A pomelo indel molecular marker, an amplification primer and application thereof in pomelo variety identification

By applying Indel molecular markers and amplification primers for pomelo, the problems of low efficiency and insufficient accuracy in the identification of pomelo varieties in existing technologies have been solved, and rapid and accurate identification of 'Dongshi Early Pomelo' has been achieved.

CN119177315BActive Publication Date: 2025-11-25INST OF TROPICAL & SUBTROPICAL CASH CROP YUNNAN ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411570798.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-06
Publication Date
2025-11-25
Estimated Expiration
2044-11-06

AI Technical Summary

Technical Problem

Existing methods for identifying pomelo varieties and germplasm sources suffer from low efficiency and insufficient accuracy, especially in the early stages when they cannot accurately identify pomelo hybrid seedlings.

Method used

Using the grapefruit Indel molecular marker located at 38807805 bp on chromosome 2 of the 'Late White Grapefruit' genome, amplification primers were designed for PCR amplification, and the results were determined by detecting the size of the amplified bands by gel electrophoresis.

Benefits of technology

It enables rapid and accurate differentiation of 'Dongshi Early Pomelo' from other pomelo varieties, providing a simple and quick identification method and improving the efficiency and accuracy of pomelo variety identification.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119177315B_ABST
    Figure CN119177315B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of molecular marker development and molecular detection, and particularly relates to a pomelo Indel molecular marker, an amplification primer and application of the pomelo Indel molecular marker in pomelo variety identification. The pomelo Indel molecular marker can be used for quickly and accurately distinguishing 'Dongshi Zaoyou' from other pomelo citrus varieties. The molecular marker and the molecular marker amplification primer can provide an effective method and idea for seedling identification of the 'Dongshi Zaoyou' variety, and are simultaneously simply and quickly used in scientific research or production practice of related pomelo varieties.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular marker development and molecular detection, and particularly relates to a pomelo Indel molecular marker, an amplification primer and application thereof in pomelo variety identification. BACKGROUND

[0002] Citrus species of the genus Citrus (L.) Osbeck Citrus grandis ) are an important part of citrus. At present, in the research of citrus plant variety identification, mainly morphological identification or molecular marker identification is adopted. Among them, morphological identification is to observe and analyze the external morphology of flowers, fruits, leaves, branches, thorns and other external forms, and to establish a taxonomic system of the genus Citrus based on typical phenotypic characteristics. For example, Li Run Tang et al.

Li Run Tang, Zhang Yingnan, Tian Dalun. Study on the stomata of citrus plants. Journal of Fruit Tree Research, 2004, 21(5): 419-424

Chen Peng. Investigation and genetic diversity of Chinese wild Fortunella species resources[D]. Central China Agricultural University, 2011

[0003] DNA molecular marker technology is a method for identifying organisms from a molecular level by using DNA level gene polymorphism. Compared with other markers, DNA molecular markers have wide distribution in biological tissues, strong polymorphism, and are less affected by environmental and time factors, can quickly distinguish the authenticity of seedlings, and the identification results are more accurate. In the research of citrus genetic identification, the commonly used DNA molecular markers at present mainly include random amplified polymorphic DNA (RAPD), amplified fragment length polymorphism marker (AFLP) and simple sequence repeat (SSR). RAPD is a molecular technology for polymorphism analysis of genome based on PCR, but its amplification stability and repeatability are seriously defective; AFLP is often used to identify DNA fingerprint of germplasm, genetic diversity of fruit tree varieties, etc., but false positive fragments are prone to exist, and the identification accuracy is low; SSR is a relatively widely used molecular marker technology at present, which is distributed in the whole genome and has high polymorphism, but the marker banding pattern needs to be distinguished by polyacrylamide gel electrophoresis, the operation process is complicated, and some toxic reagents are involved, so it is not suitable for safe and efficient identification work.

[0004] In summary, the existing methods for identifying grapefruit varieties and germplasm sources have certain defects, which limit the identification efficiency and accuracy of grapefruit variety genetic background. SUMMARY

[0005] The purpose of the present application is to provide a grapefruit Indel molecular marker, an amplification primer and its application in grapefruit variety identification, which can be used for the identification of grapefruit varieties, especially 'Dongshi early grapefruit', quickly and accurately.

[0006] The present application provides a grapefruit Indel molecular marker, which is located at 38807805bp of the second chromosome of 'Late white grapefruit' genome, and there is an insertion / deletion polymorphism of 143bp as shown in SEQ ID NO. 1.

[0007] Preferably, the nucleotide sequence comprising the grapefruit Indel molecular marker is shown in SEQ ID NO. 2 or SEQ ID NO. 3.

[0008] The present application also provides an amplification primer of the grapefruit Indel molecular marker described in the above technical solution, and the nucleotide sequences of the forward primer and the reverse primer of the amplification primer are shown in SEQ ID NO. 8 and SEQ ID NO. 9, respectively.

[0009] The present application also provides the application of the amplification primer described in the above technical solution in the preparation of grapefruit detection reagents, kits, genome chips or liquid phase probes.

[0010] The present application also provides a grapefruit detection product, which comprises the amplification primer described in the above technical solution.

[0011] Preferably, the type of the product includes reagents, kits, genome chips or liquid phase probes.

[0012] The present application also provides the application of the grapefruit Indel molecular marker described in the above technical solution, the amplification primer described in the above technical solution or the grapefruit detection product described in the above technical solution in the identification or differentiation of grapefruit varieties.

[0013] Preferably, the application includes the identification of 'Dongshi early grapefruit'.

[0014] The present application also provides a method for identifying 'Dongshi early grapefruit', which comprises the following steps:

[0015] Amplifying the genomic DNA of the grapefruit sample to be tested with the amplification primer to obtain a PCR amplification product;

[0016] The PCR amplification product is subjected to gel electrophoresis detection to obtain a gel electrophoresis amplification band;

[0017] The result is determined according to the size of the gel electrophoresis amplification band:

[0018] When the gel electrophoresis amplification band is 343bp, the pummelo sample to be tested is 'Dongshi Zaoyou';

[0019] When the gel electrophoresis amplification band is 204bp, the pummelo sample to be tested is other varieties other than 'Dongshi Zaoyou';

[0020] The amplification primer is the amplification primer described in the above technical solution.

[0021] Preferably, the PCR amplification system comprises: 10.0 μL 2xTaq Mix, 0.5 μL of forward primer with a concentration of 10 mmol / L, 0.5 μL of reverse primer with a concentration of 10 mmol / L, 1.0 μL of genomic DNA and 8.0 μL of ddH2O.

[0022] The PCR amplification program comprises 94℃ pre-denaturation for 5 min, 94℃ denaturation for 1 min, 55℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles, and 72℃ terminal extension for 10 min.

[0023] Beneficial effects:

[0024] The present application provides a pummelo Indel molecular marker, which is located at 38807805bp of the second chromosome of 'Wanbaiyou' genome, and there is an insertion / deletion polymorphism of 143bp as shown in SEQ ID NO. 1. On this basis, the present application also provides an amplification primer of the above-mentioned pummelo Indel molecular marker, and the pummelo Indel molecular marker can be used to quickly and accurately distinguish 'Dongshi Zaoyou' from other pummelo citrus varieties. The molecular marker and the molecular marker amplification primer provided by the present application can provide an effective method and idea for the seedling identification of 'Dongshi Zaoyou' variety, and can be simply and quickly used in the scientific research or production practice of related pummelo varieties. BRIEF DESCRIPTION OF DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below.

[0026] Figure 1 Visualization of InDel03 variation information by IGV2.10.3 software in Example 1;

[0027] Figure 2InDel primer identification results of 10 citrus pomelo germplasms in Example 1;

[0028] Figure 3 InDel03 variation information of Example 1 for the GeneDoc software;

[0029] Figure 4 InDel03 primer identification results of 65 citrus pomelo germplasms in Example 2. DETAILED DESCRIPTION

[0030] The application provides a pomelo Indel molecular marker, which is located at 38807805bp of the second chromosome of a 'Wanbaiyu' genome, and an insertion / deletion polymorphism of 143bp as shown in SEQ ID NO. 1 exists.

[0031] The nucleotide sequence shown in SEQ ID NO. 1 is specifically 5'-AGAAGTTAGAAATGTTTTGTGTTGCAATCCGTGTACTCTACATCTAGGAATAGATGATACTCTTTTCGCCACAAAATTTTATATAAATTTTTATATCATAATATAATTGGTTGAATGAAACAAAAACACACCAAAAACTATGC-3'.

[0032] As an implementation form, the nucleotide sequence of the pomelo Indel molecular marker can be shown as SEQ ID NO. 2 or SEQ ID NO. 3; the nucleotide sequence shown as SEQ ID NO. 2 or SEQ ID NO. 3 is as follows, respectively, SEQ ID NO. 2: 5'-AGATTACAATAACATTTCGCAGCTATATATGATTCATCACTTACCAATTTTTTTTTTTTTATTTCCTACTGTCGTCGTAATGTATCAGAAGTTAGAAATGTTTTGTGTTGCAATCCGTGTACTCTACATCTAGGAATAGATGATACTCTTTTCGCCACAAAATTTTATATAAATTTTTATATCATAATATAATTGGTTGAATGAAACAAAAACACACCAAAAACTATGCCCTTTTTTGGTAAATTAAAAAAAAATTATAACTTACTTCCGGTGTAACTTCGTTTTGTGTGTGATTTTTAGGAATTTTTTTTCATAATTTAATTAAAGCAATCGTTGGTTGGTTT-3'; SEQ ID NO. 3: 5'-AGATTACAATAACATTTCGCAGCTATATTATATGATTGATCTCTTACCAATTTATTTTTTTTTATTTCCTACTGTCGTCGTAATGTATCCTTTTTTGGTAAATTAAAAAAAAAAATTATAACTTACTTTCGGTGTAACTTCGTTTTGTGTGTGATTTTTAGGAAATTTTTTCATAATTTAATTAAAGCAATCGTTGGTTGGTTT-3'.

[0033] The application further provides the amplification primer of the pomelo Indel molecular marker in the above technical solution, and the nucleotide sequences of the forward primer and the reverse primer of the amplification primer are shown as SEQ ID NO. 8 and SEQ ID NO. 9, respectively. The nucleotide sequences shown as SEQ ID NO. 8 or SEQ ID NO. 9 in the application are as follows, respectively, SEQ ID NO. 8: 5'-AGATTACAATAACATTTCGCAGCT-3'; SEQ ID NO. 9: 5'-AAACCAACCAACGATTGCTT-3'.

[0034] The application further provides the application of the amplification primer in the above technical solution in the preparation of a pomelo detection reagent, a kit, a genomic chip or a liquid phase probe.

[0035] The application further provides a grapefruit detection product comprising the amplification primer according to the above technical solution. As an implementation form, the product according to the application can be a reagent, a kit, a genomic chip or a liquid probe. In a specific embodiment, the product can be a kit, which can further comprise a PCR amplification reagent.

[0036] The application further provides an application of the grapefruit Indel molecular marker according to the above technical solution, the amplification primer according to the above technical solution or the grapefruit detection product according to the above technical solution in identification or differentiation of grapefruit varieties. As an implementation form, the application according to the application can be identification of 'Dongshi Zao' grapefruit. As another implementation form, the identification of 'Dongshi Zao' grapefruit according to the application can be identification of true or false of 'Dongshi Zao' seedling.

[0037] The application further provides a method for identifying 'Dongshi Zao' grapefruit, comprising the following steps:

[0038] amplifying the genomic DNA of the grapefruit sample to be tested by using the amplification primer to obtain a PCR amplification product;

[0039] detecting the PCR amplification product by gel electrophoresis to obtain a gel electrophoresis amplification band;

[0040] determining the result according to the size of the gel electrophoresis amplification band:

[0041] when the gel electrophoresis amplification band is 343 bp, the grapefruit sample to be tested is 'Dongshi Zao' grapefruit;

[0042] when the gel electrophoresis amplification band is 204 bp, the grapefruit sample to be tested is not 'Dongshi Zao' grapefruit;

[0043] The amplification primer is the amplification primer according to the above technical solution.

[0044] As an implementation form, the genomic DNA of the grapefruit sample to be tested according to the application can be extracted from leaf, fruit or root tissue. The application does not have special limitations on the extraction method of the genomic DNA, and a conventional genomic DNA extraction method in the art can be used.

[0045] As an implementation form, the PCR amplification system of the present application can be: 10.0 μL 2x Taq Mix, 0.5 μL forward primer with a concentration of 10 mmol / L, 0.5 μL reverse primer with a concentration of 10 mmol / L, 1.0 μL genomic DNA and 8.0 μL ddH2O. The PCR amplification procedure can be 94°C pre-denaturation for 5 min; 94°C denaturation for 1 min, 55°C annealing for 30 s, 72°C extension for 1 min, 35 cycles; 72°C final extension for 10 min.

[0046] As an implementation form, the gel electrophoresis detection of the present application can be agarose gel electrophoresis detection; as another implementation form, the agarose gel electrophoresis detection of the present application can be 2.5% agarose gel electrophoresis detection.

[0047] In order to further illustrate the present application, the technical solutions provided by the present application are described in detail below in combination with the drawings and examples, but they should not be understood as limiting the scope of protection of the present application.

[0048] Example 1

[0049] InDel primer design and screening of effective primers

[0050] 1. Material selection

[0051] Taking 'Dongshi Zao' and 64 citrus varieties as test materials, the CTAB method was used to extract the genomic DNA of the citrus varieties. The purified 'Dongshi Zao' DNA was subjected to a purification step to meet the quality requirements for resequencing. Among them, 'Dongshi Zao' and 'Shatian You' came from the Citrus Test Base of the Institute of Tropical Crops, Yunnan Province, and the other varieties were provided by Dr. Zhang Yingzi of the College of Horticulture and Forestry, Huazhong Agricultural University (Table 1).

[0052] Table 1 Information summary of 65 citrus varieties

[0053]

[0054]

[0055]

[0056]

[0057] 2. InDel primer design and screening of effective primers

[0058] With 'Yanbaiyu' genome as the reference genome (http: / / citrus.hzau.edu.cn / ), the whole genome resequencing data of 'Dongshi Zao' was analyzed by bioinformatics method. The raw resequencing data was quality controlled and filtered by FastQC software, and the adapter sequence and low-quality reads were removed. Then the quality-controlled reads were aligned to 'Yanbaiyu' genome by BWA software, and the whole genome InDel variant site detection and gvcf file merging and filtering were performed by GATK4.2.0 software. The vcf file containing InDel information was sorted according to the InDel fragment size to determine the variant site information, and IGV2.10.3 software was further used for visualization to verify the variant information Figure 1 ), by Figure 1 It can be known that 'Dongshi Zao' exists base fragment insertion at 38807805 bp of the second chromosome.

[0059] According to the above genome variant sequence of 'Dongshi Zao', 10 pairs of specific high-quality primer pairs were designed (Table 2), and then the InDel marker primer pairs were screened for effectiveness.

[0060] Table 2 InDel primer information used for genetic identification of 'Dongshi Zao'

[0061]

[0062] PCR amplification was performed on 'Dongshi Zao' and 'Yanbaiyu', 'Shuimiyou', 'Yonghong Aoliangyou', 'Juhuaxinyou', 'Zaoshu Gaosugangyou No.4', 'Jinlanyou', 'Sanliao Banyou', 'Cili Xiangyou', 'Wendanyou' and other citrus varieties, and the amplified bands were detected by electrophoresis. High-quality specific differential InDel markers of 'Dongshi Zao' were selected as candidate effective species source identification primers. The specific operation steps are as follows:

[0063] The PCR reaction system was 20 µL, and each component was 10.0 µL 2×Taq Mix, 0.5 µL F (forward primer 10 mmol / L), 0.5 µL R (reverse primer 10 mmol / L), 1.0 µL DNA (template 300 ng / L), and 8.0 µL ddH2O.

[0064] The PCR reaction program was 94℃ pre-denaturation for 5 min, 94℃ denaturation for 1 min, 55℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles, 72℃ final extension for 10 min, and 4℃ storage.

[0065] After amplification according to the above PCR reaction system and procedure, the PCR amplification products were electrophoresed in a 2.5% agarose gel (0.5×TBE buffer), and the results were observed under a gel imaging system after development by Goldview (Guangzhou Jianyang Biotechnology Co., Ltd.). The results are as follows. Figure 2 As shown, in Figure 2 In the text, M represents Marker, and 1~10 represent 'Dongshi Early Pomelo', 'Late White Pomelo', 'Shuimi Pomelo', 'Yonghong Dwarf Late Pomelo', 'Chrysanthemum Core Pomelo', 'Early-maturing High-sugar Fragrant Pomelo No. 4', 'Jinlan Pomelo', 'Sandou Ban Pomelo', 'Cili Fragrant Pomelo', and 'Wendan Pomelo'.

[0066] Depend on Figure 2 It can be concluded that InDel01 is a unique marker for 'Wenzhou Pomelo', distinguishing it from other varieties. InDel03 can significantly differentiate 'Dongshi Early Pomelo' from the other 9 varieties. InDel02, InDel06, and InDel08 cannot be considered unique markers for 'Dongshi Early Pomelo'. Based on the test results, one effective primer pair, InDel03, was finally determined to be able to distinguish 'Dongshi Early Pomelo' from the 9 citrus pomelo varieties.

[0067] Meanwhile, the InDel03 site was cloned and its sequence analyzed, as follows:

[0068] The Escherichia coli clone strain DH5α was purchased from TransGenBiotech; the blunt-ended cloning vector pClone007 Blunt Simple Vector Kit was purchased from Tsingke.

[0069] Specific primers SEQ ID NO. 8 and SEQ ID NO. 9 were designed using the sequences of SEQ ID NO. 2 or SEQ ID NO. 3. PCR amplification was performed to identify the variant sites in 'Dongshi Early Pomelo' and 'Guanxi Honey Pomelo'. PCR products were recovered using the EZNA® DNA Recovery Kit (Omega, USA) according to the kit instructions. The purified fragments were ligated into the blunt-ended cloning vector pClone007 and then transformed into *E. coli* DH5α. The cells were cultured overnight at 37°C. Two single clones were picked from each culture dish transformed with SEQ ID NO. 1 and amplified using primers SEQ ID NO. 8 and SEQ ID NO. 9 corresponding to InDel03 in Table 2. After confirming that the size of the transformed product matched the target band size, the clones were sent to Qingke Biotechnology Co., Ltd. for sequencing verification. Specific TA cloning procedures were performed according to the pClone007 Blunt Simple Vector Kit instructions. Variant site sequence alignment was performed using ClustalX software, and visualization was performed using GeneDoc software.

[0070] By Figure 3 It can be concluded that by cloning the InDel03 variation site of ‘Dongshi early pomelo’ and ‘Guanyuxi honey pomelo’, it is found that ‘Dongshi early pomelo’ has an insertion of 143bp and 1bp fragment and a deletion of 3bp and 2bp sequence at the site Figure 3 , wherein DSZ and GXMY represent ‘Dongshi early pomelo’ and ‘Guanyuxi honey pomelo’ respectively, it can be seen that compared with other varieties, ‘Dongshi early pomelo’ has inserted a 143bp sequence fragment, and this feature can be used to distinguish ‘Dongshi early pomelo’ from other pomelo varieties using InDel03 primer pair.

[0071] Example 2

[0072] Verification of InDel03 primer pair specific to ‘Dongshi early pomelo’

[0073] To verify the effectiveness of the screened InDel03 marker primer pair of ‘Dongshi early pomelo’, 65 pomelo varieties (Table 1) were used to expand from the initial 10 pomelo materials as verification display. The 65 pomelo citrus materials including ‘Dongshi early pomelo’ were subjected to PCR amplification using InDel03 primer pair.

[0074] The specific operation steps are as follows:

[0075] According to Example 1, the genomic DNA of 65 pomelo materials was extracted, and passed the detection of agarose gel electrophoresis, and the concentration was detected by spectrophotometer, and the concentration was diluted to 300 ng / µL for standby.

[0076] The PCR reaction system was 20 µL, and each component was 10.0 µL 2×Taq Mix, 0.5 µL F (forward primer 10 mmol / L), 0.5 µL R (reverse primer 10 mmol / L), 1.0 µL DNA (template 300 ng / L), and 8.0 µL ddH2O.

[0077] The PCR reaction program was 94℃ pre-denaturation for 5 min, 94℃ denaturation for 1 min, 55℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles, 72℃ final extension for 10 min, and 4℃ storage.

[0078] The amplification product was electrophoresed in 2.5% agarose gel (0.5×TBE buffer) and colored by Goldview, and the results were observed under the gel imaging system. The results are shown in Figure 4 , wherein M represents Marker, DSZ represents ‘Dongshi early pomelo’, and the numbers: 2~65 represent one-to-one correspondence with the pomelo varieties represented by the numbers in Table 1.

[0079] By Figure 4It can be concluded that the band of the DSZ amplified by the InDel03 marker primer is 343bp, while the amplification band of other varieties is 204bp, that is, the InDel03 marker primer can distinguish 'Dongshi Zaoyou' from 64 citrus varieties.

[0080] From the above examples, it can be concluded that the grapefruit Indel molecular marker can be used to quickly and accurately identify grapefruit varieties, especially 'Dongshi Zaoyou'.

[0081] Although the above examples have made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiments without creativity, which belong to the protection scope of the present application.

Claims

1. Application of amplification primers for grapefruit Indel molecular markers in the preparation of 'Dongshi Early Grapefruit' detection reagent, wherein the nucleotide sequences of the forward and reverse primers of the amplification primers are shown in SEQ ID NO.8 and SEQ ID NO.9, respectively.

2. Application of amplification primers for grapefruit Indel molecular markers in the identification of 'Dongshi Early Grapefruit'; the nucleotide sequences of the forward and reverse primers of the amplification primers are shown in SEQ ID NO.8 and SEQ ID NO.9, respectively.

3. Application of detection products containing amplification primers for grapefruit Indel molecular markers in the identification of 'Dongshi Early Grapefruit'; the nucleotide sequences of the forward and reverse primers of the amplification primers are shown in SEQ ID NO.8 and SEQ ID NO.9, respectively.

4. A method for identifying 'Dongshi Early Pomelo', characterized in that, Includes the following steps: Genomic DNA from the grapefruit sample to be tested was amplified using amplification primers to obtain PCR amplification products; The PCR amplification products were detected by gel electrophoresis to obtain gel electrophoretic amplification bands; The results are determined based on the size of the amplified bands in the gel electrophoresis: When the gel electrophoresis amplification band is 343bp, the grapefruit sample to be tested is 'Dongshi Early Grapefruit'; When the gel electrophoresis amplification band is 204bp, the grapefruit sample to be tested is a variety other than 'Dongshi Early Grapefruit'; The nucleotide sequences of the forward and reverse primers of the amplification primers are shown in SEQ ID NO.8 and SEQ ID NO.9, respectively.

5. The method according to claim 4, characterized in that, The PCR amplification system comprises: 10.0 µL 2×TaqMix, 0.5 µL of forward primer at a concentration of 10 mmol / L, 0.5 µL of reverse primer at a concentration of 10 mmol / L, 1.0 µL genomic DNA, and 8.0 µL ddH2O; the PCR amplification program comprises: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 1 min, 55℃ annealing for 30 s, 72℃ extension for 1 min, for 35 cycles; and 72℃ final extension for 10 min.

Citation Information

Patent Citations

  • Ma pomelo InDel (insertion-deletion) molecular marker, and application of molecular marker in differentiating rough bark Ma pomelo at early stage of citrus seed seedling

    CN108660246A

  • Method for identifying orange and pomelo varieties by using InDel marker of Sli gene

    CN118086552A