Biotin protein ligase with enhanced activity and method for producing L-glutamic acid

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of biotin protein ligase activity enhancement in production of L-glutamic acid. The activity of the biotin protein ligase is enhanced or the biotin protein ligase 159-site mutant provided by the invention can improve the yield and conversion rate of glutamic acid, can reduce the production cost of glutamic acid, and provides a new choice for large-scale production.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of enhancing the activity of biotin protein ligase in producing L-glutamic acid. Background Art

[0002] L-glutamic acid is a basic substance that constitutes the protein required for animal nutrition. It plays an important role in the protein metabolism process in organisms and participates in many important chemical reactions in animals, plants and microorganisms. It is mainly used to produce seasonings such as monosodium glutamate and chicken essence, as well as various foods. It is also widely used in the fields of medicine, chemical industry, animal husbandry, etc. Due to the large demand and high production capacity, the industrial fermentation of L-glutamic acid has always been one of the important fermentation industries in my country, and the main strain of L-glutamic acid industrial fermentation is Corynebacterium glutamicum.

[0003] Corynebacterium glutamicum is a biotin auxotrophic Gram-positive bacterium that does not have a complete biotin synthesis pathway and can only use intermediate metabolites such as exogenous biotin or desulfobiotin to maintain normal cell growth. Biotin protein ligase (BirA) can activate biotin to form biotinyl-5'-adenylic acid, and specifically transfer the activated biotin to a biotin receptor protein containing a polypeptide sequence, making the protein biotinylated (Biotin protein ligase from Corynebacterium glutamicum: role for growth and L-lysine production. Applied Microbiology and Biotechnology, 93 (6), 2493-2502.), which is also the main target of strains using biotin. Prior art shows that enhancing the expression of BirA in Corynebacterium glutamicum can strengthen the synthesis of biotin, thereby increasing the L-threonine production of the strain (CN114015632A). At present, there is no research focusing on the influence of biotin protein ligase on L-glutamate synthesis. There is still a need in this field to further analyze the relationship between BirA and L-glutamate production in Corynebacterium glutamicum in order to further improve the production of L-glutamate. Summary of the invention

[0004] The present invention overexpresses wild-type BirA and finds that its overexpression can increase the yield of L-glutamic acid in Corynebacterium glutamicum. The structure of BirA is further simulated and analyzed, and it is speculated that its 159th amino acid residue may play an important role in the structure and function of BirA, and then saturation mutation is performed on its 159th position to obtain a series of mutants, and these mutants and overexpression of mutants can increase the L-glutamic acid yield of the strain, and then the production efficiency of L-glutamic acid can be improved, and the production cost can be reduced. On this basis, the present invention is completed.

[0005] In a first aspect, the present invention provides a strain with improved L-glutamic acid production capacity, wherein the biotin protein ligase activity in the strain is enhanced. Preferably, the enhanced biotin protein ligase activity is the enhanced expression of a polypeptide having an amino acid sequence as shown in SEQ ID NO: 1, or a mutant of the polypeptide having an amino acid sequence as shown in SEQ ID NO: 1, wherein the valine at position 159 of the polypeptide shown in SEQ ID NO: 1 is replaced by any one of methionine, phenylalanine, aspartic acid, serine, glutamic acid, histidine, glycine, threonine, proline, tyrosine, leucine, asparagine, and glutamine.

[0006] More specifically, the strain is a bacterium, preferably Enterobacter or Corynebacterium, more preferably Corynebacterium glutamicum, more specifically such as Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067, and a mutant or strain producing L-glutamic acid prepared from the above strain.

[0007] Further preferably, the strain is a strain obtained by transformation based on Corynebacterium glutamicum ATCC 13032 and Corynebacterium glutamicum ATCC13869, and these transformations include but are not limited to one or more genes selected from the following being enhanced or overexpressed:

[0008] a. yggB gene encoding a mechanosensitive channel protein;

[0009] b. fxpk gene encoding phosphoketolase;

[0010] c. pyc gene encoding pyruvate carboxylase;

[0011] d. gdh gene encoding glutamate dehydrogenase;

[0012] e. Gene encoding carbonic anhydrase.

[0013] Also preferably, the L-glutamic acid producing strain may also have one or more genes selected from, but not limited to, the following weakened or reduced expression:

[0014] d. odhA gene encoding α-ketoglutarate dehydrogenase;

[0015] e. amtR gene encoding a transcriptional regulatory gene;

[0016] f. acnR gene encoding a transcriptional repressor.

[0017] Particularly preferably, the Corynebacterium glutamicum is further improved by introducing an A111V mutation into the NCgl1221 homologous gene and a C361Y mutation into the GltA encoding gene.

[0018] The strain is specifically achieved by transformation. Here, "transformation" has the meaning generally understood by those skilled in the art, that is, the process of introducing exogenous DNA into a host. The method of transformation includes any method for introducing nucleic acid into a cell, including but not limited to electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method and lithium acetate-DMSO method.

[0019] " bacterial strain " of the present invention is the implication that those of ordinary skill in the art usually understand, that is, can import the cell of the nucleic acid with promoter activity of the present invention, is called recombinant strain after importing. In other words, the present invention can utilize any bacterial strain, as long as the biotin protein ligase activity in its bacterial strain strengthens. Bacterial strain of the present invention can be bacterium, preferably enterobacterium or corynebacterium, more preferably Corynebacterium glutamicum, include but not limited to Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067, and the mutant or bacterial strain of the production L-Glutamic acid prepared by the above-mentioned bacterial strain.

[0020] In the present invention, the culture of the strain can be carried out according to conventional methods in the art, including but not limited to well plate culture, shake flask culture, batch culture, continuous culture and batch fed culture, etc., and various culture conditions such as temperature, time and pH value of the culture medium can be appropriately adjusted according to actual conditions. Among them, the "biotin protein ligase" described herein and its abbreviated name "BirA" refer to an enzyme that can activate biotin to form biotinyl-5'-adenylic acid, and specifically transfer the activated biotin to a biotin receptor protein containing a polypeptide sequence to biotinylate the protein. As used herein, the biotin protein ligase is not specifically limited as long as it has the corresponding activity, and it can be a biotin protein ligase derived from a microorganism of the genus Corynebacterium, specifically, Corynebacterium glutamicum, but is not limited thereto. For example, the biotin protein ligase may be an amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 75%, specifically at least 80%, more specifically 85%, and even more specifically 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher homology with the amino acid sequence of SEQ ID NO: 1. In addition, if the amino acid sequence has homology with the above sequence and has substantially the same or corresponding biological activity as the protein of SEQ ID NO: 1, it is obvious that an amino acid sequence having deletions, modifications, substitutions or additions should also fall within the scope of the present disclosure. In the present invention, any polynucleotide sequence encoding a biotin protein ligase may fall within the scope of the present disclosure. For example, the polynucleotide sequence can be a polynucleotide sequence having at least 75%, specifically at least 80%, more specifically 85%, and even more specifically 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher homology with the polynucleotide sequence of SEQ ID NO: 2. In addition, based on codon degeneracy or considering codons preferred by organisms to express proteins, the polynucleotide sequence encoding the protein can have various variants in the coding region within the scope of not changing the amino acid sequence of the protein expressed from the coding region.

[0021] In a second aspect, the present invention provides a biotin protein ligase mutant, wherein the amino acid sequence of the mutant is as shown in SEQ ID NO: 1, and the valine at position 159 is replaced by other amino acids.

[0022] Preferably, the other amino acids are substituted with methionine, phenylalanine, aspartic acid, serine, glutamic acid, histidine, glycine, threonine, proline, tyrosine, leucine, asparagine or glutamine.

[0023] The "polypeptide", "peptide" and "protein" are used interchangeably herein and are amino acid polymers of any length. The polymer may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).

[0024] The "fragment" refers to a polypeptide or a catalytic or carbohydrate binding module that lacks one or more (eg, several) amino acids from the amino and / or carboxyl termini of a mature polypeptide or domain. In a specific embodiment, the fragment has biotin protein ligase activity.

[0025] The term "wild-type" refers to an object that can be found in nature. For example, a polypeptide or polynucleotide sequence that exists in an organism, can be isolated from a source in nature, and has not been intentionally modified by humans in a laboratory is naturally occurring. As used in the present disclosure, "naturally occurring" and "wild-type" are synonymous. In some embodiments, the wild-type biotin protein ligase in the present disclosure refers to the wild-type BirA protein, that is, the polypeptide having the amino acid sequence shown in SEQ ID NO: 1.

[0026] The "mutant" refers to a polynucleotide that contains changes (i.e., substitutions, insertions and / or deletions) at one or more (e.g., several) positions relative to a "wild type" or "compared" polynucleotide or polypeptide, wherein substitution refers to replacing a nucleotide occupying a position with a different nucleotide. Deletion refers to the removal of a nucleotide occupying a position. Insertion refers to the addition of a nucleotide adjacent to and immediately following the nucleotide occupying the position. In a specific embodiment, the "mutation" is a "substitution", which is a mutation caused by the replacement of a base in one or more nucleotides by another different base, also known as a base substitution mutation (subsititution) or a point mutation (point mutation).

[0027] The "amino acid mutation" or "nucleotide mutation" includes "substitution, duplication, deletion or addition of one or more amino acids or nucleotides". In the present invention, the term "mutation" refers to a change in a nucleotide sequence or an amino acid sequence. In a specific embodiment, the term "mutation" refers to "substitution".

[0028] In some embodiments, the "mutation" comprises replacing the valine at position 159 in the sequence shown in SEQ ID NO: 1 with other amino acids, and compared with the biotin protein ligase of the sequence shown in SEQ ID NO: 1, the mutant can increase the production of glutamate.

[0029] In a third aspect, the present invention provides a polynucleotide encoding the biotin protein ligase mutant.

[0030] The "polynucleotide" refers to a polymer composed of nucleotides. A polynucleotide can be in the form of a separate fragment or a component of a larger nucleotide sequence structure, which is derived from a nucleotide sequence separated at least once in quantity or concentration, and can be identified, manipulated, and restored by standard molecular biology methods (e.g., using a cloning vector) and its component nucleotide sequences. When a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C), in which "U" replaces "T". In other words, a "polynucleotide" refers to a nucleotide polymer removed from other nucleotides (separate fragments or entire fragments), or can be a component or ingredient of a larger nucleotide structure, such as an expression vector or a polycistronic sequence. Polynucleotides include DNA, RNA, and cDNA sequences.

[0031] Specifically, the polynucleotide encoding the biotin protein ligase mutant of the present invention includes the polynucleotide shown in SEQ ID NO: 2, and the polynucleotide mutated at positions 475-477 thereof. In addition, the polynucleotide of the present invention also includes any polynucleotide having 75% or more, specifically 80% or more, more specifically 85% or more, and even more specifically 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% or more homology with the polynucleotide shown in SEQ ID NO: 2.

[0032] The term "homology" of the present invention refers to the percentage of identity between two polynucleotides or polypeptide parts. The homology between the sequence of one part and another part can be measured by techniques known in the art. For example, homology can be measured by directly arranging the sequence information of two polynucleotide molecules or two polypeptide molecules using an easily available computer program. Examples of computer programs can include BLAST (NCBI), CLC Main Workbench (CLCbio), MegAlignTM (DNASTAR Inc.), etc. In addition, the homology between polynucleotides can be measured by the following steps: hybridizing polynucleotides under conditions of forming stable double chains between homologous regions, decomposing using single-stranded specific nucleases, and then measuring the size of the decomposed fragments.

[0033] In a fourth aspect, the present invention provides a vector, especially a recombinant expression vector, containing the encoding nucleotide of the biotin protein ligase mutant.

[0034] The term "expression" of the present invention includes any steps involved in RNA production and protein production, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification and secretion.

[0035] The term "vector" of the present invention refers to a DNA construct containing a DNA sequence operably linked to an appropriate control sequence to express a target gene in a suitable host. "Recombinant expression vector" refers to a DNA structure used to express, for example, a polynucleotide encoding a desired polypeptide. A recombinant expression vector may include, for example, a collection of genetic elements that regulate gene expression, such as promoters and enhancers; ii) a structural or coding sequence that is transcribed into mRNA and translated into a protein; and iii) a transcription subunit that is suitable for transcription and translation initiation and termination sequences. The recombinant expression vector is constructed in any suitable manner. The nature of the vector is not important, and any vector may be used, including plasmids, viruses, phages, and transposons. Possible vectors for use in the present disclosure include, but are not limited to, chromosomal, non-chromosomal, and synthetic DNA sequences, such as bacterial plasmids, phage DNA, yeast plasmids, and vectors derived from a combination of plasmids and phage DNA, DNA from viruses such as vaccinia, adenovirus, fowlpox, baculovirus, SV40, and pseudorabies.

[0036] In a fifth aspect, the present invention provides the use of the biotin protein ligase with enhanced expression or the biotin protein ligase 159 mutant in the production of L-glutamate.

[0037] In a sixth aspect, the present invention provides a method for producing L-glutamic acid, the method comprising culturing the strain of the fourth aspect to produce L-glutamic acid, and further comprising the step of separating, extracting or recovering L-glutamic acid from the culture medium.

[0038] Beneficial effects of the present invention: The biotin protein ligase activity enhancement or the biotin protein ligase 159-position mutant provided by the present invention can increase the yield and conversion rate of bacterial L-glutamate, reduce the production cost of L-glutamate, and provide a new selection strategy for large-scale production. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 .The ratio of L-glutamate production of BirA mutant at position 159 to that of wild-type bacteria. DETAILED DESCRIPTION

[0040] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used to implement or test the present invention, the methods and materials provided herein are preferred.

[0041] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental techniques and experimental methods used in the examples are all conventional technical methods unless otherwise specified. For example, the experimental methods in the following examples that do not specify specific conditions are usually carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. The materials, reagents, etc. used in the examples can be obtained through regular commercial channels unless otherwise specified.

[0042] The culture medium used in the examples is as follows:

[0043] The components of TSB plate culture medium are (g / L): glucose, 5g / L; yeast powder, 5g / L; soy peptone, 9g / L; urea, 3g / L; succinic acid, 0.5g / L; K2HPO4·3H2O, 1g / L; MgSO4·7H2O, 0.1g / L; biotin, 0.01mg / L; vitamin B1, 0.1mg / L; MOPS, 20g / L; agar powder, 15g / L.

[0044] The components of TSB liquid culture medium are (g / L): glucose, 5g / L; yeast powder, 5g / L; soy peptone, 9g / L; urea, 3g / L; succinic acid, 0.5g / L; K2HPO4·3H2O, 1g / L; MgSO4·7H2O, 0.1g / L; biotin, 0.01mg / L; vitamin B1, 0.1mg / L; MOPS, 20g / L.

[0045] The components of the seed culture medium used in the glutamate fermentation experiment are: glucose, 25g / L; KH2PO4·3H2O, 2.2g / L; urea, 3g / L; corn steep liquor, 33mL; MgSO4·7H2O, 0.9g / L; soybean cake hydrolyzate, 22mL; MOPS, 20g / L; initial pH 7.2.

[0046] The components of the fermentation medium used in the glutamate fermentation experiment are: glucose, 80g / L; KH2PO4, 1g / L; urea, 10g / L; corn steep liquor powder, 5g / L; MgSO4·7H2O, 0.4g / L; FeSO4·7H2O, 10mg / L; MnSO4·4H2O, 10mg / L; VB1, 200μg / L; MOPS, 40g / L; initial pH 7.5.

[0047] Example 1. Construction of Corynebacterium glutamicum BirA overexpression strain

[0048] BirA protein (encoding gene Cgl0709 or NCgl0679) from Corynebacterium glutamicum is encoded by the gene with Gene ID BBD29_03970 in Corynebacterium glutamicum ATCC13869 and is annotated as a biotin protein ligase. It can activate biotin to form biotinyl-5'-adenylic acid, and specifically transfer the activated biotin to a biotin acceptor protein containing a polypeptide sequence to biotinylate the protein (Peters-Wendisch, P; Stansen, KC; Gotker, S; Wendisch, VF. Biotin protein ligase from Corynebacterium glutamicum: role for growth and l-lysine production. Applied Microbiology and Biotechnology, 93 (6), 2493-2502.). The inventors speculated that this protein is essential for the growth of Corynebacterium glutamicum and that the enzyme could not be knocked out, so the enzyme in Corynebacterium glutamicum 13869 was overexpressed to confirm its effect on L-glutamic acid production.

[0049] According to the published sequence of Corynebacterium glutamicum ATCC 13869 genome (GenBank: CP016335.1), primers BirA-F and BirA-R were designed, and the wild-type birA fragment (amino acid sequence as shown in SEQ ID NO: 1, nucleotide sequence as shown in SEQ ID NO: 2) was amplified using the ATCC 13869 genome as a template. According to the sequence of plasmid pXMJ19 (Jakoby, M; Ngouoto-Nkili, CE; Burkovski, A. Construction and application of new Corynebacterium glutamicum vectors. Biotechnology Techniques, 1999, 13 (6), 437-441), primers pXMJ19-rev-F and pXMJ19-rev-R were designed, and the pXMJ19 linearized vector fragment was obtained by PCR amplification using plasmid pXMJ19 as a template. The purified birA fragment was recovered and recombined with the pXMJ19 linearized vector fragment. The ligation product was transformed into Trans T1 competent cells and spread on LB resistance plates containing 34 μg / mL chloramphenicol. The cells were cultured overnight and positive clones were selected for colony PCR and sequencing verification. The verified recombinant vector was named pXMJ19-BirA. WT .

[0050] The glutamate production strain SCgGC7 (strain information and construction process refer to CN115927325A) competent cells were prepared by the method reported in the literature (Ruan, YL; Zhu, LJ; Li, Q. Improving the electro-transformation efficiency of Corynebacterium glutamicum by weakening its cellwall and increasing the cytoplasmic membrane fluidity. Biotechnology Letters, 2015, 37: 2445-52.), pXMJ19 and pXMJ19-BirA WT The plasmids were transformed into SCgGC7 competent cells to obtain recombinant strains SCgGC7 / pXMJ19 and SCgGC7 / pXMJ19-BirA WT The primers used in this example are shown in Table 1.

[0051] Table 1. Primers used in this example

[0052] Primers Nucleotide sequence BirA-F gaaggagatatacatTTGGGCGTGTCGCCCTTAAA BirA-R gggatcctctagagtTTACTGCAGGCGAAGGTGCG pXMJ19-rev-F ACTCTAGAGGATCCCCGGGTAC pXMJ19-rev-R ATGTATATCTCCTTCCTGCAGGCATGCAAGCTT

[0053] Example 2: Effect of BirA overexpression on L-glutamate production

[0054] The strains SCgGC7 / pXMJ19 and SCgGC7 / pXMJ19-BirA WT The culture was inoculated into a seed medium containing 5 μg / mL chloramphenicol and cultured for 8 h. The culture was used as a seed to inoculate 800 μL of fermentation medium per well in a 24-well plate containing 5 μg / mL chloramphenicol and 10 μM IPTG. The initial OD 600 The control was about 0.5, the plate shaker speed was 800 rpm, each strain was cultured in 3 parallels at 30°C, 5 g / L urea was added for 23 hours, and the fermentation ended after 25 hours. The L-glutamic acid production and glucose consumption were detected, and the sugar-acid conversion rate from glucose to L-glutamic acid was calculated. The results are shown in Table 2. It can be seen that overexpression of BirA can increase the glutamic acid production and sugar-acid conversion rate of the strain.

[0055] Table 2. L-glutamic acid production and sugar-acid conversion rate

[0056] strain L-Glutamic acid (g / L) Sugar-acid conversion rate (g / g, %) SCgGC7 / pXMJ19 9.40±0.57 15.02±0.90 <![CDATA[SCgGC7 / pXMJ19-BirA WT ]]> 10.60±0.57 16.66±0.52

[0057] Example 3: Construction of BirA 159th position saturation mutant strain of Corynebacterium glutamicum

[0058] Through simulation analysis of the structure of BirA, we speculated that the amino acid residue at position 159 may play an important role in its structure and function, so we performed saturation mutagenesis screening on this site.

[0059] First, the ATCC 13869 genome was used as a template, and primers birA-F and birA-R were used to amplify the recombinant fragment containing the wild-type BirA sequence. Primers pK-F / R were designed based on the sequence information of plasmid pK18mobsacB, and the linearized vector fragment was obtained by reverse PCR amplification using plasmid pK18mobsacB as a template. The above two fragments were recovered and recombined to obtain the template plasmid pK18-BirA containing wild-type BirA.

[0060] According to the pK18-BirA vector sequence, primers M / F / L / I / P / T / A / Y / H / Q / N / K / E / C / W / R / S / G / DB-birA-F were designed and used with primer B-birA-R to amplify the BirA-containing V159M BirA V159F BirA V159L BirA V159I BirA V159P BirA V159T BirA V159A BirA V159Y BirA V159H BirA V159Q BirA V159N BirA V159K BirA V159E BirA V159C BirA V159W BirA V159R BirA V159S BirA V159G BirA V159DThe gene fragment of the mutation site was used to mutate the valine (V) at position 159 of BirA to methionine (M), phenylalanine (F), leucine (L), isoleucine (I), proline (P), threonine (T), alanine (A), tyrosine (Y), histidine (H), glutamine (Q), asparagine (N), lysine (K), glutamic acid (E), cysteine ​​(C), tryptophan (W), arginine (R), serine (S), glycine (G), and aspartic acid (D). The fragments of the mutants obtained above were purified and recovered, and then terminal phosphorylation was performed using T4 polynucleotide kinase (T4 PNK), and then self-circularization and ligation were performed using T4 ligase. The ligation products were transformed into Trans1-T1 competent cells, coated on LB resistance plates containing 34μg / mL chloramphenicol, cultured overnight, and positive clones were selected for colony PCR and sequencing verification to obtain the editing vector pK18-BirA of mutant BirA. V159M 、pK18-BirA V159F 、pK18-BirA V159L 、pK18-BirA V159I 、pK18-BirA V159P 、pK18-BirA V159T 、pK18-BirA V159A 、pK18-BirA V159Y 、pK18-BirA V159H 、pK18-BirA V159Q 、pK18-BirA V159N 、pK18-BirA V159K 、pK18-BirA V159E 、pK18-BirA V159C 、pK18-BirA V159W 、pK18-BirA V159R 、pK18-BirA V159S 、pK18-BirA V159G 、pK18-BirA V159D The primers used in this example are shown in Table 3.

[0061] Table 3. Primers for constructing mutant editing plasmids

[0062]

[0063]

[0064] 1 μg of pK18-BirA was electroporated into SCgGC7 competent cells. V159M 、pK18-BirA V159F 、pK18-BirA V159L、pK18-BirA V159I 、pK18-BirA V159P 、pK18-BirA V159T 、pK18-BirA V159A 、pK18-BirA V159Y 、pK18-BirA V159H 、pK18-BirA V159Q 、pK18-BirA V159N 、pK18-BirA V159K 、pK18-BirA V159E 、pK18-BirA V159C 、pK18-BirA V159W 、pK18-BirA V159R 、pK18-BirA V159S 、pK18-BirA V159G 、pK18-BirA V159D Plasmid, add 1mL of TSB medium preheated at 46℃, incubate at 46℃ for 6min, incubate at 30℃ for 3h, apply TSB solid medium containing 25μg / mL kanamycin, and culture at 30℃ for 24h to obtain the first recombinant transformant. The correct transformant was transferred to TSB medium containing 5g / L glucose for overnight culture, and then transferred to TSB medium containing 100g / L sucrose. After culturing at 30℃ for 4h, it was applied to TSB medium supplemented with 100g / L sucrose for screening, and 16 L-glutamic acid production strains with mutant BirA were obtained, namely SCgGC7-BirA V159M , SCgGC7-BirA V159F , SCgGC7-BirA V159L , SCgGC7-BirA V159P , SCgGC7-BirA V159T , SCgGC7-BirA V159A , SCgGC7-BirA V159Y , SCgGC7-BirA V159H , SCgGC7-BirA V159Q , SCgGC7-BirA V159N , SCgGC7-BirA V159E , SCgGC7-BirA V159W , SCgGC7-BirA V159R , SCgGC7-BirA V159S , SCgGC7-BirA V159G , SCgGC7-BirA V159D , that is, the strain contains the mutated BirA. V159CBirA V159K and BirA V159I The mutant strain was not successfully obtained, probably because the activity of BirA decreased significantly after mutation, affecting the cell membrane synthesis.

[0065] Example 4: Fermentation test of BirA 159th position saturated mutant strain

[0066] In order to verify the effect of the 159th saturation mutant of BirA on glutamate synthesis, we conducted fermentation tests on the recombinant strains constructed above. V159M , SCgGC7-BirA V159F , SCgGC7-BirA V159L , SCgGC7-BirA V159P , SCgGC7-BirA V159T , SCgGC7-BirA V159A , SCgGC7-BirA V159Y , SCgGC7-BirA V159H , SCgGC7-BirA V159Q , SCgGC7-BirA V159N , SCgGC7-BirA V159E , SCgGC7-BirA V159W , SCgGC7-BirA V159R , SCgGC7-BirA V159S , SCgGC7-BirA V159G , SCgGC7-BirA V159D The culture was inoculated into the seed medium and cultured for 8 h. The culture was inoculated as seeds into 24-well plates containing 800 μL of fermentation medium per well. The initial OD 600 The control was about 0.5, the plate shaker speed was 800 rpm, each strain was cultured in 3 parallels at 30°C, 5 g / L urea was added at 21h and 23h, and the fermentation ended at 25h. The L-glutamic acid production and glucose consumption were detected, and the sugar-acid conversion rate from glucose to L-glutamic acid was calculated. The ratio of the mutant to the wild type yield was calculated. The results are shown in Figure 1 As shown, BirA V159A BirA V159W and BirA V159R The mutant strain grew significantly in the fermentation medium, resulting in a significant decrease in L-glutamic acid production. V159M BirA V159F BirA V159L BirA V159P BirA V159T BirA V159YBirA V159H BirA V159Q BirA V159N BirA V159E BirA V159S BirA V159G BirA V159D The yields of the 13 mutant strains can increase the L-glutamic acid production by 7%-19% compared with the control strain SCgGC7, indicating that the above mutants are beneficial to the synthesis of L-glutamic acid and have good application prospects in the production of L-glutamic acid and its derivatives.

Claims

1. A strain with improved L-glutamic acid production capacity, characterized in that The biotin protein ligase activity in the strain is enhanced.

2. The strain according to claim 1, characterized in that The enhancement of the biotin protein ligase activity is the enhancement of the expression of the polypeptide with an amino acid sequence as shown in SEQ ID NO: 1, or a mutant containing the polypeptide with an amino acid sequence as shown in SEQ ID NO: 1, wherein the valine at position 159 of the polypeptide with an amino acid sequence as shown in SEQ ID NO: 1 is replaced by any one of methionine, phenylalanine, aspartic acid, serine, glutamic acid, histidine, glycine, threonine, proline, tyrosine, leucine, asparagine and glutamine.

3. The strain according to claim 1 or 2, characterized in that Described bacterial strain is bacterium, preferably enterobacterium or corynebacterium, more preferably Corynebacterium glutamicum, more specifically as Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067, and the mutant or bacterial strain of the production L-amino acid prepared by above-mentioned bacterial strain.

4. The strain according to claim 3, characterized in that The strain is a strain obtained by transformation based on Corynebacterium glutamicum ATCC 13032 and Corynebacterium glutamicum ATCC13869, wherein the transformation includes but is not limited to one or more genes selected from the following being enhanced or overexpressed: Encoding mechanosensitive channel protein ygB Gene; Encoding phosphoketolase fxpk Gene; Encoding pyruvate carboxylase pyc Gene; d. Encoding glutamate dehydrogenase gd Gene; e. Gene encoding carbonic anhydrase.

5. The strain according to claim 4, characterized in that The glutamate producing strain may also include, but is not limited to, one or more genes selected from the following being weakened or having reduced expression: Encoding α-ketoglutarate dehydrogenase odhA Gene; Genes encoding transcriptional regulators ikB Gene; Encoding transcriptional repressors acn Gene.

6. The strain according to claim 5, characterized in that The Corynebacterium glutamicum is further improved, wherein NCgl1221 The A111V mutation was introduced into the homologous gene, and the C361Y mutation was introduced into the GltA encoding gene.

7. A biotin protein ligase mutant, characterized in that: The mutant has a substitution mutation at valine at position 159 based on the amino acid sequence of the biotin protein ligase shown in SEQ ID NO: 1 or a homologous enzyme derived from Corynebacterium glutamicum, and compared with the biotin protein ligase of the sequence shown in SEQ ID NO: 1, the mutant can increase the yield of glutamate; the amino acid sequence of the homologous enzyme has an amino acid sequence with 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher homology with the sequence shown in SEQ ID NO: 1; Preferably, the substitution mutation is to replace valine with any one of methionine, phenylalanine, aspartic acid, serine, glutamic acid, histidine, glycine, threonine, proline, tyrosine, leucine, asparagine and glutamine.

8. The nucleic acid encoding the biotin protein ligase mutant according to claim 7.

9. Use of the strain according to any one of claims 1 to 6 or the biotin protein ligase mutant according to claims 7-8 or the encoding polynucleotide thereof in producing L-glutamic acid.

10. A method for producing L-glutamic acid, characterized in that: The method comprises culturing the strain according to any one of claims 1 to 6 to produce L-glutamic acid, and further comprises the step of separating, extracting or recovering L-glutamic acid from the culture medium.

Images