SNP marker related to seedling primary root length of wheat chromosome 4b and application thereof

Abstract

The application discloses a SNP marker related to a main root length of a wheat 4B chromosome at a seedling stage and an application thereof. The application provides an application of a substance for detecting a SNP site Ta-4B-SNP haplotype in a wheat genome in any one of the following: A1) identification or auxiliary identification of a wheat root length; A2) screening or auxiliary screening of a wheat with a long root system; A3) breeding of the wheat with the long root system; and A4) wheat genetic breeding; the SNP site Ta-4B-SNP is the 94th site of SEQ ID NO:1. The application finds a SNP site Ta-4B-SNP on a 4B chromosome of the wheat, and develops a molecular marker according to the SNP site, the marker is a KASP marker, has good repeatability, low cost, is beneficial to screening of a wheat strain or variety with a long root system, and has important significance for cultivation of a new wheat variety with the long root system.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of molecular detection technology and crop genetic breeding, and relates to a SNP marker related to main root length of wheat 4B chromosome at seedling stage and application thereof. BACKGROUND

[0002] Excellent root morphology is the basis for efficient use of water and nutrients in wheat (Atkinson et al. 2015). Root architecture is composed of traits with different functions, such as root length affecting water absorption, root number, root diameter and root surface area affecting nutrient absorption (Meister et al. 2014; Courtois et al. 2009), and root biomass affecting the biomass balance between the aboveground and root systems of plants, thereby affecting yield (Bettembourg et al. 2017; Cormier et al. 2016). Roots adapt to different growth environments by changing morphological and spatial distribution characteristics, which are the basis for efficient use of water and fertilizer, lodging resistance and heat tolerance in wheat (Li et al. 2022; Uga et al. 2013).

[0003] At present, the main methods for investigating root traits are indoor identification at seedling stage and field identification at adult stage. The adult root identification methods include digging method, small basket method and micro-root tube method, which cause great damage to roots, have low throughput and are labor-intensive, and are not suitable for genetic analysis of populations (Li et al. 2022). However, seedling root identification has the characteristics of being fast, simple and highly correlated with adult stage, and can well reflect the root morphology and root group distribution at adult stage. Therefore, using molecular breeding techniques to study the genetic mechanism of seedling root traits is helpful for wheat root improvement.

[0004] Identifying molecular markers that control seedling root traits is a prerequisite for assisted breeding of wheat varieties with excellent root systems. Using molecular markers closely linked to genes or QTLs related to wheat seedling root traits for assisted selection can greatly improve breeding selection efficiency, and is of great significance for accelerating the improvement and breeding of wheat varieties with excellent root systems. At present, the positioning and cloning of genes or QTLs have made some progress, for example, Ayalew et al (2017) identified 13 QTLs on chromosomes 1B, 2D and 5A by identifying seedling root length and root dry weight using a RIL population; Ma et al (2022) identified 36 QTLs related to nine seedling root traits by using a natural population of 388 varieties.

[0005] Although some QTLs related to wheat seedling root system have been located, few closely linked markers are reported to be applied in molecular breeding. Therefore, the functional markers used for identifying wheat seedling root system are further explored, and the markers are used to screen wheat varieties with excellent root system, so as to provide a molecular assisted selection method for breeding wheat varieties with high yield, stable yield and excellent quality. SUMMARY

[0006] The technical problem solved by the present application is to identify and assist in screening wheat varieties with long seedling root system by using the KASP marker of Ta-4B-SNP site.

[0007] In order to solve the above technical problem, in a first aspect, the present application provides an application of a substance for detecting a haplotype of SNP site Ta-4B-SNP in a wheat genome in any one of the following:

[0008] A1) identifying or assisting in identifying wheat root length;

[0009] A2) screening or assisting in screening wheat with long root system;

[0010] A3) breeding wheat with long root system;

[0011] A4) wheat genetic breeding;

[0012] The SNP site Ta-4B-SNP is the 94th of SEQ ID NO: 1.

[0013] In the above-mentioned application, the root length is specifically the length of the main root.

[0014] In the above-mentioned application, the root length is further specifically the length of the main root at the seedling stage.

[0015] In the above-mentioned application, the haplotype of the SNP site Ta-4B-SNP is GG, CC or GC.

[0016] In the above-mentioned application, the substance for detecting the haplotype of the SNP site Ta-4B-SNP in the wheat genome is B1) or B2):

[0017] B1) a complete set of primers;

[0018] B2) a PCR reagent or kit containing the complete set of primers;

[0019] The complete set of primers comprises primer 1, primer 2 and primer 3.

[0020] The nucleotide sequence of the primer 1 comprises the sequence shown in SEQ ID NO: 2 at positions 22-42.

[0021] The nucleotide sequence of the primer 2 comprises the sequence shown in SEQ ID NO: 3 at positions 22-42.

[0022] The nucleotide sequence of the primer 3 is SEQ ID NO: 4.

[0023] In the above-mentioned application, the nucleotide sequence of the primer 1 is SEQ ID NO: 2;

[0024] The nucleotide sequence of the primer 2 is SEQ ID NO: 3.

[0025] In a second aspect, the present application provides any one of the following:

[0026] the set of primers in the first aspect;

[0027] or, a PCR reagent or kit containing the set of primers in the first aspect.

[0028] In the above, the PCR reagent includes primer 1, primer 2, primer 3, KASP Master mix (LGC Biosearch Company, KBS-1050-122);

[0029] The molar ratio of the primer 1, primer 2, primer 3 is 1:1:2.5.

[0030] In an embodiment of the present application, the concentration of primer 1 in the PCR reagent is 168 nM, the concentration of primer 2 in the PCR reagent is 168 nM, and the concentration of primer 3 in the PCR reagent is 420 nM.

[0031] In a third aspect, the present application provides the use of the set of primers, PCR reagent or kit in the second aspect in any one of the following:

[0032] A1) identifying or assisting in identifying wheat root length;

[0033] A2) screening or assisting in screening wheat with long root system;

[0034] A3) breeding wheat with long root system;

[0035] A4) wheat genetic breeding.

[0036] In a fourth aspect, the present application provides a method for identifying or assisting in identifying wheat root length, comprising the following steps: detecting whether the SNP site Ta-4B-SNP haplotype in the wheat genome is GG or CC, and the root length of the wheat to be tested with Ta-4B-SNP site haplotype of GG is greater than or candidate greater than the wheat to be tested with Ta-4B-SNP site haplotype of CC.

[0037] In the method described above, the method for detecting whether the SNP site Ta-4B-SNP haplotype in the wheat genome is GG or CC comprises the following steps: using the wheat genome to be detected as a template, performing KASP reaction by using the PCR reagent in the second aspect, and obtaining the haplotype.

[0038] In a fifth aspect, the present application provides a method for breeding wheat with long root system, comprising the following steps: breeding wheat with haplotype GG of the SNP site Ta-4B-SNP in the fourth aspect.

[0039] In the method described above, the method for detecting whether the SNP site Ta-4B-SNP haplotype in the wheat genome is GG or CC or comprises the following steps: using the wheat genome to be detected as a template, performing KASP reaction by using the PCR reagent, and obtaining the haplotype.

[0040] In the above, the KASP reaction procedure is as follows:

[0041] 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s; 61℃ annealing and extension for 60 s, 10 cycles, each cycle decreasing by 0.6℃; 94℃ denaturation for 20 s, 55℃ annealing and extension for 60 s, 32 cycles; 37℃ for 1 min, 37℃ for 1 s (scanning fluorescence value, genotype reading).

[0042] In the above, the KASP reaction by using the PCR reagent to obtain the haplotype is to detect the amplification product by using Bio-RAD CFX96 fluorescence quantitative PCR instrument, the KASP reaction to obtain the haplotype is to perform genotyping according to the fluorescence data.

[0043] The present application finds a SNP site Ta-4B-SNP on the 4B chromosome of wheat, finds that the SNP site is significantly related to the length of the main root of wheat (P<0.01) by using marker / character correlation analysis in 194 wheat germplasms, and further verifies and applies in the breeding process. According to the SNP site, a molecular marker is developed, the marker is a KASP marker, has good repeatability, low cost, is beneficial to screening wheat strains or varieties with long root system, and has important significance for cultivating new wheat varieties with long root system. BRIEF DESCRIPTION OF DRAWINGS

[0044] Figure 1 Comparison of the root system of wheat materials with haplotypes Ta-4B-SNP-GG and Ta-4B-SNP-CC at the seedling stage.

[0045] Figure 2 Comparison of the main root length of two haplotypes of Ta-4B-SNP in a natural population (A) and a genetic population (B) of wheat. DETAILED DESCRIPTION

[0046] The application will be further described in conjunction with the specific embodiments. The examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0047] The experimental methods in the following examples are all conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0048] The quantitative tests in the following examples are all set up in triplicate, and the results are averaged, unless otherwise specified.

[0049] The taproot length in the following examples refers to the length from the rhizome separation to the farthest point of the taproot.

[0050] Example 1, Mining of Ta-4B-SNP site and obtaining of KASP marker-specific primers

[0051] I. Mining of Ta-4B-SNP site

[0052] 1. Root trait investigation

[0053] 194 wheat varieties were used as materials. 20 seeds with full grains and uniform size were selected from each variety, disinfected with 3% H2O2, and then placed in a culture dish for 7 days of germination. After removing the endosperm, 5 plants were placed in each hole, fixed with a sponge strip, and then transferred to a punched foam board and placed in Hoagland nutrient solution (pH = 6.0). The oxygen pump was continuously aerated, and the plants were cultured in an artificial climate chamber with a light cycle of 16h light / 8h darkness and a light intensity of 500 μmol·m-2·s-1 for 21 days (seedling stage). The nutrient solution was replaced every 3 days. The phenotypic data of 3 plants selected from each line were measured for taproot length, total root length, root surface area, root volume, root diameter, and root tip number using a Microtek Scanmaker i 800 plus root scanner and Win-RHIZO system. The fresh weight of roots, stem and leaf, plant, dry weight of roots, stem and leaf, and plant was measured.

[0054] 2. Association analysis positioning and discovery of linked marker Ta-4B-SNP

[0055] 194 wheat varieties were SNP typed by using wheat 16K SNP chip, and 9793 SNP markers were different in the 194 wheat varieties. Through TASSEL 5.0, each SNP was taken as a fixed factor, and PCA and Kinship matrix were taken as random factors, and MLM was run for whole genome association analysis. When the threshold P<0.001 or log10(P)>3, it was found that the SNP site Ta-4B-SNP was significantly associated with the main root length.

[0056] The haplotype of the Ta-4B-SNP site is GG, CC or GC.

[0057] The main root length of the wheat variety with the haplotype of the Ta-4B-SNP site being GG Figure 1 A) is greater than the main root length of the wheat variety with the haplotype of the Ta-4B-SNP site being CC Figure 1 B) (as shown in the figure). Figure 1

[0058] The Ta-4B-SNP site is located on the 4B chromosome of the wheat genome, and it is the 94th nucleotide of SEQ ID NO: 1, which is G or C.

[0059] II. Development of KASP marker specific primers for detecting the Ta-4B-SNP site

[0060] According to the design rules of KASP primers, KASP primers for amplifying the Ta-4B-SNP site are designed. As the detection primer of Ta-4B-SNP, it includes 3 primer sequences (sequences are as shown in SEQ ID NO: 2-4), which are as follows: primer 1 KASP-4B-SNP-FAM: GAAGGTGACCAAGTTCATGCTacacatggccgtgaaattctG (SEQ ID NO: 2)

[0061] Primer 2 KASP-4B-SNP-HEX: GAAGGTCGGAGTCAACGGATTacacatggccgtgaaattctC (SEQ ID NO: 3)

[0062] Primer 3 KASP-4B-SNP-R: tccaaaacctagcgcttcca (SEQ ID NO: 4)

[0063] Among them, GAAGGTGACCAAGTTCATGCT is the FAM fluorescent tag sequence carried by the 5' end of primer 1 KASP-4B-SNP-FAM, and GAAGGTCGGAGTCAACGGATT is the HEX fluorescent tag sequence carried by the 5' end of primer 2 KASP-4B-SNP-HEX.​

[0064] The scatter plot based on KASP markers shows the clustering of different germplasms on the X-(FAM) axis and Y-(HEX) axis. The genotype is determined by detecting the fluorescence signal of the amplification product. The amplification product of primer 1 and primer 3 only shows the color of the connected FAM fluorescence tag, and the strong FAM signal is concentrated in the lower right corner of the scatter plot, so the haplotype of the Ta-4B-SNP site of the wheat to be tested is GG homozygous; the amplification product of primer 2 and primer 3 only shows the color of the connected HEX fluorescence tag, and the strong HEX signal is concentrated in the upper left corner of the scatter plot, so the haplotype of the Ta-4B-SNP site of the wheat to be tested is CC homozygous.

[0065] III. Establishment of Ta-4B-SNP site haplotype detection method

[0066] 1. Extracting the genomic DNA of the wheat to be tested

[0067] 2. Using the extracted DNA as a template, and using the KASP primers shown in SEQ ID NO: 2-4 to perform PCR amplification;

[0068] The amplification process is as follows:

[0069] (1) Preparation of KASP primer working solution

[0070] Dilute the primers to 100 μM stock solution, then mix 12 μL primer 1 KASP-4B-SNP-FAM, 12 μL primer 2 KASP-4B-SNP-HEX, 30 μL primer 3 KASP-4B-SNP-R, and 46 μL ddH2O to prepare KASP-4B-SNP Assay Mix working solution.

[0071] (2) KASP reaction system and procedure

[0072] The 10 μL reaction system of the 96-well plate is as follows: KASP Master mix (LGC Biosearch Company, KBS-1050-122) 5 μL, DNA template 1.5 μL (about 60 ng), KASP-4B-SNP Assay Mix working solution 0.14 μL, and ddH2O 3.5 μL.

[0073] Among them, the concentration of primer 1 KASP-4B-SNP-FAM in the reaction system is 168 nM, the concentration of primer 2 KASP-4B-SNP-HEX in the reaction system is 168 nM, and the concentration of primer 3 KASP-4B-SNP-R in the reaction system is 420 nM.

[0074] The KASP reaction procedure is as follows:

[0075] 94°C pre-denaturation 15 min; 94°C denaturation 20 s; 61°C annealing and extension 60 s, 10 cycles, each cycle decreasing 0.6°C; 94°C denaturation 20 s, 55°C annealing and extension 60 s, 32 cycles; 37°C 1 min, 37°C 1 s (scan fluorescence value, genotype reading).

[0076] 3. The amplified product was detected by Bio-RAD CFX96 fluorescence quantitative PCR instrument, and genotyped according to the fluorescence data.

[0077] If the fluorescence signal of the amplified product is the sequence connected with FAM fluorescence label sequence on the X axis, the base of the wheat Ta-4B-SNP site to be detected is G, and the haplotype is GG; if the fluorescence signal of the amplified product is the sequence connected with HEX fluorescence label sequence on the Y axis, the base of the wheat Ta-4B-SNP site to be detected is C, and the haplotype is CC.

[0078] The main root length of wheat with Ta-4B-SNP site haplotype GG is longer than that of wheat with Ta-4B-SNP site haplotype CC. Since wheat is a self-pollinating crop, the proportion of genomic heterozygous sites is low, so the present experiment does not study the Ta-4B-SNP site haplotype heterozygote.

[0079] Therefore, the forward primer 1KASP-4B-SNP-FAM (SEQ ID NO: 2) with FAM sequence label, the forward primer 2KASP-4B-SNP-HEX (SEQ ID NO: 3) with HEX sequence label and the reverse primer 3KASP-4B-SNP-R (SEQ ID NO: 4) can be used for allele-specific marker KASP genotyping of the wheat to be detected. According to whether the Ta-4B-SNP site haplotype is GG or CC, the main root length of the wheat to be detected is detected, and the main root length of the wheat with GG haplotype is longer than that of the wheat with CC haplotype. The wheat with GG haplotype is a long root length strain, which indicates that the marker can assist in the selection of wheat main root length at the seedling stage, and provides a molecular assisted selection means for breeding long root system varieties.

[0080] Example 2, Application of Ta-4B-SNP in detecting the main root length of wheat natural population

[0081] Taking 194 wheat as an example, the main root length was detected according to the method of example 1, and the results are shown in Table 1.

[0082] The 194 wheat were detected for Ta-4B-SNP site haplotype according to the method shown in example 1, and the KASP reaction and data analysis were performed by Bio-RAD CFX96 fluorescence quantitative PCR instrument, and the results are shown in Table 1.

[0083] Table 1 is the haplotype statistics of wheat germplasm

[0084]

[0085]

[0086]

[0087]

[0088] It can be seen that the haplotype of Ta-4B-SNP site in 153 of the 194 wheat materials is GG, and the haplotype of Ta-4B-SNP site in 41 of the 194 wheat materials is CC.

[0089] The main root length of wheat with GG haplotype is longer than that of wheat with CC haplotype.

[0090] The main root length of 194 wheat materials and the haplotype of Ta-4B-SNP site were statistically analyzed.

[0091] The results are shown in Table A. Figure 2 It can be seen from Table A that the average main root length of wheat materials with GG haplotype of Ta-4B-SNP site is 16.80 cm, and the average main root length of wheat materials with CC haplotype of Ta-4B-SNP site is 15.49 cm. The average main root length of wheat materials with GG haplotype of Ta-4B-SNP site is significantly higher than that of wheat materials with CC haplotype of Ta-4B-SNP site (P<0.05). Figure 2 A).

[0092] Therefore, it can be judged or assisted to judge that the wheat material with GG haplotype of Ta-4B-SNP site is long-rooted wheat.

[0093] Example 3, application of Ta-4B-SNP in a genetic population

[0094] There is a difference between Jinmai 47 and Jinmai 84 varieties, and a DH population (201 strains) is constructed using the two parents to detect the application of Ta-4B-SNP site in the DH population.

[0095] The KASP-Ta-4B-SNP marker is used to genotype the DH population by the method of Example 1, and the Bio-RAD CFX96 fluorescence quantitative PCR instrument is used for PCR reaction and data analysis.

[0096] Root trait investigation of DH population: 20 seeds with full grain and uniform size were taken each time, and after repeated disinfection with 3% H2O2, they were placed in a culture dish for 7 days of germination. After removing the endosperm, 5 plants were placed in each hole, with a 3 cm spacing between them, and then transferred to a perforated foam board and placed in Hoagland nutrient solution (pH = 6.0). An oxygen pump was used for continuous aeration, and the plants were cultured in an artificial climate chamber with a light cycle of 16 h light / 8 h darkness and a light intensity of 500 μmol·m-2·s-1 for 14 days (seedling stage), with the nutrient solution being replaced every 3 days (20 L). Three uniform plants were selected from each line to measure the length of the main root using a Microtek Scanmaker i 800 plus root scanner and a Win-RHIZO system.

[0097] The results showed that among the above-mentioned 201 lines, 107 had the haplotype GG at the Ta-4B-SNP site, and 94 had the haplotype CC at the Ta-4B-SNP site.

[0098] The above two haplotypes and their corresponding average main root lengths were analyzed, and the results are shown in Table 2. Figure 2 As shown in Table 2, the average length of the main root of the line with the haplotype GG at the Ta-4B-SNP site was 8.55 cm, and the average length of the main root of the line with the haplotype CC at the Ta-4B-SNP site was 6.83 cm. The length of the main root of the test wheat with the haplotype GG at the Ta-4B-SNP site was significantly higher than that of the test wheat with the haplotype CC at the Ta-4B-SNP site.

[0099] Example 4, Application of Ta-4B-SNP in detecting wheat breeding offspring

[0100] The F1 generation was obtained by crossing Jinmai 919 and DH118, and the F3 generation was obtained by selfing the F1 generation. The application of Ta-4B-SNP site in the offspring was detected.

[0101] The F3 generation population was genotyped using the KASP-Ta-4B-SNP marker in the method of Example 1, and the PCR reaction was performed using a Bio-RAD CFX96 fluorescence quantitative PCR instrument.

[0102] The length of the main root of the F3 generation was measured using the method of Example 1.

[0103] The results showed that the average length of the main root of the test wheat with the haplotype GG at the Ta-4B-SNP site was 15.84 cm, and the average length of the main root of the test wheat with the haplotype CC at the Ta-4B-SNP site was 12.10 cm. The length of the main root of the test wheat with the haplotype GG at the Ta-4B-SNP site was significantly (P<0.01) higher than that of the test wheat with the haplotype CC at the Ta-4B-SNP site.

[0104] Therefore, using the SNP site Ta-4B-SNP and designing KASP marker based on the site can be used for quickly identifying whether the to-be-tested wheat has longer root system.

[0105] The application has been described in detail above. For those skilled in the art, the application can be implemented in a wider range under equivalent parameters, concentrations and conditions without departing from the purpose and scope of the application and without unnecessary experiments. Although the application gives a specific example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the application intends to include any change, use or improvement of the application, including changes made by conventional techniques known in the art, which deviate from the range disclosed in the application. Some basic features can be applied within the scope of the following attached claims.

Claims

1. Application of a substance for detecting the Ta-4B-SNP haplotype in the wheat genome in any of the following: A1) Identify or assist in identifying wheat root length; A2) Screening or assisted screening of wheat with long root systems; A3) Breeding wheat with long root systems; A4) Genetic breeding for long root system traits in wheat; The SNP site Ta-4B-SNP is the 94th position of SEQ ID NO: 1; the unit type of the SNP site Ta-4B-SNP is GG or CC.

2. The use according to claim 1, characterized in that: The substance for detecting the SNP site Ta-4B-SNP unit type in the wheat genome is B1) or B2): B1) Primer set; B2) a PCR reagent or kit containing the primer set; The primer set includes primer 1, primer 2 and primer 3; The nucleotide sequence of the primer 1 is SEQ ID NO: 2; The nucleotide sequence of the primer 2 is SEQ ID NO: 3; The nucleotide sequence of the primer 3 is SEQ ID NO:

4.

3. Use of the primer set, PCR reagent or kit according to claim 2 in any of the following: A1) Identify or assist in identifying wheat root length; A2) Screening or assisted screening of wheat with long root systems; A3) Breeding wheat with long root systems; A4) Genetic breeding for long root system traits in wheat.

4. A method for identifying or assisting in identifying wheat root length, comprising the following steps: detecting whether the Ta-4B-SNP haplotype in the wheat genome is GG or CC, wherein the root length of the wheat to be tested whose Ta-4B-SNP haplotype is GG is greater than or is potentially greater than that of the wheat to be tested whose Ta-4B-SNP haplotype is CC; The SNP site Ta-4B-SNP is the 94th position of SEQ ID NO:

1.

5. The method according to claim 4, characterized in that: The method for detecting whether the unit type of the SNP site Ta-4B-SNP in the wheat genome is GG or CC comprises the following steps: using the wheat genome to be tested as a template, performing a KASP reaction with the PCR reagent described in claim 2 to obtain the unit type.

6. A method for breeding long-root wheat, comprising the following steps: breeding wheat with the Ta-4B-SNP locus unit type GG as described in claim 4 or 5.

Images