Application of rice gene OsDITF1 in drought resistance of rice

Abstract

The application relates to application of a rice gene OsDITF1 in rice drought resistance and belongs to the technical field of molecular biology and genetic engineering. The application provides application of the OsDITF1 gene in rice drought resistance, specifically, overexpression of a plant of the OsDITF1 gene, knockout of the OsDITF1 gene by using a CRISPR / Cas9 method to obtain a mutant, and evaluation of drought resistance of the mutant by using a stress condition, so that it is determined that the OsDITF1 gene positively regulates the rice drought resistance, and the yield of the rice under a drought condition is improved.

Description

Technical Field

[0001] The present invention relates to the technical fields of molecular biology and genetic engineering, and in particular to the application of rice gene OsDITF1 in rice drought resistance. Background Art

[0002] With the intensification of global climate change, population explosion, increasing demand for agricultural water and shortage of freshwater resources, drought has become a key factor restricting global agricultural development, seriously affecting the quality and yield of food. In the past decade or so, the total economic losses of global crops caused by drought have reached as high as 30 billion US dollars. As for my country's staple food crops, rice production consumes more freshwater resources than other crops. It takes 3 to 5 tons of water to produce 1 kilogram of rice seeds, while corn or wheat only needs less than half of the water. As a result, the growth, development and yield of rice are more susceptible to drought stress. Therefore, in-depth exploration of rice drought-related genes, analysis of the molecular mechanism of drought resistance, and thus the breeding of drought-resistant rice varieties are of great significance for improving rice yield and quality and ensuring food security.

[0003] Crops can experience drought stress at any stage of their growth, leading to reduced quality and yield. Drought during the reproductive period is particularly severe, resulting in yield losses of at least 50%. Drought can affect flowering and fertilization, reducing pollen fertility and seed set. Drought can also lead to incomplete grain filling, reducing thousand-grain weight. Drought can also affect ear development, resulting in shorter ear length and fewer grains per ear. These factors contribute significantly to yield losses. Therefore, yield can be an important indicator for evaluating drought resistance.

[0004] However, there are still no reports on the application of OsDITF1 gene in rice drought resistance. The present invention has found that using biotechnology to change the expression level of rice OsDITF1 gene can improve rice drought resistance and thus increase yield. Summary of the Invention

[0005] Based on the above-mentioned background technical problems, the purpose of the present invention is to provide an application of the rice OsDITF1 gene in rice drought resistance, specifically by overexpressing the OsDITF1 gene in plants and knocking out the OsDITF1 gene using the CRISPR / Cas9 method to obtain mutants, and evaluating their drought resistance using stress conditions, thereby determining that the OsDITF1 gene can be applied to rice drought resistance and increase rice yield under drought conditions.

[0006] The object of the present invention is to overcome at least one deficiency of the prior art and provide an application of the rice OsDITF1 gene in rice drought resistance.

[0007] The technical solution adopted by the present invention is:

[0008] The first aspect of the present invention provides:

[0009] Application of rice gene OsDITF1 in rice drought resistance, the nucleotide sequence of the OsDITF1 gene is shown in SEQ ID NO.1.

[0010] In some application examples, the amino acid sequence of the OsDITF1 protein is shown as SEQ ID NO.3.

[0011] In some application examples, the method includes the following steps: overexpressing the rice gene OsDITF1 in rice.

[0012] In some application examples, the method includes the following steps: constructing an overexpression vector of the rice gene OsDITF1;

[0013] The overexpression vector is transferred into rice to obtain overexpression rice.

[0014] In some application examples, the following steps are included:

[0015] B01 designs primers to amplify the CDS sequence of the OsDITF1 gene;

[0016] B02 constructs an overexpression vector;

[0017] B03 transforming the overexpression vector described in B02 into Agrobacterium, screening the recombinant Agrobacterium strain containing OsDITF1 to infect rice callus;

[0018] Screening and differentiation of B04 resistant callus to obtain transgenic plants;

[0019] In some application examples, B05 also performs genetic testing on transgenic plants, uses designed primers for PCR amplification and sequencing, confirms successful transformation, and obtains transgenic plants.

[0020] In some application examples, the primers in step B01 are shown as SEQ ID NO.16 and SEQ ID NO.17.

[0021] In some application examples, the primers in step B05 are shown as SEQ ID NO.18 and SEQ ID NO.19.

[0022] The second aspect of the present invention provides:

[0023] A gene editing method for obtaining a rice gene OsDITF1 mutant comprises the following steps:

[0024] A01 designed sgRNA primers in the OsDITF1 coding region;

[0025] A02 Constructing double-target CRISPR / Cas9 knockout vector;

[0026] A03 Transforming the CRISPR / Cas9 knockout vector described in A02 into Agrobacterium, and screening the recombinant Agrobacterium strain containing CRISPR / Cas9 to infect rice callus;

[0027] A04 Screening and differentiation of resistant callus to obtain T0 generation lines;

[0028] A05 Gene detection of T0 generation lines, PCR amplification and sequencing using designed primers to confirm successful knockout and obtain OsDITF1 mutants.

[0029] In some application examples, the double-target sequences in step A02 are shown in SEQ ID NO. 12 and SEQ ID NO. 13.

[0030] In some application examples, the sgRNA primers of step A01 include two pairs of primers, which are shown in SEQ ID NO. 8 and SEQ ID NO. 9, and SEQ ID NO. 10 and SEQ ID NO. 11, respectively.

[0031] In some application examples, the primers in step A05 are shown in SEQ ID NO. 14 and SEQ ID NO. 15.

[0032] Beneficial effects

[0033] The present application obtains mutants by overexpressing OsDITF1 gene in plants and using CRISPR / Cas9 method to knockout OsDITF1 gene, and evaluates the drought resistance of the mutants under stress conditions. After overexpressing OsDITF1 gene in rice, the yield of OsDITF1 overexpression plants is significantly improved compared with the yield of wild type plants planted in a drought pool. Therefore, overexpression of OsDITF1 can significantly improve the drought resistance of rice and increase the yield of rice under drought conditions. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 is the expression pattern analysis of OsDITF1 gene under drought stress treatment in Example 1

[0035] Analysis of the expression amount of OsDITF1 under two conditions of water culture (normal) and 20% PEG treatment (drought);

[0036] Figure 2 is the drought resistance analysis of OsDITF1 mutant plants in Example 2

[0037] ab. Drought resistance phenotypic analysis of osditf1 mutant plants and wild-type plants (WT) (scale bar, 20 cm) and comparison of yield per plant (scale bar, 2 cm); cf. Tiller number, grain number per ear, 1000-grain weight, and yield per plant of wild-type (WT) and OsDITF1 mutant plants grown in water ponds (normal) and drought ponds (Drought) (lowercase letters indicate significant differences, P < 0.05);

[0038] Figure 3 Example 3 Analysis of Drought Resistance of OsDITF1 Overexpressing Plants

[0039] ab. Drought resistance phenotypic analysis of OsDITF1 overexpressing plants (scale bar, 10 cm) and comparison of yield per plant (scale bar, 4 cm). c. Comparison of tiller number of wild-type and OsDITF1 overexpressing plants under water pond cultivation and dry field cultivation (lowercase letters indicate significant differences, P < 0.05). d. Yield per plant of wild-type and OsDITF1 overexpressing plants under water pond cultivation and dry field cultivation. Red values ​​represent increases in yield of OsDITF1 overexpressing plants compared to wild-type; blue values ​​represent decreases in yield of OsDITF1 overexpressing plants compared to wild-type;

[0040] Figure 4 This is a diagram of the process of obtaining rice OsDITF1 mutants;

[0041] Figure 5 This is a diagram of the process of obtaining rice overexpressing OsDITF1.

[0042] Modes for Carrying Out the Invention

[0043] The technical solution of the present invention is further illustrated below with reference to examples and experiments.

[0044] Example 1: Analysis of expression patterns of the OsDITF1 gene under drought stress

[0045] The OsDITF1 (Oryza sativa Drought Induced Transcription Factor 1) gene involved in this Example 1 is derived from rice (Oryza sativa L.), its genomic sequence is shown in SEQ ID NO.1, its cDNA sequence is shown in SEQ ID NO.2 in the sequence listing, and the amino acid sequence encoded by OsDITF1 is shown in SEQ ID NO.3.

[0046] Zhonghua 11 rice seedlings grown to the 3-leaf stage were treated with 20% PEG and samples were taken at 0h, 1h, 2h, 4h, 8h, 12h, and 24h. Untreated Zhonghua 11 rice seedlings were sampled at the same time points as a control and quickly frozen in liquid nitrogen. Total RNA from Zhonghua 11 was extracted and reverse transcribed into cDNA. Real-time fluorescence quantitative PCR was performed using cDNA as a template to detect changes in the transcription level of the OsDITF1 gene after drought treatment, using OsActin1 as an internal reference gene. The experiment was repeated 3 times, and the results were averaged. The specific primer sequences are as follows:

[0047] OsDITF1-qpcr-F: 5'-GTCGCTACCCAAGTATCAGG-3' (SEQ ID NO: 4),

[0048] OsDITF1-qpcr-R: 5'-CAAGCCGACTTTCTGATATTC-3' (SEQ ID NO: 5);

[0049] OsActin1-qpcr-F: 5'-ACCATTGGTGCTGAGCGTTT-3' (SEQ ID NO: 6);

[0050] OsActin1-qpcr-R: 5'-CGCAGCTTCCATTCCTATGAA-3' (SEQ ID NO: 7).

[0051] The results analysis is as follows Figure 1 As shown, in this example, the expression pattern of rice OsDITF1 gene under drought stress was analyzed by qPCR method. The results showed that the expression of OsDITF1 was significantly induced by PEG treatment. The expression level of OsDITF1 was significantly increased after PEG treatment for 2 hours and reached a peak at 12 hours ( Figure 1 ), which indicated that OsDITF1 was involved in the response of rice to drought stress.

[0052] Example 2: Obtaining a rice osditf1 mutant and identifying its drought resistance

[0053] This Example 2 is to obtain the rice osditf1 mutant and identify its drought resistance, specifically including the following steps: Figure 4 As shown:

[0054] A01 designed sgRNA primers in the OsDITF1 coding region;

[0055] Using the nucleotide sequence of the OsDITF1 gene as shown in SEQ ID NO.1 as a reference sequence, two pairs of sgRNA primer sequences were designed in the OsDITF1 coding region, namely

[0056] OsDITF1-U3F1 / OsDITF1-U3R1 and OsDITF1-U3F2 / OsDITF1-U3R2. The primer sequences are as follows:

[0057] OsDITF1-U3F1: 5'-GATCCTCGTGCAGCACCAGA-3' (SEQ ID NO: 8);

[0058] OsDITF1-U3R1: 5'-TCTGGTGCTGCACGAGGATC-3' (SEQ ID NO: 9);

[0059] OsDITF1-U3F2: 5'-CTTGGTGACGGACTCCTTG-3' (SEQ ID NO: 10);

[0060] OsDITF1-U3R2: 5'-CAAGGAGTCCGTCACCAAG-3' (SEQ ID NO: 11).

[0061] Furthermore, to facilitate subsequent ligation, a ggca linker was added to the 5' end of the primer sequences of OsDITF1-U3F1 and OsDITF1-U3F2, and an aaac linker was added to the 5' end of the primer sequences of OsDITF1-U3R1 and OsDITF1-U3R2.

[0062] As shown below:

[0063] OsDITF1-U3F1: 5'-ggcaGATCCTCGTGCAGCACCAGA-3';

[0064] OsDITF1-U3R1: 5'-aaacTCTGGTGCTGCACGAGGATC-3';

[0065] OsDITF1-U3F2: 5'-ggcaCTTGGTGACGGACTCCTTG-3';

[0066] OsDITF1-U3R2: 5'-aaacCAAGGAGTCCGTCACCAAG-3'.

[0067] A02 constructs a dual-target CRISPR / Cas9 knockout vector;

[0068] The two pairs of primers in step A01 were annealed and extended into double strands to complete the preparation of target adapters. The two pairs of target adapters were respectively connected to the pYLgRNA-OsU3 vector to obtain two intermediate vectors.

[0069] Furthermore, gRNA expression cassettes containing the corresponding targets were amplified from the two intermediate vectors, and the amplified fragments were ligated into the vector pYLCRISPR / Cas9-MH using the cut-and-ligate method to obtain the dual-target OsDITF1 CRISPR / Cas9 knockout vector.

[0070] Furthermore, in this example, the two targets are named OsDITF1-T1 and OsDITF1-T2, respectively. The sequence of the target of OsDITF1-T1 is shown as GATCCTCGTGCAGCACCAGA (SEQ ID NO. 12), and the sequence of the target of OsDITF1-T2 is shown as CAAGGAGTCCGTCACCAAG (SEQ ID NO. 13).

[0071] A03: Transform the CRISPR / Cas9 knockout vector described in A02 into Agrobacterium, and screen for recombinant Agrobacterium strains containing CRISPR / Cas9 to infect rice callus tissue;

[0072] The OsDITF1 CRISPR / Cas9 knockout vector containing dual targets in step A03 was transformed into the Agrobacterium strain EHA105 by heat shock method, and the recombinant Agrobacterium strain containing OsDITF1 CRISPR / Cas9 was screened and used to infect Zhonghua 11 callus tissue.

[0073] The specific operation is to take the activated Agrobacterium and culture it in liquid AAM medium (a commercial product) at 8°C and 200 r / min until the OD 600 = 0.4, collect the bacteria by centrifugation and resuspend them in an equal volume of AAM medium. Add acetosyringone to a final concentration of 100 μmol and shake incubate for 2–3 hours as the infection medium. Select well-grown embryogenic callus and place it in the infection medium, shaken at 100 rpm for 20 minutes. After 10 minutes of stagnation, remove the callus and remove the excess bacterial solution with sterile filter paper. Then, culture the callus on co-cultivation medium (induction medium supplemented with 10 g / L glucose and 10 mg / L acetosyringone) until colonies just appear. Subsequently, wash the callus 2–3 times with 0.1 mol mannitol sterile solution and 2–3 times with 500 mg / L cephalosporin solution until the supernatant is completely clear. Remove the callus and place it in a sterile culture dish lined with filter paper to dry for 2–3 days. Then, transfer the callus to selection medium for selection. Change the medium every 20 days.

[0074] A04 resistant callus was screened and differentiated to obtain T0 generation strains;

[0075] Transformed calli are first cultured on a subculture medium with a lower selective pressure for 3-4 weeks, and then on a subculture medium with a higher selective pressure for another 3-4 weeks. Surviving resistant calli are then selected and cultured on a differentiation medium with a lower selective pressure for differentiation. For materials that are difficult to differentiate, appropriate drying treatment can be performed after the callus turns green. Once the young shoots grow to 1-2 mm, they are transferred to a seedling culture medium for rooting to obtain T0 generation strains.

[0076] The A05 T0 generation strain was genetically tested, and PCR amplification and sequencing were performed using the designed primers to confirm that the knockout was successful and obtain the OsDITF1 mutant.

[0077] Guided by sgRNA, Cas9 can cut the double strands of the target sequence, causing double-strand breaks in the DNA, thereby activating the cell's DNA double-strand break repair function. During the repair process, a small number of bases may be replaced, deleted, or inserted, resulting in gene editing.

[0078] Extract genomic DNA from the T0 generation strain, design primers near the target site, amplify the DNA fragment containing the target site by PCR technology and perform sequencing detection. The specific primer sequences for amplification are as follows:

[0079] OsDITF1-Cas9-F: 5'-ACCCTAACCCTAGAATCGT-3' (SEQ ID NO. 14);

[0080] OsDITF1-Cas9-R: 5'-TTTCCCACTCAGATATTGC-3' (SEQ ID NO. 15).

[0081] Sequencing revealed that compared to wild-type genomic DNA, the OsDITF1 mutant strain had a one-base deletion at the OsDITF1-T1 target site and a three-base deletion at the OsDITF1-T2 target site. This frameshift mutation resulted in premature translation termination. The cDNA sequence of the OsDITF1 mutant strain is shown in SEQ ID NO. 20, and the amino acid sequence is shown in SEQ ID NO. 21. Sequencing confirmed successful knockout, resulting in the generation of OsDITF1 mutant plants.

[0082] Identification of drought resistance in rice osditf1 mutant

[0083] osditf1 mutant and wild-type plants were planted in identification ponds (both water and dry ponds). Ten days after transplanting, the dry ponds were not irrigated until the rice matured. During this period, if there was heavy rainfall, the dry ponds were promptly drained. Normally irrigated water ponds served as controls. After the osditf1 mutant and wild-type plants reached maturity, their yield per plant, tiller number, and relative seed set rate were measured.

[0084] like Figure 2 As shown, the tiller number of OsDITF1 mutants grown in water ponds was significantly increased compared to wild-type plants; however, the tiller number of OsDITF1 mutants grown in dry ponds was significantly lower than that of wild-type plants. The thousand-grain weight of OsDITF1 mutants grown in both water ponds and dry ponds was significantly lower than that of wild-type plants. This ultimately resulted in a significant decrease in yield per plant of OsDITF1 mutants compared to wild-type plants. The yield per plant of mutants grown in water ponds was 18.59% lower than that of wild-type plants, while the yield per plant of plants grown in dry ponds was 29.84% lower, a difference of approximately 10% from that of plants grown in water ponds. These results indicate that OsDITF1 positively regulates drought resistance in rice.

[0085] Example 3: Obtaining OsDITF1-overexpressing rice and identifying its drought resistance

[0086] This Example 3 is to obtain rice overexpressing OsDITF1 and identify its drought resistance, which specifically includes the following steps: Figure 5 As shown:

[0087] B01 designs primers to amplify the CDS sequence of the OsDITF1 gene;

[0088] Total RNA was extracted from the japonica rice variety Nipponbare and reverse transcribed into cDNA. Using the cDNA as a template, the CDS region of OsDITF1 was amplified using the primer combination OE-OsDITF1F / OE-OsDITF1R. The primer sequences are as follows:

[0089] OE-OsDITF1F:

[0090] 5-ACGATGATAAGGGC GGTACC ATGGGGAAGAAGAAGAAGCG-3' (SEQ ID NO. 16);

[0091] OE-OsDITF1R:

[0092] 5'-AGGCTACGTA GGATCC TTACAGGGCCATGCGTCCAG-3' (SEQ ID NO. 17).

[0093] The bold sequence in the OE-OsDITF1F / OE-OsDITF1R primer sequence is the sequence on the vector, and the underlined part contains the KpnI (GGTACC) and BamHI (GGATCC) restriction sites.

[0094] Furthermore, OE-OsDITF1F / OE-OsDITF1R primers have been added to the vector linker.

[0095] B02 constructs an overexpression vector;

[0096] The DNA fragment amplified from B01 was ligated into the KpnI and BamHI restriction sites of the vector pCAMBIA1300-221 to obtain an overexpression vector.

[0097] B03 transformed the overexpression vector of B02 into Agrobacterium, screened the recombinant Agrobacterium strain containing OsDITF1 and infected rice callus;

[0098] The overexpression vector constructed in step B02 was transformed into the Agrobacterium strain EHA105 by the heat shock method, and the recombinant Agrobacterium strain containing OsDITF1 was screened and infected with the Zhonghua 11 callus.

[0099] The B04 resistant callus was screened and differentiated to obtain T0' generation strains;

[0100] The transformed callus is first cultured on a subculture medium with a lower selection pressure for 3 to 4 weeks, and then cultured on a subculture medium with a higher selection pressure for 3 to 4 weeks. Then, the surviving resistant callus pieces are selected and cultured on a differentiation medium with a lower selection pressure for differentiation culture.

[0101] For materials that are difficult to differentiate, appropriate drying treatment can be performed when the callus tissue turns green. When the young shoots grow to 1-2 mm, they can be transferred to the seedling culture medium for rooting culture to obtain the T0' generation strains.

[0102] The B05 T0' generation line was genetically tested, and PCR amplification and sequencing were performed using the designed primers to confirm successful transformation and obtain transgenic plants.

[0103] Genomic DNA from the T0' transgenic rice obtained in step B04 was extracted. Primers were designed for the CDS region of the vector pCAMBIA1300-221 and the OsDITF1 gene. The resulting PCR product was 500 bp in size. Plants containing this PCR product were identified as transgenic-positive plants. The primer sequences are as follows:

[0104] OsDITF1-F1: 5'-TCTAGAGGATCTCGAG-3' (SEQ ID NO. 18);

[0105] OsDITF1-R1: 5'-ATAGGTGGAGCTACAC-3' (SEQ ID NO. 19).

[0106] Furthermore, the transcriptional level of transgenic plants was analyzed;

[0107] Transgenic plants obtained from B05 were used as experimental materials. Total RNA was extracted from the transgenic lines and wild-type Zhonghua 11 and reverse-transcribed into cDNA. Real-time fluorescence quantitative PCR was performed using the cDNA as a template to detect the expression of the OsDITF1 gene in the different materials. OsActin1 was used as an internal reference gene. The experiment was repeated three times, and the results were averaged. The specific primer sequences are as follows:

[0108] OsDITF1-qpcr-F: 5'-GTCGCTACCCAAGTATCAGG-3' (SEQ ID NO: 4),

[0109] OsDITF1-qpcr-R: 5'-CAAGCCGACTTTCTGATATTC-3' (SEQ ID NO: 5);

[0110] OsActin1-qpcr-F: 5'-ACCATTGGTGCTGAGCGTTT-3' (SEQ ID NO: 6);

[0111] OsActin1-qpcr-R: 5'-CGCAGCTTCCATTCCTATGAA-3' (SEQ ID NO: 7).

[0112] According to the results of real-time fluorescence quantitative PCR, the expression level of OsDITF1 gene in the identified transgenic positive strains was significantly increased at the transcriptional level compared with the wild type Zhonghua 11. Two independent transgenic strains were selected and named OE-1 and OE-2.

[0113] Identification of drought resistance in rice overexpressing OsDITF1

[0114] OsDITF1 transgenic plants OE-1 and OE-2, along with wild-type plants, were planted in identification ponds (both water and dry ponds). Ten days after transplanting, the dry ponds were not irrigated until the rice reached maturity. During this period, if heavy rainfall occurred, the dry ponds were promptly drained. Water ponds were irrigated normally as controls. After the plants reached maturity, yield and tiller number were measured.

[0115] like Figure 3As shown, the tiller number of OsDITF1-overexpressing plants OE-1 grown in water ponds was not significantly different from that of the wild type, while the tiller number of OE-2 was significantly lower than that of the wild type. However, the tiller number of OsDITF1-overexpressing plants grown in dry ponds was significantly higher than that of the wild type. The yield per plant of OsDITF1-overexpressing plants OE-1 grown in water ponds was slightly higher than that of the wild type, while the yield per plant of OE-1 was 9.57% lower than that of the wild type. However, the yield per plant of OsDITF1-overexpressing plants OE-1 and OE-2 grown in dry ponds was 17.76% and 12.91% higher than that of the wild type, respectively. These results indicate that overexpressing OsDITF1 can significantly improve drought resistance in rice.

[0116] Sequence Listing

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123] The above is a further detailed description of the present invention and should not be considered as a limitation on the specific implementation of the present invention. For those skilled in the art, simple deductions or substitutions without departing from the concept of the present invention are within the scope of protection of the present invention.

Claims

1. Use of overexpressing rice OsDITF1 gene in improving drought resistance of rice, characterized in that: The method comprises the following steps: over-expressing the rice gene OsDITF1 in rice, wherein the nucleotide sequence of the OsDITF1 gene is shown as SEQ ID NO.

1.

2. The use of the overexpressed rice OsDITF1 gene in improving drought resistance of rice according to claim 1, characterized in that: The amino acid sequence of the protein encoded by the OsDITF1 gene is shown in SEQ ID NO.

3.

3. The use of the overexpressed rice OsDITF1 gene in improving drought resistance of rice according to claim 1, characterized in that: include: An overexpression vector of the rice gene OsDITF1 is constructed; the overexpression vector is transferred into rice to obtain overexpression rice.

4. The use of the overexpressed rice OsDITF1 gene in improving drought resistance of rice according to claim 3, characterized in that: include: B01: design primers to amplify the CDS sequence of the OsDITF1 gene; B02: Construction of overexpression vector; B03: Transform the overexpression vector described in B02 into Agrobacterium, screen for recombinant Agrobacterium strains containing OsDITF1, and infect rice callus tissue; B04: Screening and differentiation of resistant callus to obtain transgenic plants.

5. The use of the overexpressed rice OsDITF1 gene in improving drought resistance of rice according to claim 4, characterized in that: Also includes: B05: Conduct genetic testing on transgenic plants, use designed primers for PCR amplification and sequencing to confirm successful transformation.

6. The use of the overexpressed rice OsDITF1 gene in improving drought resistance of rice according to claim 4, characterized in that: The primers in step B01 are shown as SEQ ID NO. 16 and SEQ ID NO.

17.

7. The use of the overexpressed rice OsDITF1 gene in improving drought resistance of rice according to claim 5, characterized in that: The primers in step B05 are shown as SEQ ID NO. 18 and SEQ ID NO. 19.

Images