has not undergone any gene editing.

[0049] In a specific embodiment, the GT49 strain used in the present invention has a preservation number of CGMCC No. 24671, is classified and named Escherichia coli, and was deposited in the General Microbiology Center of China National Microbiological Culture Collection Administration on April 12, 2022 (address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Postal Code 100101).

[0050] In a specific embodiment, the GT60 strain used in the present invention has a preservation number of CGMCC No. 22070, is classified and named Escherichia coli, and was deposited in the General Microbiology Center of China National Culture Collection Administration on March 25, 2021 (address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Postal Code 100101).

[0051] As used in the present invention, the term "operably linked" refers to the following configuration: a regulatory sequence is placed in an appropriate position relative to a coding sequence of a polynucleotide so that the regulatory sequence directs the expression of the coding sequence. Exemplarily, the regulatory sequence can be selected from sequences encoded by a promoter and / or an enhancer.

[0052] As used herein, the term "endogenous" refers to a polynucleotide, polypeptide, or other compound that is naturally expressed or produced in an organism or cell. That is, an endogenous polynucleotide, polypeptide, or other compound is not exogenous. For example, an "endogenous" polynucleotide or polypeptide is present in a cell when the cell is initially isolated from nature.

[0053] As used herein, the term "exogenous" refers to any polynucleotide or polypeptide that is naturally found or expressed in a particular cell or organism in which expression is desired. An exogenous polynucleotide, polypeptide or other compound is not endogenous.

[0054] As used in the present invention, the term "amino acid mutation" or "nucleotide mutation" includes "substitution, duplication, deletion or addition of one or more amino acids or nucleotides". In the present invention, the term "mutation" refers to a change in a nucleotide sequence or an amino acid sequence. In a specific embodiment, the term "mutation" refers to "substitution".

[0055] In one embodiment, the "mutation" of the present invention can be selected from "conservative mutations". In the present invention, the term "conservative mutation" refers to a mutation that can normally maintain the function of a protein. A representative example of a conservative mutation is a conservative substitution.

[0056] As used herein, the term "conservative substitution" refers to replacing an amino acid residue with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art and include those having basic side chains (e.g., lysine, arginine, and histidine), acidic side chains (e.g., aspartic acid and glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan), β-branched chains (e.g., threonine, valine, and isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, and histidine). As used herein, "conservative substitution" typically exchanges an amino acid at one or more sites in a protein. Such substitutions may be conservative. As substitutions considered as conservative substitutions, in addition, conservative mutations also include naturally occurring mutations resulting from individual differences, strains, species differences, etc. from which the gene is derived.

[0057] As used in the present invention, the term "polynucleotide" refers to a polymer composed of nucleotides. A polynucleotide can be in the form of a separate fragment or a component of a larger nucleotide sequence structure, which is derived from a nucleotide sequence separated at least once in quantity or concentration, and can be identified, manipulated, and recovered by standard molecular biology methods (e.g., using a cloning vector) and its component nucleotide sequences. When a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C), in which "U" replaces "T". In other words, "polynucleotide" refers to a nucleotide polymer removed from other nucleotides (separate fragments or entire fragments), or can be a component or ingredient of a larger nucleotide structure, such as an expression vector or a polycistronic sequence. Polynucleotides include DNA, RNA, and cDNA sequences. "Recombinant polynucleotide" is one of the "polynucleotides".

[0058] As used herein, the term "vector" refers to a DNA construct containing a DNA sequence operably linked to an appropriate control sequence to express a target gene in a suitable host. "Recombinant expression vector" refers to a DNA structure used to express, for example, a polynucleotide encoding a desired polypeptide. A recombinant expression vector may include, for example, a collection of genetic elements that regulate gene expression, such as promoters and enhancers; ii) a structural or coding sequence that is transcribed into mRNA and translated into a protein; and iii) a transcription subunit that is suitable for transcription and translation initiation and termination sequences. The recombinant expression vector is constructed in any suitable manner. The nature of the vector is not important, and any vector may be used, including plasmids, viruses, phages, and transposons. Possible vectors for use in the present invention include, but are not limited to, chromosomal, non-chromosomal, and synthetic DNA sequences, such as bacterial plasmids, phage DNA, yeast plasmids, and vectors derived from a combination of plasmids and phage DNA, DNA from viruses such as vaccinia, adenovirus, fowlpox, baculovirus, SV40, and pseudorabies.

[0059] As used herein, the term "transduction" has the meaning generally understood by those skilled in the art, i.e., the process of introducing exogenous DNA into a host. The transformation method includes any method for introducing nucleic acid into a cell, including but not limited to electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0060] The cultivation of the recombinant microorganism of the present invention can be carried out according to conventional methods in the art, including but not limited to well plate culture, shake flask culture, batch culture, continuous culture and batch fed culture, and various culture conditions such as temperature, time and pH value of the culture medium can be appropriately adjusted according to actual conditions.

[0061] Unless defined otherwise or clearly indicated by the context, all technical and scientific terms in the present invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0062] Example

[0063] Other objects, features and advantages of the present invention will become apparent from the following detailed description. However, it should be understood that the detailed description and specific examples (although representing specific embodiments of the present invention) are given for illustrative purposes only, because after reading the detailed description, various changes and modifications made within the spirit and scope of the present invention will become apparent to those skilled in the art.

[0064] The experimental techniques and experimental methods used in this example are all conventional technical methods unless otherwise specified. For example, the experimental methods in the following examples that do not specify specific conditions are usually carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. The materials, reagents, etc. used in the examples can be obtained through regular commercial channels unless otherwise specified.

[0065] In the present invention, the sequence of relevant elements is as follows:

[0066] The nucleic acid sequence of the P3 element is as follows:

[0067] TTATCTCTGGCGGTGTTGACAAGAGATAACAACGTTGATATAATTGAGCCCGTATTGTTAGCATGTACGTTTAAACCAGGAAACAGCT (SEQ ID NO: 1).

[0068] Example 1: Transcriptome determination method of recombinant E. coli strain GT60 (deposit number CGMCC No. 22070, see Chinese patent application CN116254281A) and wild-type strain E. coli ATCC 8739

[0069] In order to determine the transcriptome of the recombinant Escherichia coli strain GT60 and the wild-type strain E. coli ATCC 8739, the two strains were fermented in 5-L fermenters, and the samples in the logarithmic phase were centrifuged, freeze-dried with liquid nitrogen, and sent to Beijing Novogene Co., Ltd. for transcriptome determination and analysis.

[0070] Scale-up fermentation medium components:

[0071] The primary seed culture medium is LB medium containing 0.5% glucose and consists of the following components:

[0072] Glucose 5g / L, yeast extract 5g / L, trypsin 10g / L, sodium chloride (NaCl) 10g / L.

[0073] The secondary seed medium is LB medium containing 2% glucose and consists of the following components:

[0074] Glucose 20g / L, yeast extract 5g / L, trypsin 10g / L, sodium chloride (NaCl) 10g / L.

[0075] The initial fermentation tank medium is an inorganic salt fermentation medium, which consists of the following components:

[0076] Macroelements: starting glucose 20 g / L, citric acid 2 g / L, KH2PO4 7.5 g / L, (NH4)2SO4 1.6 g / L, MgSO4·7H2O 2 g / L; and

[0077] Trace elements: FeSO4·7H2O 75mg / L, MnSO4·H2O 4.5mg / L, Na2SO4 20mg / L, ZnSO4 6mg / L, CoCl2·6H2O4mg / L, CuSO4·5H2O 0.6mg / L.

[0078] Scale-up fermentation method:

[0079] (1) Primary seed culture: 3 mL of primary seed culture medium was placed in a 15 mL test tube and sterilized at 121°C for 15 minutes. After cooling, a single colony of genetically engineered E. coli WJ060 was inoculated into 3 mL of seed culture medium and cultured overnight at 30°C and 250 rpm in a shaking incubator for 16 hours for inoculation of the secondary seed culture medium.

[0080] (2) Secondary seed culture: 200 mL of secondary seed culture medium was sterilized at 121°C for 15 minutes in a 1L shake flask. After cooling, 2 mL of primary seed culture solution was inoculated into 200 mL of secondary seed culture medium and cultured in a shaker at 37°C and 250 rpm for 24 hours for inoculation of fermenter culture medium.

[0081] (3) Fermentation production by feeding in a fermenter: 200 mL of the above-mentioned secondary seed bacterial liquid was inoculated into a 5L Biotech-5BG fermenter (Shanghai Baoxing Bio-Equipment Engineering Co., Ltd.) containing 2L of initial fermenter medium, and fermented at 37°C, pH 6.5 (pH regulated by concentrated ammonia water), and 20% dissolved oxygen. After fermentation began, when the glucose concentration in the fermenter dropped below 1 g / L, feeding with a glucose solution of 500 g / L was started, and the feeding rate was controlled so that the glucose concentration in the fermenter was less than 1 g / L.

[0082] (4) After fermentation was expanded to the logarithmic phase, 40 mL of the fermentation broth was centrifuged (5000 rpm, 4°C, 5 min), the supernatant was discarded, and the cells were resuspended in PBS and centrifuged again (5000 rpm, 4°C, 5 min) to collect the cells.

[0083] (5) The collected bacteria were quickly freeze-dried in liquid nitrogen, and the samples were placed in dry ice and sent to Beijing Novogene Co., Ltd. for transcriptome determination and analysis.

[0084] Results: The transcriptome detection results of strains E. coli ATCC 8739 and GT60 were as follows Figure 1 shown.

[0085] Specifically: Through transcriptome analysis of the control group strain E. coli ATCC 8739 and the experimental group strain GT60, we found that compared with the control group, the two transcription factors soxS and marA that responded to oxygen stress levels were upregulated by 4.3 times and 2.7 times, respectively. Therefore, we speculate that because DHS has extremely strong antioxidant activity, in the process of accumulating a large amount of DHS, cells respond to the increased intracellular ROS levels by activating oxygen stress transcription factors to disturb the intracellular metabolic network of the bacteria. This result indicates that transcription factors that respond to ROS levels may affect the efficient synthesis of DHS.

[0086] Example 2: Construction of recombinant E. coli strains AA78, AA79, AA80 and AA81

[0087] The chloramphenicol resistance gene cat and the fructan sucrose transferase gene sacB (cat-sacB box, whose nucleic acid sequence is shown in SEQ ID NO: 2) were inserted into the soxS (GenBank ID: 948567) and marA (GenBank ID: 947613) loci of the GT49 genome by λ-red homologous recombination to replace the CDS of the soxS and marA genes, thereby knocking out soxS and marA and successfully constructing the AA78 and AA79 strains.

[0088] 1. Preparation method of recombinant Escherichia coli strain AA78:

[0089] The plasmid pEASY-cat-sacB containing the chloramphenicol resistance gene cat and the fructan sacose transferase gene sacB (cat-sacB box, the nucleic acid sequence of which is shown in SEQ ID NO: 2) was used as a template, and the first step homologous recombination fragment soxS1 was amplified using primer pair 1 (soxS1-up / soxS1-down). The sequence of primer pair 1 is:

[0090] soxS1-up (forward primer):

[0091] CTTGAGGAATTATACTCCCCAACAGATGAATTAACGAACTGAACACTGAAAAGAGGCTGGTGTCCCTGTTGATACC (SEQ ID NO: 3)

[0092] soxS1-down (reverse primer):

[0093] CAGGTGTTTATGCAATGGATGGAGCAATTACCCGCGCGGGAGTTAACGCGCGGGCAACATCAGAGCTTTTACGAG (SEQ ID NO: 4)

[0094] The specific sequence of the cat-sacB cassette is as follows (SEQ ID NO: 2):

[0095]

[0096] Amplification system: 5×TransStart TM FastPfu Buffer 10μL, dNTPs (2.5mmol / L each dNTP) 4μL, DNA template 1μL (20-50ng), forward primer (10μmol / L) 2μL, reverse primer (10μmol / L) 2μL, 100% DMSO 1μL, TransStart TM 1 μL FastPfu DNA Polymerase (2.5U / μL), 29 μL deionized water, total volume 50 μL.

[0097] The amplification conditions were: 94°C pre-denaturation for 5 minutes (1 cycle); 95°C denaturation for 20 seconds, 55°C annealing for 30 seconds, 72°C extension for 3 minutes (30 cycles); 72°C extension for 5 minutes (1 cycle). The amplified soxS1 product contained the cat-sacB box and the 63 base sequences upstream of the soxS start codon and the 62 base sequences downstream of the soxS stop codon at both ends.

[0098] The soxS1 amplification product was introduced into Escherichia coli GT49 containing pKD46 plasmid by electroporation and then homologous recombination was performed to replace the CDS region of soxS with the cat-sacB box. The specific process is as follows: Escherichia coli GT49 (CGMCC No. 24671, Chinese patent application CN116254281A)) and plasmid pKD46 were preserved in our laboratory; pKD46 plasmid can be found in non-patent literature Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci US A. 2000, 97 (12): 6640-6645).

[0099] The soxS1 fragment was electroporated into E. coli GT49 containing pKD46. The electroporation conditions were as follows: first, prepare electroporation competent cells of E. coli GT49 containing pKD46; place 50 μL competent cells on ice, add 50-100 ng soxS1 fragment, place on ice for 2 minutes, and transfer to a 0.2 cm Bio-Rad electroporation cup. Use MicroPulser (Bio-Rad) electroporator with an electroporation voltage of 2.5 kV. After electroporation, quickly transfer 1 mL of LB liquid culture medium to the electroporation cup, mix it with a pipette for about 5 times, and then transfer it to a 15 mL test tube, and place it in a shaker at 30°C and 100 rpm for incubation for 2 hours. Take 200 μL of the incubated bacterial solution and spread it on LB solid culture medium containing chloramphenicol and ampicillin, and culture it at 30°C until a single colony is visible to the naked eye, and pick a single colony for colony PCR amplification and DNA sequencing verification. PCR amplification and DNA sequencing primer pair 2 are:

[0100] soxS-up (forward primer): CCAATACATCCGTCCAGTTCG (SEQ ID NO: 5)

[0101] soxS-down (reverse primer): CCTCCGATTTTCATACGTCAC (SEQ ID NO: 6)

[0102] A correct single colony was picked and named Escherichia coli AA78 (containing pKD46).

[0103] 2. Preparation method of recombinant Escherichia coli strain AA79:

[0104] The plasmid pEASY-cat-sacB containing the chloramphenicol resistance gene cat and the fructan sacose transferase gene sacB (cat-sacB box, the nucleic acid sequence of which is shown in SEQ ID NO: 10) was used as a template, and the first step homologous recombination fragment marA1 was amplified using primer pair 3 (marA1-up / marA1-down). The sequence of primer pair 3 is:

[0105] marA1-up (forward primer):

[0106] GGCAACACTTGAGCATTTGCTTAAGAAAGTCCTGCCGTAAACAAAAAAGAGGTATGACGTGGTGTCCCTGTTGATACC (SEQ ID NO: 7).

[0107] marA1-down (reverse primer):

[0108] CTGCTATTGCGGATGAAAGTGGTTTCCATGATTGCCTCAGTGACGTTGTCACGTTATCAAACATCAGAGCTTTTACGAG (SEQ ID NO: 8).

[0109] Amplification system: 5×TransStart TM FastPfu Buffer 10μL, dNTPs (2.5mmol / L each dNTP) 4μL, DNA template 1μL (20-50ng), forward primer (10μmol / L) 2μL, reverse primer (10μmol / L) 2μL, 100% DMSO 1μL, TransStart TM 1 μL FastPfu DNA Polymerase (2.5U / μL), 29 μL deionized water, total volume 50 μL.

[0110] The amplification conditions were: 94°C pre-denaturation for 5 minutes (1 cycle); 95°C denaturation for 20 seconds, 55°C annealing for 30 seconds, 72°C extension for 3 minutes (30 cycles); 72°C extension for 5 minutes (1 cycle). The amplified marA1 product contained the cat-sacB box and the 59 base sequences upstream of the marA start codon and downstream of the marA stop codon at both ends.

[0111] The amplified product of marA1 was introduced into Escherichia coli GT49 containing pKD46 plasmid by electroporation and then homologous recombination was performed to replace the CDS region of marA with the cat-sacB box. The specific process is as follows: Escherichia coli GT49 and plasmid pKD46 were preserved in our laboratory (Escherichia coli GT49 (CGMCC No. 24671); pKD46 plasmid can be found in the non-patent literature Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci US A. 2000, 97 (12): 6640-6645).

[0112] The marA1 fragment was electroporated into Escherichia coli GT49 containing pKD46. The electroporation conditions were as follows: first, prepare electroporation competent cells of Escherichia coli GT49 containing pKD46; place 50 μL of competent cells on ice, add 50-100 ng of marA1 fragment, place on ice for 2 minutes, and transfer to a 0.2 cm Bio-Rad electroporation cup. Use MicroPulser (Bio-Rad) electroporator with an electroporation parameter of 2.5 kV. After electroporation, quickly transfer 1 mL of LB liquid culture medium to the electroporation cup, mix it with a pipette for about 5 times, and then transfer it to a 15 mL test tube, and place it in a shaker at 30°C and 100 rpm for incubation for 2 hours. Take 200 μL of the incubated bacterial solution and spread it on LB solid culture medium containing chloramphenicol and ampicillin, and culture it at 30°C until a single colony is visible to the naked eye, and pick a single colony for colony PCR amplification and DNA sequencing verification. The primer pair 4 for PCR amplification and DNA sequencing is:

[0113] marA-up (forward primer): CGAGTATCTGTCTCCGCTGG (SEQ ID NO: 9)

[0114] marA-down (reverse primer): GTTGCACCGTTATCGTTACTGG (SEQ ID NO: 10)

[0115] A correct single colony was picked and named Escherichia coli AA79 (containing pKD46).

[0116] 3. Preparation method of recombinant Escherichia coli strain AA80:

[0117] The plasmid pEASY-cat-sacB containing the chloramphenicol resistance gene cat and the fructan sacose transferase gene sacB (cat-sacB box, the nucleic acid sequence of which is shown in SEQ ID NO: 10) was used as a template, and the fragment soxS2 was amplified using primer pair 5 (soxS1-up / WP-cs-a). The sequence of primer pair 5 is:

[0118] soxS1-up (forward primer):

[0119] GGCAACACTTGAGCATTTGCTTAAGAAAGTCCTGCCGTAAACAAAAAAGAGGTATGACGTGGTGTCCCTGTTGATACC (SEQ ID NO: 3).

[0120] WP-cs-a (reverse primer):

[0121] CAACACCGCCAGAGATAAACATCAGAGCTTTTACGAG (SEQ ID NO: 11).

[0122] The engineered bacteria GT49 containing the P3 promoter was used as a template and the fragment soxS3 was amplified using primer pair 6 (cs-WPs / soxS-wpa). The sequence of primer pair 6 is:

[0123] cs-WPs (forward primer):

[0124] CTCGTAAAAGCTCTGATGTTTATCTCTGGCGGTGTTG (SEQ ID NO: 12).

[0125] soxS-wpa (reverse primer):

[0126] GAATAATTTTCTGATGGGACATAGCTGTTTCCTGGTTTAAAC (SEQ ID NO: 13).

[0127] The engineered bacteria GT49 containing the P3 promoter was used as a template and the fragment soxS4 was amplified using primer pair 7 (wp-soxS-s / soxS-down). The sequence of primer pair 7 is:

[0128] wp-soxS-s (forward primer): GTTTAAACCAGGAAACAGCTATGTCCCATCAGAAAATTATTC (SEQ ID NO: 14).

[0129] soxS-down (reverse primer): CCTCCGATTTTCATACGTCAC (SEQ ID NO: 6).

[0130] Amplification system: 5×TransStart TM FastPfu Buffer 10μL, dNTPs (2.5mmol / L each dNTP) 4μL, DNA template 1μL (20-50ng), forward primer (10μmol / L) 2μL, reverse primer (10μmol / L) 2μL, 100% DMSO 1μL, TransStart TM 1 μL FastPfu DNA Polymerase (2.5U / μL), 29 μL deionized water, total volume 50 μL.

[0131] The amplification conditions were: 94°C pre-denaturation for 5 minutes (1 cycle); 95°C denaturation for 20 seconds, 55°C annealing for 30 seconds, 72°C extension for 3 minutes (30 cycles); 72°C extension for 5 minutes (1 cycle). The amplified soxS2, soxS3 and soxS4 were used as templates and PCR amplified using the introduction pair 8 (soxS1-up / soxS-down). The amplified soxS5 product contained the cat-sacB box, the P3 promoter, and the 63 base sequences upstream of the soxS start codon and the 823 base sequences downstream of the soxS start codon at both ends.

[0132] The obtained soxS5 amplification product was introduced into Escherichia coli GT49 containing pKD46 plasmid by electroporation and then homologous recombination was performed to insert the cat-sacB box and P3 promoter in front of the CDS region of soxS. The specific process is as follows: Escherichia coli GT49 and plasmid pKD46 were preserved in the laboratory of our institute (Escherichia coli GT49 (CGMCC No. 24671); pKD46 plasmid can be found in the non-patent literature Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci US A. 2000, 97 (12): 6640-6645).

[0133] The soxS5 fragment was electroporated into E. coli GT49 containing pKD46. The electroporation conditions were as follows: first, prepare electroporation competent cells of E. coli GT49 containing pKD46; place 50 μL competent cells on ice, add 50-100 ng soxS5 fragment, place on ice for 2 minutes, and transfer to a 0.2 cm Bio-Rad electroporation cup. Use MicroPulser (Bio-Rad) electroporator, and the shock parameter is 2.5 kV. After the shock, quickly transfer 1 mL of LB liquid culture medium to the electroporation cup, mix it with a pipette for about 5 times, and then transfer it to a 15 mL test tube, and place it in a shaker at 30°C and 100 rpm for incubation for 2 hours. Take 200 μL of the incubated bacterial solution and spread it on the LB solid culture medium containing chloramphenicol and ampicillin, and culture it at 30°C until a single colony is visible to the naked eye, and pick a single colony for colony PCR amplification and DNA sequencing verification. PCR amplification and DNA sequencing primer pair 2 are:

[0134] soxS-up (forward primer): CCAATACATCCGTCCAGTTCG (SEQ ID NO: 5)

[0135] soxS-down (reverse primer): CCTCCGATTTTCATACGTCAC (SEQ ID NO: 6)

[0136] A correct single colony was picked and named Escherichia coli AA80 (containing pKD46).

[0137] 4. Preparation method of recombinant Escherichia coli strain AA81:

[0138] The plasmid pEASY-cat-sacB containing the chloramphenicol resistance gene cat and the fructan sacose transferase gene sacB (cat-sacB box, the nucleic acid sequence of which is shown in SEQ ID NO: 10) was used as a template and the fragment soxS2 was amplified using primer pair 9 (marA1-up / WP-cs-a). The sequence of primer pair 9 is:

[0139] marA1-up (forward primer):

[0140] GGCAACACTTGAGCATTTGCTTAAGAAAGTCCTGCCGTAAACAAAAAAGAGGTATGACGTGGTGTCCCTGTTGATACC (SEQ ID NO: 7).

[0141] WP-cs-a (reverse primer):

[0142] CAACACCGCCAGAGATAAACATCAGAGCTTTTACGAG (SEQ ID NO: 11).

[0143] The engineered bacteria GT49 containing the P3 promoter was used as a template and the fragment soxS3 was amplified using primer pair 10 (cs-WPs / marA-wpa). The sequence of primer pair 6 is:

[0144] cs-WPs (forward primer):

[0145] CTCGTAAAAGCTCTGATGTTTATCTCTGGCGGTGTTG (SEQ ID NO: 12).

[0146] marA-wpa (reverse primer):

[0147] CAGTATTGCGTCTGGACATAGCTGTTTCCTGGTTTAAAC (SEQ ID NO: 15).

[0148] The engineered bacteria GT49 containing the P3 promoter was used as a template and the fragment soxS4 was amplified using primer pair 11 (wp-marA-s / marA-down). The sequence of primer pair 11 is:

[0149] wp-marA-s (forward primer): GTTTAAACCAGGAAACAGCTATGTCCAGACGCAATACTG (SEQ ID NO: 16)

[0150] marA-down (reverse primer): GTTGCACCGTTATCGTTACTGG (SEQ ID NO: 10)

[0151] Amplification system: 5×TransStart TM FastPfu Buffer 10μL, dNTPs (2.5mmol / L each dNTP) 4μL, DNA template 1μL (20-50ng), forward primer (10μmol / L) 2μL, reverse primer (10μmol / L) 2μL, 100% DMSO 1μL, TransStart TM 1 μL FastPfu DNA Polymerase (2.5U / μL), 29 μL deionized water, total volume 50 μL.

[0152] The amplification conditions were: 94°C pre-denaturation for 5 minutes (1 cycle); 95°C denaturation for 20 seconds, 55°C annealing for 30 seconds, 72°C extension for 3 minutes (30 cycles); 72°C extension for 5 minutes (1 cycle). The amplified marA2, marA3 and marA4 were used as templates and PCR amplified using introduction pair 12 (marA1-up / marA-down). The amplified marA5 product contained the cat-sacB box, the P3 promoter, and the 59 base sequences upstream of the marA start codon and the 835 base sequences downstream of the marA start codon at both ends.

[0153] The amplified product of marA5 was introduced into Escherichia coli GT49 containing pKD46 plasmid by electroporation and then homologous recombination was performed to insert cat-sacB box and P3 promoter before the CDS region of marA. The specific process is as follows: Escherichia coli GT49 and plasmid pKD46 were preserved in the laboratory of our institute (Escherichia coli GT49, deposit number is CGMCC No. 24671); pKD46 plasmid can be found in non-patent literature Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci US A. 2000, 97 (12): 6640-6645).

[0154] The marA5 fragment was electroporated into Escherichia coli GT49 containing pKD46. The electroporation conditions were as follows: first, prepare electroporation competent cells of Escherichia coli GT49 containing pKD46; place 50 μL of competent cells on ice, add 50-100 ng of marA5 fragment, place on ice for 2 minutes, and transfer to a 0.2 cm Bio-Rad electroporation cup. Use MicroPulser (Bio-Rad) electroporator with an electroporation parameter of 2.5 kV. After electroporation, quickly transfer 1 mL of LB liquid culture medium to the electroporation cup, mix it with a pipette about 5 times, and then transfer it to a 15 mL test tube, and place it in a shaker at 30°C and 100 rpm for incubation for 2 hours. Take 200 μL of the incubated bacterial solution and spread it on LB solid culture medium containing chloramphenicol and ampicillin, and culture it at 30°C until a single colony is visible to the naked eye, and pick a single colony for colony PCR amplification and DNA sequencing verification. The primer pair 4 for PCR amplification and DNA sequencing is:

[0155] marA-up (forward primer): CGAGTATCTGTCTCCGCTGG (SEQ ID NO: 9)

[0156] marA-down (reverse primer): GTTGCACCGTTATCGTTACTGG (SEQ ID NO: 10)

[0157] A correct single colony was picked and named Escherichia coli AA81 (containing pKD46).

[0158] Example 3: Method and results of detecting intracellular ROS levels in recombinant Escherichia coli strains GT49, AA78 and AA79

[0159] The intracellular ROS levels of E. coli recombinant strains GT49, AA78 and AA79 were detected by referring to the operating instructions of the intracellular ROS detection kit H2DCFDA (HARVEYBIO, CAS No.: 4091-99-0). The specific operation is as follows: GT49, AA78, and AA79 were cultured in shake flasks to an OD of about 2, washed and resuspended with phosphate buffer (pH 7.4), and the cell suspension was mixed with 10 μM H2DCFA dissolved in 0.1% (v / v), and then incubated at 37°C for 30 minutes for fluorescence quantitative detection (excitation wavelength 485 nm, emission wavelength 538 nm).

[0160] Results: The results of intracellular ROS levels in strains GT49, AA78 and AA79 were as follows: Figure 2 shown.

[0161] Specifically, we used the ROS detection kit H2DCFDA to detect the intracellular ROS levels of GT49, AA78, and AA79, and found that knocking out the transcriptional regulators soxS and marA that responded to ROS levels led to different degrees of increase in intracellular ROS levels, which increased by 27.8% and 129.5%, respectively. This result indicates that soxS and marA respond to and participate in regulating intracellular ROS levels.

[0162] Example 4: Shake flask fermentation method and results of recombinant Escherichia coli strains GT49, AA80 and AA81

[0163] The seed medium was LB medium containing 0.5% glucose and consisted of the following components:

[0164] Glucose 5g / L, yeast extract 5g / L, trypsin 10g / L, sodium chloride (NaCl) 10g / L.

[0165] The shake flask fermentation medium is NBS medium, which consists of the following components:

[0166] Glucose 20g / L, KH2PO4 3.5g / L, K2HPO4·3H2O 6.5g / L, (NH4)2HPO4 3.5g / L, MgSO4 0.120g / L, CaCl2 11mg / L, Thiamine HCl (thiamine hydrochloride) 5mg / L, calcium carbonate 10g / L, FeCl3·6H2O0.16mg / L, CoCl2·6H2O 0.2mg / L, CuSO4·5H2O0.015mg / L, Na2MoO4·2H2O 0.02mg / L, ZnCl2 0.02mg / L, H3BO3 0.005mg / L.

[0167] The recombinant Escherichia coli strains GT49, AA78, AA79, AA80 and AA81 are used to ferment and produce 3-dehydroshikimic acid, comprising the following steps:

[0168] (1) Seed culture: 3 mL of seed culture medium was placed in a 15 mL test tube and sterilized at 121°C for 15 minutes. After cooling, single colonies of GT49, AA78, AA79, AA80 and AA81 were inoculated into 3 mL of seed culture medium and cultured overnight at 30°C and 250 rpm for 16 hours for inoculation of the fermentation medium.

[0169] (2) Fermentation culture: 200 μL of the above seed bacterial solution was inoculated into the fermentation medium, and cultured at 37° C. and 250 rpm in a shaking incubator for 24 hours to obtain a fermentation broth.

[0170] Analytical method: Agilent-1200 high performance liquid chromatograph was used to analyze and determine the components in the fermentation broth. The concentrations of glucose and organic acids in the fermentation broth were determined using an Aminex HPX-87H organic acid analysis column (300mm×7.8mm, 9μm) from Bio-Rad; the mobile phase was 5mM sulfuric acid, the flow rate was 0.6mL / min, the column temperature was 63°C, and the detection wavelength was 210nm. 3-Dehydroshikimic acid standard was purchased from Sigma-Aldrich, the product catalog number is 05616-100MG.

[0171] Results: The results of 48-hour shake flask fermentation of strains GT49, AA78, AA79, AA80 and AA81 are as follows: Figure 3 shown.

[0172] Specifically, at the shake flask fermentation level, we found that whether the transcriptional regulatory factor soxS or marA was knocked out, the DHS production was significantly reduced compared with the control GT49, by 13.5% and 6.4%, respectively; while overexpression of the transcriptional regulatory factor soxS or marA significantly increased the DHS production compared with the control GT49, by 5.8% and 9.0%, respectively. These results indicate that knocking out the transcriptional regulatory factor soxS or marA weakens the ability of cells to respond to ROS levels, and the increased intracellular ROS level affects the biosynthesis of DHS with strong antioxidant properties; while enhancing the expression of the transcriptional regulatory factor soxS or marA enhances the ability of cells to respond to ROS levels, and the reduced intracellular ROS level promotes the biosynthesis of DHS with strong antioxidant properties.

[0173] Furthermore, from the above description, those skilled in the art can easily understand the key features of the present invention, and many modifications can be made to the invention to adapt to various different purposes and conditions without departing from the spirit and scope of the present invention. Therefore, such modifications are also intended to fall within the scope of the appended claims.

Claims

1. A recombinant microorganism for producing 3-dehydroshikimic acid, characterized in that: Compared with the starting strain, the recombinant microorganism has the following characteristics: enhanced enzyme activity of the DNA-binding transcription dual regulatory factor SoxS and / or the expression level of its encoding gene; or enhanced enzyme activity of the DNA-binding transcription dual regulatory factor MarA and / or the expression level of its encoding gene.

2. The recombinant microorganism according to claim 1, characterized in that In the starting strain, a regulatory element P3 is inserted upstream of the translation start codon of the starting DNA-binding transcription dual regulatory factor SoxS to enhance the enzyme activity of the DNA-binding transcription dual regulatory factor SoxS and / or the expression level of its encoding gene; or a regulatory element P3 is inserted upstream of the translation start codon of the starting DNA-binding transcription dual regulatory factor MarA to enhance the enzyme activity of the DNA-binding transcription dual regulatory factor MarA and / or the expression level of its encoding gene; Wherein, the sequence of the regulatory element P3 is shown as SEQ ID NO:

1.

3. The recombinant microorganism according to claim 1, characterized in that The starting strain is Escherichia coli for producing 3-dehydroshikimic acid Escherichia coli .

4. A method for preparing a recombinant microorganism for producing 3-dehydroshikimic acid, characterized in that: The method comprises the following steps: The step of enhancing the enzyme activity of the DNA-binding transcription dual regulatory factor SoxS and / or the expression level of its encoding gene; or the step of enhancing the enzyme activity of the DNA-binding transcription dual regulatory factor MarA and / or the expression level of its encoding gene.

5. The method for preparing a recombinant microorganism according to claim 4, characterized in that: In the starting strain, Inserting a regulatory element P3 or a promoter stronger than the endogenous promoter upstream of the translation start codon of the enzyme of the starting DNA-binding transcription dual regulatory factor SoxS to enhance the enzyme activity of the DNA-binding transcription dual regulatory factor SoxS and / or the expression level of its encoding gene; or inserting a regulatory element P3 or a promoter stronger than the endogenous promoter upstream of the translation start codon of the enzyme of the starting DNA-binding transcription dual regulatory factor MarA to enhance the enzyme activity of the DNA-binding transcription dual regulatory factor MarA and / or the expression level of its encoding gene; Wherein, the sequence of the regulatory element P3 is shown in SEQ ID NO: 1; The starting strain is Escherichia coli for producing 3-dehydroshikimic acid Escherichia coli .

6. Use of the recombinant microorganism according to claim 1, 2 or 3 in producing 3-dehydroshikimic acid.

7. A method for producing 3-dehydroshikimic acid, characterized in that: The method comprises the steps of using glucose as a substrate and utilizing the recombinant microorganism according to claim 1, 2 or 3 to carry out a fermentation reaction.

8. The method for producing 3-dehydroshikimic acid according to claim 7, characterized in that: The method further comprises the step of adding yeast extract to the culture medium.

9. The method for producing 3-dehydroshikimic acid according to claim 7, characterized in that: The method further comprises the step of separating 3-dehydroshikimic acid from the fermentation reaction liquid after the fermentation reaction is completed.

Images