Penaueus vannamei raptor gene snp molecular marker and application thereof

Abstract

This invention discloses a molecular marker for the Raptor gene of Litopenaeus vannamei, comprising molecular markers D.11926, D.11999, D.12025, D.12026, D.12039, D.12044, D.12063, D.12195, D.12212, D.12241, and D.12349, which are located sequentially at positions 69, 142, 168, 169, 182, 187, 206, 338, 355, 384, and 492 of the nucleotide sequence shown in Sequence 1 of the sequence listing. The molecular markers described above can be used as functional markers for the nitrite tolerance trait in Litopenaeus vannamei and applied in the breeding of Litopenaeus vannamei to cultivate Litopenaeus vannamei strains with good nitrite tolerance.

Description

Technical Field

[0001] This invention belongs to the field of breeding technology for Litopenaeus vannamei, specifically relating to a molecular marker for the Raptor gene SNP in Litopenaeus vannamei and its application. Background Technology

[0002] Litopenaeus vannamei, also known as the Pacific white shrimp, stands out in shrimp farming due to its excellent environmental adaptability and tolerance, making it one of the three highest-yielding shrimp species in the world. However, with the continuous improvement of shrimp farming techniques, increasing stocking densities, large feed inputs, accumulation of metabolic waste products, reduced water exchange, and high environmental loads, water quality factors fluctuate frequently, and the stability of the farming environment deteriorates, thus affecting the ecological farming of Litopenaeus vannamei. Furthermore, because the feed for Litopenaeus vannamei has a high protein content, ammonia nitrogen or uneaten feed and feces decompose and transform into nitrite in the shrimp farming water, resulting in increased nitrite levels and water toxicity, posing certain challenges to the ecological farming of Litopenaeus vannamei.

[0003] The mammalian target of rapamycin (mTOR) is a serine / threonine protein kinase. mTOR participates in regulating growth and homeostasis, and is a key component in signaling pathways integrating nutrient utilization, energy status, cellular stressors, and growth factors. mTOR binds to different proteins to form two structurally and functionally distinct multi-protein complexes: mTORC1 and mTORC2, which differ significantly in upstream pathways, downstream targets, and functions. The reason for this structural and functional difference between the two mTORCs is that mTORC1 binds to the regulator-associated protein of rapamycin (Raptor), which plays a crucial role in activating the mTORC1 signaling pathway; while mTORC2 binds to the rapamycin-insensitive component of mTOR (Rictor). mTORCl responds to stimuli such as growth factors, amino acids, energy, stress, and oxygen, promoting the synthesis of a range of biomolecules including proteins, lipids, and nucleotides. It also inhibits autophagy, promoting anabolism while suppressing catabolism, thus influencing various cellular biological processes. Raptor, a member of the mTORCl protein complex, is crucial to the entire mTORCl signaling pathway. Raptor binds directly to the mTOR protein, acting as a scaffold within the mTORCl protein complex. Raptor presents downstream effector proteins of the mTORCl pathway to the catalytic subunit of the mTOR protein, promoting mTORCl pathway activity. Simultaneously, Raptor senses upstream signals and regulates the mTOR signaling pathway. The role of Raptor in the mTOR signaling pathway is critical, involving the transmission of many energy signals within the mTOR pathway.

[0004] This invention screens for SNPs associated with nitrite nitrogen tolerance in the nucleotide sequence of the Raptor gene, a protein that plays a key role in the activation of mTORCl-targeted proteins by rapamycin. The aim is to provide technical support for breeding Litopenaeus vannamei varieties with nitrite nitrogen tolerance, to carry out stress-resistant breeding of Litopenaeus vannamei, to develop and promote new nitrite-tolerant varieties, and to provide stress-resistant germplasm for Litopenaeus vannamei aquaculture. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker for the Raptor gene SNP in Litopenaeus vannamei, which can be used as a functional marker for the nitrite tolerance trait in Litopenaeus vannamei, and applied in the breeding of Litopenaeus vannamei to cultivate Litopenaeus vannamei strains with good nitrite tolerance.

[0006] This invention is achieved using the following technical solution:

[0007] A molecular marker for the SNP of the Raptor gene in Litopenaeus vannamei includes molecular markers D.11926 (A>G), D.11999 (T>C), D.12025 (A>G), D.12026 (A>G), D.12039 (A>T), D.12044 (C>T), D.12063 (A>T), and D.1... 2195 (T>G), molecular marker D.12212 (T>A), molecular marker D.12241 (G>A), molecular marker D.12349 (T>C), and are located at positions 69, 142, 168, 169, 182, 187, 206, 338, 355, 384, and 492 of the nucleotide sequence shown in Sequence 1 of the sequence listing, respectively.

[0008] The polymorphic forms of the molecular markers D.11926, D.11999, D.12025, D.12026, D.12039, D.12044, D.12063, D.12195, D.12212, D.12241, and D.12349 are A / G, C / T, A / G, A / C, A / T, C / T, A / T, G / T, A / T, A / G, and C / T, respectively.

[0009] The genotypes of the molecular marker D.11926 include AA, AG, and GG genotypes;

[0010] The genotypes of the molecular marker D.11999 include CC, CT, and TT genotypes;

[0011] The genotypes of the molecular marker D.12025 include AA, AG, and GG genotypes;

[0012] The genotypes of the molecular marker D.12026 include AA, AC, and CC genotypes;

[0013] The genotypes of the molecular marker D.12039 include AA, AT, and TT genotypes;

[0014] The genotypes of the molecular marker D.12044 include CC genotype and CT genotype;

[0015] The genotypes of the molecular marker D.12063 include AA, AT, and TT genotypes;

[0016] The genotypes of the molecular marker D.12195 include the GT genotype and the TT genotype;

[0017] The genotypes of the molecular marker D.12212 include AA, AT, and TT genotypes;

[0018] The genotypes of the molecular marker D.12241 include AA, AG, and GG genotypes;

[0019] The molecular marker D.12349 includes the CC, CT, and TT genotypes.

[0020] The application of the Raptor gene SNP molecular markers in Litopenaeus vannamei (SPV) for breeding nitrite-tolerant varieties involves first extracting genomic DNA from the muscle tissue of the SPV to be tested, then using the obtained genomic DNA as a template for PCR amplification and purification of the PCR amplification products, followed by sequencing of the obtained PCR amplification products to determine the genotypes of molecular markers D.11926, D.11999, D.12025, D.12026, D.12039, D.12044, D.12063, D.12195, D.12212, D.12241, and D.12349.

[0021] When the genotype of the molecular marker D.11926 is the dominant AA genotype, this individual is selected as a backup parent for breeding Litopenaeus vannamei.

[0022] When the genotype of the molecular marker D.11999 is the dominant TT genotype, the individual is selected as a backup parent for breeding Litopenaeus vannamei.

[0023] When the genotype of the molecular marker D.12025 is the dominant AA genotype, this individual is selected as a backup parent for breeding of Litopenaeus vannamei varieties.

[0024] When the genotype of the molecular marker D.12026 is the dominant AA genotype, this individual is selected as a backup parent for breeding of Litopenaeus vannamei varieties.

[0025] When the genotype of the molecular marker D.12039 is the dominant AA genotype, the individual is selected as a backup parent for breeding Litopenaeus vannamei.

[0026] When the genotype of the molecular marker D.12044 is the dominant CC genotype, the individual is selected as a backup parent for breeding Litopenaeus vannamei.

[0027] When the genotype of the molecular marker D.12063 is the dominant AA genotype, the individual is selected as a backup parent for breeding Litopenaeus vannamei.

[0028] When the genotype of the molecular marker D.12195 is the dominant TT genotype, this individual is selected as a backup parent for breeding Litopenaeus vannamei.

[0029] When the genotype of the molecular marker D.12212 is the dominant genotype AA or AT, the individual is selected as a backup parent for breeding Litopenaeus vannamei.

[0030] When the genotype of the molecular marker D.12241 is the dominant genotype GG, the individual is selected as a backup parent for breeding Litopenaeus vannamei.

[0031] When the genotype of the molecular marker D.12349 is the dominant TT genotype, the individual is selected as a backup parent for breeding Litopenaeus vannamei.

[0032] This invention improves the tolerance of Litopenaeus vannamei to nitrite by detecting the genotype at the SNP marker site of the Raptor gene in individuals within a population, retaining individuals with favorable genotypes and eliminating those with unfavorable genotypes.

[0033] Furthermore, during the PCR amplification process, the primers used to detect the SNP molecular marker of the Raptor gene in Litopenaeus vannamei include primer F1, primer R1, and primer R2.

[0034] The nucleotide sequence of primer F1 is: TCTGGAGAGGTGAGGTTATGG (as shown in sequence 2 in the sequence listing);

[0035] The nucleotide sequence of primer R1 is: GCATCCCTGGTATATTTGTTCTCA (as shown in sequence 3 in the sequence listing);

[0036] The nucleotide sequence of primer R2 is: CATAGACTGTGATGTAACTGTCAG (as shown in sequence listing 4).

[0037] Furthermore, the PCR amplification process is nested PCR amplification, which involves two PCR amplifications. The amplification system for the first PCR includes 5 μL of 2×Es Taq MasterMix, 0.2 μL of template at a concentration of 100 ng / μL, 0.4 μL of primer F1 at a concentration of 10 μmol / L, 0.4 μL of primer R1 at a concentration of 10 μmol / L, and 4 μL of ddH2O. The amplification system for the second PCR includes 25 μL of 2×Es Taq MasterMix, 1 μL of the product from the first PCR amplification diluted 100-fold, 2 μL of primer F1 at a concentration of 10 μmol / L, 2 μL of primer R2 at a concentration of 10 μmol / L, and 20 μL of ddH2O.

[0038] Furthermore, the amplification procedure for the first PCR amplification is as follows:

[0039] S101: Pre-denaturation at 94℃ for 5 min;

[0040] S102: Denaturation at 94℃ for 30s, annealing at 62℃ for 30s, extension at 72℃ for 30s, for a total of 35 amplification cycles;

[0041] S103: Extend at 72℃ for 7 minutes;

[0042] The amplification procedure for the second PCR was as follows:

[0043] S201: Pre-denaturation at 94℃ for 3 min;

[0044] S202: 94℃ denaturation for 30s, 62℃ annealing for 30s, 72℃ extension for 30s, for a total of 35 cycles;

[0045] S203: Extend for 7 minutes after reaching 72℃.

[0046] Compared with existing technologies, this technical solution has the following advantages:

[0047] 1. This invention provides a Raptor gene SNP molecular marker associated with the nitrite tolerance trait of Litopenaeus vannamei. Among the 11 SNP sites, 3 SNP sites are highly significantly associated with the nitrite tolerance trait of Litopenaeus vannamei, and 8 SNP sites are significantly associated with the nitrite tolerance trait of Litopenaeus vannamei. 4 of these SNP sites can be selected as TaggerSNPs.

[0048] 2. Applying the Raptor gene SNP molecular marker provided by this invention to the breeding of nitrite-tolerant Litopenaeus vannamei can accurately screen for nitrite-tolerant individuals as reserve parents without being affected by age or sex, or without conducting large-scale nitrite stress experiments. This achieves molecular-assisted breeding of nitrite-tolerant traits in Litopenaeus vannamei, significantly improving breeding efficiency and accuracy and promoting the breeding process, thus providing a good foundation for the research on the improvement of nitrite-tolerant varieties of Litopenaeus vannamei. Attached Figure Description

[0049] Figure 1 These are partial sequences of the product obtained from amplifying the Raptor gene in the examples. 'a' represents positions 64-74, showing the peak values ​​of AA, AG, and GG at the D.11926 (A>G) site; 'b' represents positions 137-147, showing the peak values ​​of CC, CT, and TT at the D.11999 (T>C) site; 'c' represents positions 163-173, showing the peak values ​​of AA, AG, and GG at the D.12025 (A>G) site and the peak values ​​of AA, AC, and CC at the D.12026 (A>G) site; and 'd' represents positions 177-187, showing the peak values ​​of AA, AT, and TT at the D.12039 (A>T) site.

[0050] Figure 2 These are partial sequences of the product obtained from amplifying the Raptor gene in the examples. e represents positions 182 to 192, showing the CC and CT peaks at the D.12044 (C>T) site; f represents positions 201 to 211, showing the AA, AT, and TT peaks at the D.12063 (A>T) site; g represents positions 333 to 343, showing the GT and TT peaks at the D.12195 (T>G) site; and h represents positions 350 to 360, showing the AA, AT, and TT peaks at the D.12212 (T>A) site.

[0051] Figure 3 The sequence is a partial fragment of the product obtained by amplifying the Raptor gene in the example. i represents position 379 to 389, showing the peak values ​​of AA, AG, and GG at the D.12241 (G>A) site; j represents position 487 to 497, showing the peak values ​​of CC, CT, and TT at the D.12349 (T>C) site.

[0052] Figure 4 This is a linkage analysis diagram of 11 SNP sites of the Raptor gene in Litopenaeus vannamei in the example. Detailed Implementation

[0053] The present invention is further illustrated by the following examples, but these are not intended to limit the invention. Specific experimental conditions and methods not specified in the following examples are generally conventional methods well known to those skilled in the art.

[0054] Example: The screening process for SNP molecular markers of the Raptor gene in Litopenaeus vannamei in this invention is as follows:

[0055] (1) Take several 1000L plastic barrels, fill them with 500L of aquaculture water, then add analytical grade sodium nitrite and stir evenly to make the concentration of sodium nitrite in the aquaculture water 757.18mg / L; select 240 whiteleg shrimp weighing about 10g each and temporarily raise them for 3 days, then put 30 whiteleg shrimp into each plastic barrel for nitrite stress experiment. During the entire experiment, the water was kept aerated, the pH value was kept at 8.2±0.3, the temperature was kept at 27±0.5℃, the salinity was kept at 30.0‰, and the dissolved oxygen content was kept at 1000mg / L. Oxygen was maintained at 7–8 mg / L. No feed was given during the experiment to maintain the nitrite concentration. The water was changed every 24 hours, and the sodium nitrite concentration was readjusted to 757.18 mg / L. When the whiteleg shrimp rolled over and did not swim away quickly or show any obvious reaction when touched with a stick, and remained in a rolled-over position, it was considered dead. The number of dead individuals was recorded starting 3 hours after the stress. 51 whiteleg shrimp that died 3–12 hours later and 56 whiteleg shrimp that were still alive after 96 hours were selected as the nitrite-sensitive group and the nitrite-tolerant group, respectively.

[0056] (2) Extract total DNA from the muscle tissue of Litopenaeus vannamei from all samples obtained in step (1) using the ammonium acetate / isopropanol method. Detect the quality and integrity of the extracted DNA using an ultra-micro UV spectrophotometer and agarose gel electrophoresis. Store the obtained total DNA at -20 °C for later use.

[0057] (3) Specific primers were designed targeting the nucleotide sequence of a partial DNA fragment of the Raptor gene in Litopenaeus vannamei, resulting in the following primers:

[0058] Primer F1 has the following sequence: TCTGGAGAGGTGAGGTTATGG;

[0059] Primer R1 has the following sequence: GCATCCCTGGTATATTTGTTCTCA;

[0060] Primer R2 has the following sequence: CATAGACTGTGATGTAACTGTCAG;

[0061] (4) Take the total DNA obtained in step (2) as a template and use the primers obtained in step (3) to perform nested PCR amplification of the target fragment. In the specific PCR amplification process, two PCR amplifications are performed. The amplification system of the first PCR includes 5 μL of 2×Es Taq MasterMix, 0.2 μL of template with a concentration of 100 ng / μL, 0.4 μL of primer F1 with a concentration of 10 μmol / L, 0.4 μL of primer R1 with a concentration of 10 μmol / L and 4 μL of ddH2O.

[0062] The amplification procedure for the first PCR amplification is as follows:

[0063] S101: Pre-denaturation at 94℃ for 5 min;

[0064] S102: Denaturation at 94℃ for 30s, annealing at 62℃ for 30s, extension at 72℃ for 30s, for a total of 35 amplification cycles;

[0065] S103: Extend at 72℃ for 7 minutes;

[0066] The amplification system for the second PCR consisted of 25 μL of 2×Es Taq MasteMix, 1 μL of the product from the first PCR amplification diluted 100-fold, 2 μL of primer F1 at a concentration of 10 μmol / L, 2 μL of primer R2 at a concentration of 10 μmol / L, and 20 μL of ddH2O.

[0067] The amplification procedure for the second PCR was as follows:

[0068] S201: Pre-denaturation at 94℃ for 3 min;

[0069] S202: 94℃ denaturation for 30s, 62℃ annealing for 30s, 72℃ extension for 30s, for a total of 35 cycles;

[0070] S203: Extend at 72℃ for 7 minutes;

[0071] (5) The PCR amplification products obtained in step (4) were purified and sequenced after detection by 1% agarose gel electrophoresis. The sequencing results were then compared and analyzed using DNAstar software, including nucleotide sequence alignment and peak diagram analysis, to screen out relevant SNP sites.

[0072] See Figures 1-3The nucleotide sequence of the PCR amplification product of one sample is shown in Sequence 1 of the sequence listing: 69th position is D.11926 (A>G), 142nd position is D.11999 (T>C), 168th position is D.12025 (A>G), 169th position is D.12026 (A>G), 182nd position is D.12039 (A>T), 187th position is D.12044 (C>T), 206th position is D.12063 (A>T), 338th position is D.12195 (T>G), 355th position is D.12212 (T>A), 384th position is D.12241 (G>A), and 492nd position is D.12349 (T>C).

[0073] (6) Based on the selected SNPs, the Litopenaeus vannamei in the sensitive group and the tolerant group were detected and genotyped according to the above method. The samples of different SNPs in the sensitive group and the tolerant group were counted, the genotype frequency and allele frequency were calculated, and the independence test was performed by chi-square analysis. The specific results are shown in Table 1.

[0074] Table 1. Chi-square analysis results of SNP marker sites

[0075]

[0076] Analysis based on Table 1 shows that the dominant genotypes for molecular markers D.11926 (A>G) are AA, D.11999 (T>C) are TT, D.12025 (A>G) and D.12026 (A>G) are AA, D.12039 (A>T) is AA, D.12044 (C>T) is CC, D.12063 (A>T) is AA, D.12195 (T>G) is TT, D.12212 (T>A) is AA or AT, D.12241 (G>A) is GG, and D.12349 (T>C) is TT.

[0077] Simultaneously, linkage disequilibrium analysis was performed on 11 SNP sites, from Figure 4It was found that eight SNP loci, namely D.11926 (A>G), D.11999 (T>C), D.12025 (A>G), D.12026 (A>G), D.12039 (A>T), D.12063 (A>T), D.12241 (G>A), and D.12349 (T>C), were completely linked; loci D.12025 (A>G), D.12195 (T>G), D.12212 (T>A), and D.12044 (C>T) could be selected as Tagger SNPs.

[0078] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. An application of a SNP molecular marker for the Raptor gene in Litopenaeus vannamei, characterized in that: The SNP molecular markers of the Raptor gene in Litopenaeus vannamei include molecular markers D.11926, D.11999, D.12025, D.12026, D.12039, D.12044, D.12063, D.12195, D.12212, D.12241, and D.12349, and are located sequentially at positions 69, 142, 168, 169, 182, 187, 206, 338, 355, 384, and 492 of the nucleotide sequence shown in Sequence 1 of the sequence listing. The polymorphic forms of the molecular markers D.11926, D.11999, D.12025, D.12026, D.12039, D.12044, D.12063, D.12195, D.12212, D.12241, and D.12349 are A / G, C / T, A / G, A / C, A / T, C / T, A / T, G / T, A / T, A / G, C / T; The genotypes of the molecular marker D.11926 include AA, AG, and GG genotypes; The genotypes of the molecular marker D.11999 include CC, CT, and TT genotypes; The genotypes of the molecular marker D.12025 include AA, AG, and GG genotypes; The genotypes of the molecular marker D.12026 include AA, AC, and CC genotypes; The genotypes of the molecular marker D.12039 include AA, AT, and TT genotypes; The genotypes of the molecular marker D.12044 include CC genotype and CT genotype; The genotypes of the molecular marker D.12063 include AA, AT, and TT genotypes; The genotypes of the molecular marker D.12195 include the GT genotype and the TT genotype; The genotypes of the molecular marker D.12212 include AA, AT, and TT genotypes; The genotypes of the molecular marker D.12241 include AA, AG, and GG genotypes; The genotypes of the molecular marker D.12349 include CC, CT, and TT genotypes; The aforementioned Raptor gene SNP molecular markers of Litopenaeus vannamei were used for the breeding of nitrite-tolerant varieties of Litopenaeus vannamei. Specifically, genomic DNA was first extracted from the muscle tissue of the Litopenaeus vannamei to be tested. Then, the obtained genomic DNA was used as a template for PCR amplification and purification of the PCR amplification products. The obtained PCR amplification products were then sequenced to determine the genotypes of the aforementioned molecular markers D.11926, D.11999, D.12025, D.12026, D.12039, D.12044, D.12063, D.12195, D.12212, D.12241, and D.12349. When the genotype of the molecular marker D.11926 is the dominant AA genotype, this individual is selected as a backup parent for breeding of Litopenaeus vannamei varieties. When the genotype of the molecular marker D.11999 is the dominant TT genotype, this individual is selected as a backup parent for breeding Litopenaeus vannamei. When the genotype of the molecular marker D.12025 is the dominant AA genotype, this individual is selected as a backup parent for breeding of Litopenaeus vannamei varieties. When the genotype of the molecular marker D.12026 is the dominant AA genotype, this individual is selected as a backup parent for breeding of Litopenaeus vannamei varieties. When the genotype of the molecular marker D.12039 is the dominant AA genotype, this individual is selected as a backup parent for breeding Litopenaeus vannamei. When the genotype of the molecular marker D.12044 is the dominant CC genotype, the individual is selected as a backup parent for breeding Litopenaeus vannamei. When the genotype of the molecular marker D.12063 is the dominant AA genotype, the individual is selected as a backup parent for breeding Litopenaeus vannamei. When the genotype of the molecular marker D.12195 is the dominant TT genotype, this individual is selected as a backup parent for breeding Litopenaeus vannamei. When the genotype of the molecular marker D.12212 is the dominant genotype AA or AT, the individual is selected as a backup parent for breeding Litopenaeus vannamei. When the genotype of the molecular marker D.12241 is the dominant genotype GG, the individual is selected as a backup parent for breeding Litopenaeus vannamei. When the genotype of the molecular marker D.12349 is the dominant TT genotype, the individual is selected as a backup parent for breeding Litopenaeus vannamei. The breeding of Litopenaeus vannamei varieties involves screening and cultivating Litopenaeus vannamei varieties with tolerance to nitrite nitrogen.

2. The application of the SNP molecular marker of the Raptor gene in Litopenaeus vannamei according to claim 1, characterized in that: During PCR amplification, the primers used to detect the SNP molecular marker of the Raptor gene in Litopenaeus vannamei include primer F1, primer R1, and primer R2. The nucleotide sequence of primer F1 is: TCTGGAGAGGTGAGGTTATGG; The nucleotide sequence of primer R1 is: GCATCCCTGGTATATTTGTTCTCA; The nucleotide sequence of primer R2 is: CATAGACTGTGATGTAACTGTCAG.

3. The application of the SNP molecular marker of the Raptor gene in Litopenaeus vannamei according to claim 2, characterized in that: The PCR amplification process is nested PCR amplification, which involves two PCR amplifications. The amplification system for the first PCR includes 5 μL of 2×EsTaq MasterMix, 0.2 μL of template at a concentration of 100 ng / μL, 0.4 μL of primer F1 at a concentration of 10 μmol / L, 0.4 μL of primer R1 at a concentration of 10 μmol / L, and 4 μL of ddH2O. The amplification system for the second PCR includes 25 μL of 2×EsTaq MasterMix, 1 μL of the product from the first PCR amplification diluted 100-fold, 2 μL of primer F1 at a concentration of 10 μmol / L, 2 μL of primer R2 at a concentration of 10 μmol / L, and 20 μL of ddH2O.

4. The application of the SNP molecular marker of the Raptor gene in Litopenaeus vannamei according to claim 3, characterized in that: The amplification procedure for the first PCR amplification is as follows: S101: Pre-denaturation at 94℃ for 5 min; S102: Denaturation at 94℃ for 30s, annealing at 62℃ for 30s, extension at 72℃ for 30s, for a total of 35 amplification cycles; S103: Extend at 72℃ for 7 minutes; The amplification procedure for the second PCR was as follows: S201: Pre-denaturation at 94℃ for 3 min; S202: 94℃ denaturation for 30s, 62℃ annealing for 30s, 72℃ extension for 30s, for a total of 35 cycles; S203: Extend for 7 minutes after reaching 72℃.

Images