T cell receptor for recognizing SSX2 and application thereof

Abstract

The invention provides a T cell receptor (TCR) capable of being specifically combined with a short peptide AQIPEKIQK derived from an SSX2 antigen. The antigen short peptide AQIPEKIQK and HLA A1101 can form a compound, and the compound and the HLA A1101 are presented to the surface of a cell together. The invention also provides a nucleic acid molecule for coding the TCR and a carrier containing the nucleic acid molecule. In addition, the invention also provides a cell transduced with the TCR provided by the invention.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a T cell receptor that recognizes SSX2 and its application, and in particular to a TCR and its coding sequence that can recognize a short peptide derived from an SSX2 antigen, SSX2-specific T cells obtained by transducing the TCR, and their use in preventing and / or treating SSX2-related diseases. Background Art

[0002] SSX2 is the synovial sarcoma X breakpoint, also known as HOM-MEL-40. SSX2 is one of the ten highly homologous nucleic acid proteins in the SSX family. SSX protein is a tumor testis antigen, which is only expressed in tumor cells and testicular germ cells without MHC expression. After SSX2 is produced in cells, it is degraded into small molecular peptides and binds to MHC (major histocompatibility complex) molecules to form a complex, which is presented on the cell surface.

[0003] Studies have shown that AQIPEKIQK is a short peptide derived from the SSX2 antigen. SSX2 protein is expressed in a variety of tumor types, including but not limited to malignant melanoma, liver cancer, human bile duct epithelial carcinoma cells, human thyroid duct carcinoma, colon cancer, breast cancer, etc. For the treatment of the above diseases, chemotherapy and radiotherapy can be used, but both will cause damage to the body's normal cells.

[0004] T cell adoptive immunotherapy is to transfer reactive T cells that are specific to target cell antigens into the patient's body so that they can act on target cells. T cell receptor (TCR) is a membrane protein on the surface of T cells that can recognize antigenic short peptides on the surface of corresponding target cells. In the immune system, the binding of antigenic short peptide-specific TCR with short peptide-major histocompatibility complex (pMHC complex) triggers direct physical contact between T cells and antigen presenting cells (APC), and then other cell membrane surface molecules of both T cells and APC interact, causing a series of subsequent cell signaling and other physiological reactions, so that T cells with different antigen specificities can exert immune effects on their target cells.

[0005] Therefore, those skilled in the art are committed to isolating TCRs specific to short peptides of the SSX2 antigen, and transducing the TCRs into T cells to obtain T cells specific to short peptides of the SSX2 antigen, so that they can play a role in cellular immunotherapy. Summary of the invention

[0006] In view of the deficiencies in the prior art, the object of the present invention is to provide a T cell receptor that recognizes SSX2 and applications thereof.

[0007] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0008] In a first aspect of the present invention, a T cell receptor (TCR) is provided, wherein the TCR comprises a TCR α chain variable domain and a TCR β chain variable domain, and the TCR is capable of binding to the AQIPEKIQK-HLA A1101 complex.

[0009] In another preferred embodiment, the three complementarity determining regions (CDRs) of the TCRα chain variable domain are:

[0010] αCDR1-TSDQSYG SEQ ID NO:10,

[0011] αCDR2-QGSYDEQN SEQ ID NO:11,

[0012] αCDR3-AMKPGGSYIPT SEQ ID NO: 12; and

[0013] The three complementarity determining regions of the TCRβ chain variable domain are:

[0014] βCDR1-MNHNY SEQ ID NO: 13,

[0015] βCDR2-SVGAGI SEQ ID NO: 14,

[0016] βCDR3-ASSYSVTEHRGKRNEQF SEQ ID NO:15.

[0017] In another preferred example, the TCR includes a TCR α chain variable domain and a TCR β chain variable domain, the TCR α chain variable domain is an amino acid sequence having at least 90% (for example, it can be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, etc.) sequence identity with SEQ ID NO:1; and / or the TCR β chain variable domain is an amino acid sequence having at least 90% (for example, it can be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, etc.) sequence identity with SEQ ID NO:5.

[0018] In another preferred example, the TCR comprises the α chain variable domain amino acid sequence SEQ ID NO: 1.

[0019] In another preferred example, the TCR comprises the β chain variable domain amino acid sequence SEQ ID NO:5.

[0020] In another preferred embodiment, the TCR is an αβ heterodimer, and the αβ heterodimer comprises the TCRα chain constant region TRAC*01 and the TCRβ chain constant region TRBC1*01 or TRBC2*01.

[0021] In another preferred example, the amino acid sequence of the α chain of the TCR is SEQ ID NO: 3 and / or the amino acid sequence of the β chain of the TCR is SEQ ID NO: 7.

[0022] In another preferred embodiment, the TCR is of human origin.

[0023] In another preferred embodiment, the TCR is soluble.

[0024] In another preferred embodiment, the TCR is isolated or purified.

[0025] In another preferred embodiment, the TCR is single chain.

[0026] In another preferred embodiment, the TCR is composed of an α chain variable domain and a β chain variable domain connected by a peptide linker sequence.

[0027] In another preferred embodiment, the constant regions of the α and β chains of the TCR are respectively the constant regions of the α and β chains of mouse origin.

[0028] In another preferred embodiment, the TCR has one or more mutations in amino acid position 11, 13, 19, 21, 53, 76, 89, 91, or 94 of the α chain variable region, and / or the 3rd to last, 5th to last, or 7th to last amino acid of the α chain J gene short peptide; and / or the TCR has one or more mutations in amino acid position 11, 13, 19, 21, 53, 76, 89, 91, or 94 of the β chain variable region, and / or the 2nd to last, 4th to last, or 6th to last amino acid of the β chain J gene short peptide, wherein the amino acid position numbers are according to the position numbers listed in IMGT (International Immunogenetics Information System).

[0029] In another preferred example, the amino acid sequence of the α chain variable domain of the TCR comprises SEQ ID NO: 30 and / or the amino acid sequence of the β chain variable domain of the TCR comprises SEQ ID NO: 32.

[0030] In another preferred example, the amino acid sequence of the TCR is SEQ ID NO: 28.

[0031] In another preferred embodiment, the TCR comprises (a) all or part of the TCR α chain except the transmembrane domain; and (b) all or part of the TCR β chain except the transmembrane domain;

[0032] And (a) and (b) each comprise a functional variable domain, or comprise a functional variable domain and at least a portion of the TCR chain constant domain.

[0033] In another preferred embodiment, the cysteine ​​residues form an artificial disulfide bond between the constant domains of the α and β chains of the TCR.

[0034] In another preferred embodiment, the cysteine ​​residues forming artificial disulfide bonds in the TCR are substituted with one or more groups of sites selected from the following:

[0035] Thr48 of exon 1 of TRAC*01 and Ser57 of exon 1 of TRBC1*01 or TRBC2*01;

[0036] Thr45 of exon 1 of TRAC*01 and Ser77 of exon 1 of TRBC1*01 or TRBC2*01;

[0037] Tyr10 of exon 1 of TRAC*01 and Ser17 of exon 1 of TRBC1*01 or TRBC2*01;

[0038] Thr45 of exon 1 of TRAC*01 and Asp59 of exon 1 of TRBC1*01 or TRBC2*01;

[0039] Ser15 of exon 1 of TRAC*01 and Glu15 of exon 1 of TRBC1*01 or TRBC2*01;

[0040] Arg53 of exon 1 of TRAC*01 and Ser54 of exon 1 of TRBC1*01 or TRBC2*01;

[0041] Pro89 of exon 1 of TRAC*01 and Ala19 of exon 1 of TRBC1*01 or TRBC2*01;

[0042] or Tyr10 of exon 1 of TRAC*01 and Glu20 of exon 1 of TRBC1*01 or TRBC2*01.

[0043] In another preferred example, the amino acid sequence of the α chain of the TCR is SEQ ID NO: 26 and / or the amino acid sequence of the β chain of the TCR is SEQ ID NO: 27.

[0044] In another preferred embodiment, an artificial interchain disulfide bond is contained between the α chain variable region and the β chain constant region of the TCR.

[0045] In another preferred embodiment, the cysteine ​​residues that form artificial interchain disulfide bonds in the TCR are substituted with one or more groups of sites selected from the following:

[0046] amino acid 46 of TRAV and amino acid 60 of exon 1 of TRBC1*01 or TRBC2*01;

[0047] amino acid 47 of TRAV and amino acid 61 of exon 1 of TRBC1*01 or TRBC2*01;

[0048] amino acid 46 of TRAV and amino acid 61 of exon 1 of TRBC1*01 or TRBC2*01;

[0049] or amino acid 47 of TRAV and amino acid 60 of exon 1 of TRBC1*01 or TRBC2*01.

[0050] In another preferred embodiment, the TCR comprises an α chain variable domain and a β chain variable domain and all or part of the β chain constant domain excluding the transmembrane domain, but does not comprise an α chain constant domain, and the α chain variable domain of the TCR forms a heterodimer with the β chain.

[0051] In another preferred embodiment, a conjugate is bound to the C- or N-terminus of the α chain of the TCR, and / or a conjugate is bound to the C- or N-terminus of the β chain of the TCR.

[0052] In another preferred embodiment, the conjugate binding to the T cell receptor comprises any one or a combination of at least two of a detectable marker, a therapeutic agent and a PK modifying moiety.

[0053] Preferably, the therapeutic agent is an anti-CD3 antibody.

[0054] The second aspect of the present invention provides a multivalent TCR complex, wherein the multivalent TCR complex comprises at least two TCR molecules, and at least one of the TCR molecules is the TCR described in the first aspect.

[0055] The third aspect of the present invention provides a nucleic acid molecule, which comprises a nucleotide sequence encoding the TCR described in the first aspect of the present invention, and / or a complementary sequence of the nucleotide sequence encoding the TCR described in the first aspect of the present invention.

[0056] In another preferred embodiment, the nucleic acid molecule is isolated or purified.

[0057] In another preferred example, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO: 2 or SEQ ID NO: 31 encoding the variable domain of the TCR α chain.

[0058] In another preferred example, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO: 6 or SEQ ID NO: 33 encoding the variable domain of the TCR β chain.

[0059] In another preferred example, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO:4 encoding the TCRα chain and / or comprises the nucleotide sequence SEQ ID NO:8 encoding the TCRβ chain.

[0060] The fourth aspect of the present invention provides a vector, wherein the vector contains the nucleic acid molecule described in the third aspect of the present invention.

[0061] Preferably, the vector is a viral vector.

[0062] Preferably, the viral vector is a lentiviral vector.

[0063] The fifth aspect of the present invention provides an isolated host cell, wherein the isolated host cell contains the vector described in the fourth aspect of the present invention, or the exogenous nucleic acid molecule described in the third aspect of the present invention is integrated into the genome of the isolated host cell.

[0064] The sixth aspect of the present invention provides a cell, wherein the cell is transduced with the nucleic acid molecule described in the third aspect of the present invention or the vector described in the fourth aspect of the present invention.

[0065] Preferably, the cells include T cells, NK cells, NKT cells or stem cells.

[0066] The seventh aspect of the present invention provides a pharmaceutical composition, which comprises any one or a combination of at least two of the TCR described in the first aspect of the present invention, the multivalent TCR complex described in the second aspect of the present invention, the nucleic acid molecule described in the third aspect of the present invention, the vector described in the fourth aspect of the present invention, and the cell described in the sixth aspect of the present invention.

[0067] Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

[0068] The eighth aspect of the present invention provides the use of any one or a combination of at least two of the TCR described in the first aspect of the present invention, the multivalent TCR complex described in the second aspect of the present invention, and the cell described in the sixth aspect of the present invention, wherein the use includes the preparation of a drug for treating tumors or autoimmune diseases.

[0069] Preferably, the tumor includes SSX2-positive tumors, including but not limited to malignant melanoma, liver cancer, human bile duct epithelial carcinoma cells, human thyroid duct carcinoma, colon cancer, breast cancer, etc.

[0070] The ninth aspect of the present invention provides the TCR described in the first aspect of the present invention, the multivalent TCR complex described in the second aspect of the present invention, or the cell described in the sixth aspect of the present invention for use as a drug for treating tumors or autoimmune diseases.

[0071] Preferably, the tumor includes SSX2-positive tumors, including but not limited to malignant melanoma, liver cancer, human bile duct epithelial carcinoma cells, human thyroid duct carcinoma, colon cancer, breast cancer, etc.

[0072] The tenth aspect of the present invention provides a method for treating a disease, comprising administering to a subject in need of treatment an appropriate amount of any one or a combination of at least two of the TCR described in the first aspect of the present invention, the TCR complex described in the second aspect of the present invention, the cell described in the sixth aspect of the present invention, and the pharmaceutical composition described in the seventh aspect of the present invention.

[0073] Preferably, the disease comprises a tumor.

[0074] Preferably, the tumor includes SSX2-positive tumors, including but not limited to malignant melanoma, liver cancer, human bile duct epithelial carcinoma cells, human thyroid duct carcinoma, colon cancer, breast cancer, etc.

[0075] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here.

[0076] The numerical range described in the present invention not only includes the point values ​​listed above, but also includes any point values ​​between the above numerical ranges that are not listed. Due to space limitations and for the sake of simplicity, the present invention no longer exhaustively lists the specific point values ​​included in the range.

[0077] Compared with the conventional technology, the present invention has the following beneficial effects:

[0078] The TCR of the present invention can specifically bind to the SSX2 antigen short peptide complex AQIPEKIQK-HLA A1101, and the effector cells transduced with the TCR of the present invention can be specifically activated. BRIEF DESCRIPTION OF THE DRAWINGS

[0079] Figure 1 This is the result of double positive staining of CD8-APC and tetramer-PE of monoclonal cells;

[0080] Figure 2a and Figure 2b is the SDS-PAGE electrophoresis gel image of the soluble TCR obtained after purification; wherein, Figure 2a and Figure 2b The right lanes are non-reducing gel and reducing gel, and the left lanes are all molecular weight markers.

[0081] Figure 3 is the SDS-PAGE electrophoresis gel image of the soluble single-chain TCR obtained after purification; wherein, Figure 3 The right lane is non-reducing gel, and the left lane is a molecular weight marker;

[0082] Figure 4 The BIAcore kinetic profile of the binding of soluble TCR to the AQIPEKIQK-HLA A1101 complex;

[0083] Figure 5 The BIAcore kinetic profile of the binding of soluble single-chain TCR to the AQIPEKIQK-HLA A1101 complex;

[0084] Figure 6 The results of ELISPOT activation function verification of the obtained T cell clones;

[0085] Figure 7 The results of ELISPOT activation function verification of effector cells transfected with the TCR of the present invention for T2 cells loaded with short peptides;

[0086] Figure 8 The results of the activation function experiments of effector cells transfected with the TCR of the present invention against tumor cell lines;

[0087] Fig. 9 The results of LDH experiments on the killing function of effector cells transfected with the TCR of the present invention against tumor cell lines. DETAILED DESCRIPTION

[0088] After extensive and in-depth research, the inventors have found a TCR that can specifically bind to the SSX2 antigen short peptide AQIPEKIQK (SEQ ID NO: 9), which can form a complex with HLA A1101 and be presented to the cell surface together. The present invention also provides a nucleic acid molecule encoding the TCR and a vector containing the nucleic acid molecule. In addition, the present invention also provides a cell transducing the TCR of the present invention.

[0089] the term

[0090] MHC molecules are proteins of the immunoglobulin superfamily and can be either class I or class II MHC molecules. Therefore, they are specific for antigen presentation. Different individuals have different MHCs that can present different short peptides in a protein antigen to the surface of their respective APC cells. Human MHC is usually called HLA gene or HLA complex.

[0091] T cell receptor (TCR) is the only receptor for specific antigenic peptides presented on the major histocompatibility complex (MHC). In the immune system, the binding of antigen-specific TCR to pMHC complex triggers direct physical contact between T cells and antigen-presenting cells (APC), and then other cell membrane surface molecules of both T cells and APC interact, which causes a series of subsequent cell signaling and other physiological reactions, so that T cells with different antigen specificities can exert immune effects on their target cells.

[0092] TCR is a glycoprotein on the cell membrane surface that exists in the form of a heterodimer of α chain / β chain or γ chain / δ chain. In 95% of T cells, TCR heterodimers are composed of α and β chains, while 5% of T cells have TCRs composed of γ and δ chains. Natural αβ heterodimeric TCR has α chain and β chain, which constitute the subunits of αβ heterodimeric TCR. Broadly speaking, each α and β chain contains a variable region, a connecting region and a constant region. The β chain usually also contains a short variable region between the variable region and the connecting region, but the variable region is often regarded as part of the connecting region. Each variable region contains three CDRs (complementarity determining regions), CDR1, CDR2 and CDR3, embedded in the framework region. The CDR region determines the binding of TCR to the pMHC complex, among which CDR3 is recombined by the variable region and the connecting region and is called the hypervariable region. The α and β chains of TCR are generally considered to have two "domains" each, namely the variable domain and the constant domain. The variable domain is composed of a connected variable region and a connecting region. The sequence of the TCR constant domain can be found in the public database of the International Immunogenetics Information System (IMGT), such as the constant domain sequence of the TCR molecule α chain is "TRAC*01", and the constant domain sequence of the TCR molecule β chain is "TRBC1*01" or "TRBC2*01". In addition, the α and β chains of TCR also contain transmembrane regions and cytoplasmic regions, and the cytoplasmic region is very short.

[0093] In the present invention, the terms "polypeptide of the present invention", "TCR of the present invention" and "T cell receptor of the present invention" are used interchangeably.

[0094] Natural interchain disulfide bonds and artificial interchain disulfide bonds

[0095] There is a set of disulfide bonds between the Cα and Cβ chains in the membrane-proximal region of the natural TCR, which are referred to as "natural interchain disulfide bonds" in the present invention. In the present invention, the artificially introduced interchain covalent disulfide bonds whose positions are different from those of the natural interchain disulfide bonds are referred to as "artificial interchain disulfide bonds".

[0096] To facilitate the description of the position of the disulfide bond, the position numbers of the amino acid sequences of TRAC*01 and TRBC1*01 or TRBC2*01 in the present invention are numbered in order from the N-terminus to the C-terminus. For example, in TRBC1*01 or TRBC2*01, the 60th amino acid in the order from the N-terminus to the C-terminus is P (proline), then in the present invention it can be described as Pro60 of exon 1 of TRBC1*01 or TRBC2*01, or it can be expressed as the 60th amino acid in exon 1 of TRBC1*01 or TRBC2*01. For example, in TRBC1*01 or TRBC2*01, the 61st amino acid in the order from the N-terminus to the C-terminus is Q (glutamine), then in the present invention it can be described as Gln61 of exon 1 of TRBC1*01 or TRBC2*01, or it can be expressed as the 61st amino acid in exon 1 of TRBC1*01 or TRBC2*01, and so on. In the present invention, the position numbers of the amino acid sequences of variable regions TRAV and TRBV follow the position numbers listed in IMGT. For example, if a certain amino acid in TRAV is numbered 46 in IMGT, it will be described as the 46th amino acid in TRAV in the present invention, and so on. In the present invention, if there are special instructions for the sequence position numbers of other amino acids, they will be followed according to the special instructions. DETAILED DESCRIPTION OF THE INVENTION

[0098] TCR molecules

[0099] During antigen processing, the antigen is degraded in the cell and then carried to the cell surface by MHC molecules. T cell receptors can recognize peptide-MHC complexes on the surface of antigen presenting cells. Therefore, the first aspect of the present application provides a TCR molecule that can bind to the AQIPEKIQK-HLA A1101 complex.

[0100] Preferably, the TCR molecule is isolated or purified. The α and β chains of the TCR each have three complementarity determining regions (CDRs).

[0101] In a preferred embodiment of the present application, the α chain of the TCR comprises a CDR having the following amino acid sequence:

[0102] αCDR1-TSDQSYG SEQ ID NO:10,

[0103] αCDR2-QGSYDEQN SEQ ID NO:11,

[0104] αCDR3-AMKPGGSYIPT SEQ ID NO: 12; and / or

[0105] The three complementarity determining regions of the TCRβ chain variable domain are:

[0106] βCDR1-MNHNY SEQ ID NO: 13,

[0107] βCDR2-SVGAGI SEQ ID NO: 14,

[0108] βCDR3-ASSYSVTEHRGKRNEQF SEQ ID NO:15.

[0109] The CDR region amino acid sequence of the present invention can be embedded into any suitable framework structure to prepare a chimeric TCR. As long as the framework structure is compatible with the CDR region of the TCR of the present invention, a person skilled in the art can design or synthesize a TCR molecule with corresponding functions based on the CDR region disclosed in the present invention. Therefore, the TCR molecule of the present invention refers to a TCR molecule comprising the above-mentioned α and / or β chain CDR region sequence and any suitable framework structure.

[0110] The TCR α chain variable domain of the present invention is an amino acid sequence having at least 90%, preferably 95%, and more preferably 98% sequence identity with SEQ ID NO: 1;

[0111] And / or the TCR β chain variable domain of the present invention is an amino acid sequence having at least 90%, preferably 95%, more preferably 98% sequence identity with SEQ ID NO:5.

[0112] In a preferred embodiment of the present invention, the TCR molecule of the present invention is a heterodimer composed of α and β chains. Specifically, on the one hand, the α chain of the heterodimeric TCR molecule comprises a variable domain and a constant domain, and the amino acid sequence of the α chain variable domain comprises CDR1 (SEQ ID NO: 10), CDR2 (SEQ ID NO: 11) and CDR3 (SEQ ID NO: 12) of the above-mentioned α chain.

[0113] Preferably, the TCR molecule comprises the α chain variable domain amino acid sequence SEQ ID NO:1.

[0114] More preferably, the amino acid sequence of the α chain variable domain of the TCR molecule is SEQ ID NO: 1.

[0115] On the other hand, the β chain of the heterodimeric TCR molecule comprises a variable domain and a constant domain, and the amino acid sequence of the β chain variable domain comprises CDR1 (SEQ ID NO: 13), CDR2 (SEQ ID NO: 14) and CDR3 (SEQ ID NO: 15) of the above-mentioned β chain.

[0116] Preferably, the TCR molecule comprises the β chain variable domain amino acid sequence SEQ ID NO:5.

[0117] More preferably, the amino acid sequence of the β chain variable domain of the TCR molecule is SEQ ID NO:5.

[0118] In a preferred embodiment of the present invention, the TCR molecule of the present invention is a single-chain TCR molecule composed of part or all of the α chain and / or part or all of the β chain. For the description of the single-chain TCR molecule, reference can be made to the document Chung et al (1994) Proc. Natl. Acad. Sci. USA 91, 12654-12658. According to the document, those skilled in the art can easily construct a single-chain TCR molecule comprising the CDRs region of the present invention. Specifically, the single-chain TCR molecule comprises Vα, Vβ and Cβ, preferably connected in the order from N-terminus to C-terminus.

[0119] The amino acid sequence of the α chain variable domain of the single-chain TCR molecule comprises CDR1 (SEQ ID NO: 10), CDR2 (SEQ ID NO: 11) and CDR3 (SEQ ID NO: 12) of the above-mentioned α chain.

[0120] Preferably, the single-chain TCR molecule comprises the α chain variable domain amino acid sequence SEQ ID NO:1.

[0121] More preferably, the amino acid sequence of the α chain variable domain of the single-chain TCR molecule is SEQ ID NO: 1.

[0122] The amino acid sequence of the β chain variable domain of the single-chain TCR molecule comprises CDR1 (SEQ ID NO: 13), CDR2 (SEQ ID NO: 14) and CDR3 (SEQ ID NO: 15) of the above-mentioned β chain.

[0123] Preferably, the single-chain TCR molecule comprises the β chain variable domain amino acid sequence SEQ ID NO:5.

[0124] More preferably, the amino acid sequence of the β chain variable domain of the single-chain TCR molecule is SEQ ID NO:5.

[0125] In a preferred embodiment of the present invention, the constant domain of the TCR molecule of the present invention is a human constant domain. Those skilled in the art know or can obtain the constant domain amino acid sequence of a human by consulting relevant books or the public database of IMGT (International Immunogenetics Information System). For example, the constant domain sequence of the α chain of the TCR molecule of the present invention may be "TRAC*01", and the constant domain sequence of the β chain of the TCR molecule may be "TRBC1*01" or "TRBC2*01". The 53rd position of the amino acid sequence given in TRAC*01 of IMGT is Arg, which is represented herein as: Arg53 of TRAC*01 exon 1, and the same applies to the others. Preferably, the amino acid sequence of the α chain of the TCR molecule of the present invention is SEQ ID NO: 3, and / or the amino acid sequence of the β chain is SEQ ID NO: 7.

[0126] The naturally occurring TCR is a membrane protein that is stabilized by its transmembrane region. Just like immunoglobulins (antibodies) as antigen recognition molecules, TCRs can also be developed for diagnosis and treatment, and soluble TCR molecules need to be obtained. Soluble TCR molecules do not include their transmembrane regions. Soluble TCRs have a wide range of uses. They can not only be used to study the interaction between TCR and pMHC, but can also be used as a diagnostic tool for detecting infections or as a marker for autoimmune diseases. Similarly, soluble TCRs can be used to deliver therapeutic agents (such as cytotoxic compounds or immunostimulatory compounds) to cells presenting specific antigens. In addition, soluble TCRs can also be combined with other molecules (such as anti-CD3 antibodies) to redirect T cells, thereby targeting cells presenting specific antigens. The present invention also obtains soluble TCRs that are specific to short peptides of the SSX2 antigen.

[0127] To obtain a soluble TCR, on the one hand, the TCR of the present invention can be a TCR in which an artificial disulfide bond is introduced between the residues of the α and β chain constant domains. The cysteine ​​residues form an artificial interchain disulfide bond between the α and β chain constant domains of the TCR. The cysteine ​​residues can replace other amino acid residues at appropriate sites in the natural TCR to form an artificial interchain disulfide bond. For example, the cysteine ​​residues that replace Thr48 of TRAC*01 exon 1 and replace Ser57 of TRBC1*01 or TRBC2*01 exon 1 form a disulfide bond. Other sites for introducing cysteine ​​residues to form disulfide bonds can also be:

[0128] Thr45 of exon 1 of TRAC*01 and Ser77 of exon 1 of TRBC1*01 or TRBC2*01;

[0129] Tyr10 of exon 1 of TRAC*01 and Ser17 of exon 1 of TRBC1*01 or TRBC2*01;

[0130] Thr45 of exon 1 of TRAC*01 and Asp59 of exon 1 of TRBC1*01 or TRBC2*01;

[0131] Ser15 of exon 1 of TRAC*01 and Glu15 of exon 1 of TRBC1*01 or TRBC2*01;

[0132] Arg53 of exon 1 of TRAC*01 and Ser54 of exon 1 of TRBC1*01 or TRBC2*01;

[0133] Pro89 of exon 1 of TRAC*01 and Ala19 of exon 1 of TRBC1*01 or TRBC2*01;

[0134] or Tyr10 of exon 1 of TRAC*01 and Glu20 of exon 1 of TRBC1*01 or TRBC2*01.

[0135] That is, cysteine ​​residues replace any of the above-mentioned α and β chain constant domains. Up to 50, or up to 30, or up to 15, or up to 10, or up to 8 or fewer amino acids may be truncated at one or more C-termini of the TCR constant domain of the present invention so that it does not include cysteine ​​residues to achieve the purpose of missing natural disulfide bonds, and the above purpose may also be achieved by mutating the cysteine ​​residues that form natural disulfide bonds to another amino acid.

[0136] As described above, the TCR of the present invention may contain artificial disulfide bonds introduced between residues of the constant domains of its α and β chains. It should be noted that the TCR of the present invention may contain a TRAC constant domain sequence and a TRBC1 or TRBC2 constant domain sequence, with or without the artificial disulfide bonds introduced as described above between the constant domains. The TRAC constant domain sequence and the TRBC1 or TRBC2 constant domain sequence of the TCR may be linked by a natural disulfide bond present in the TCR.

[0137] To obtain a soluble TCR, on the other hand, the TCR of the present invention also includes a TCR mutated in its hydrophobic core region, and the mutations in these hydrophobic core regions are preferably mutations that can improve the stability of the soluble TCR of the present invention, as described in the patent document with publication number WO2014 / 206304. Such a TCR may mutate at the following variable domain hydrophobic core positions: (α and / or β chain) variable region amino acids 11, 13, 19, 21, 53, 76, 89, 91, 94, and / or α chain J gene (TRAJ) short peptide amino acid position penultimate 3, 5, 7, and / or β chain J gene (TRBJ) short peptide amino acid position penultimate 2, 4, 6, wherein the position numbering of the amino acid sequence is according to the position numbering listed in the International Immunogenetics Information System (IMGT). Those skilled in the art are aware of the above-mentioned International Immunogenetics Information System, and can obtain the position numbering of the amino acid residues of different TCRs in IMGT according to the database.

[0138] The TCR with a mutation in the hydrophobic core region of the present invention can be a stable soluble single-chain TCR composed of a flexible peptide chain connecting the variable domains of the α and β chains of the TCR. It should be noted that the flexible peptide chain in the present invention can be any peptide chain suitable for connecting the variable domains of the α and β chains of the TCR.

[0139] In addition, in terms of stability, patent document 201680003540.2 also discloses that the introduction of an artificial interchain disulfide bond between the α chain variable region and the β chain constant region of the TCR can significantly improve the stability of the TCR. Therefore, the α chain variable region and the β chain constant region of the TCR of the present invention may also contain an artificial interchain disulfide bond. Specifically, the cysteine ​​residue that forms the artificial interchain disulfide bond between the α chain variable region and the β chain constant region of the TCR is replaced by:

[0140] amino acid 46 of TRAV and amino acid 60 of exon 1 of TRBC1*01 or TRBC2*01;

[0141] amino acid 47 of TRAV and amino acid 61 of exon 1 of TRBC1*01 or TRBC2*01;

[0142] amino acid 46 of TRAV and amino acid 61 of exon 1 of TRBC1*01 or TRBC2*01;

[0143] or amino acid 47 of TRAV and amino acid 60 of exon 1 of TRBC1*01 or TRBC2*01.

[0144] Preferably, such a TCR may comprise (i) all or part of the TCR α chain excluding its transmembrane domain, and (ii) all or part of the TCR β chain excluding its transmembrane domain, wherein (i) and (ii) both comprise the variable domain and at least a portion of the constant domain of the TCR chain, and the α chain and the β chain form a heterodimer.

[0145] More preferably, such a TCR may comprise an α chain variable domain and a β chain variable domain and all or part of the β chain constant domain excluding the transmembrane domain, but does not comprise an α chain constant domain, and the α chain variable domain of the TCR forms a heterodimer with the β chain.

[0146] The TCR of the present invention can also be provided in the form of a multivalent complex. The multivalent TCR complex of the present invention comprises a polymer formed by combining two, three, four or more TCRs of the present invention, such as a tetramerization domain of p53 can be used to produce a tetramer, or a complex formed by combining multiple TCRs of the present invention with another molecule. The TCR complex of the present invention can be used to track or target cells presenting specific antigens in vitro or in vivo, and can also be used to produce intermediates of other multivalent TCR complexes with such applications.

[0147] The TCR of the present invention can be used alone or in combination with a conjugate, preferably covalently, wherein the conjugate includes a detectable marker (for diagnostic purposes, wherein the TCR is used to detect the presence of cells presenting the AQIPEKIQK-HLA A1101 complex), a therapeutic agent, a PK (protein kinase) modifying moiety, or any combination of these substances.

[0148] Detectable labels for diagnostic purposes include, but are not limited to, fluorescent or luminescent labels, radioactive labels, MRI (magnetic resonance imaging) or CT (computed tomography) contrast agents, or enzymes capable of producing a detectable product.

[0149] Therapeutic agents that can be combined or coupled to the TCR of the present invention include, but are not limited to:

[0150] 1. Radionuclides (Koppe et al., 2005, Cancer metastasis reviews 24, 539);

[0151] 2. Biological toxins (Chaudhary et al., 1989, Nature 339, 394; Epel et al., 2002, Cancer Immunology and Immunotherapy 51, 565);

[0152] 3. Cytokines such as IL-2 (Gillies et al., 1992, Proceedings of the National Academy of Sciences (PNAS) 89, 1428; Card et al., 2004, Cancer Immunology and Immunotherapy 53, 345; Halin et al., 2003, Cancer Research 63, 3202);

[0153] 4. Antibody Fc fragment (Mosquera et al., 2005, The Journal of Immunology 174, 4381);

[0154] 5. Antibody scFv fragment (Zhu et al., 1995, International Journal of Cancer 62, 319);

[0155] 6. Gold nanoparticles / nanorods (Lapotko et al., 2005, Cancer letters 239, 36; Huang et al., 2006, Journal of the American Chemical Society 128, 2115);

[0156] 7. Virus particles (Peng et al., 2004, Gene therapy 11, 1234);

[0157] 8. Liposomes (Mamot et al., 2005, Cancer Research 65, 11631);

[0158] 9.Nanomagnetic particles;

[0159] 10. Prodrug activating enzymes (e.g., DT-diaphorase (DTD) or biphenyl hydrolase-like protein (BPHL));

[0160] 11. Chemotherapeutic agents (e.g., cisplatin) or nanoparticles in any form, etc.

[0161] In addition, the TCR of the present invention can also be a hybrid TCR comprising sequences derived from more than one species. For example, studies have shown that murine TCR can be expressed more effectively in human T cells than human TCR. Therefore, the TCR of the present invention can comprise human variable domains and mouse constant domains. The drawback of this method is that an immune response may be induced. Therefore, when it is used for adoptive T cell therapy, there should be a regulatory scheme to perform immunosuppression to allow the implantation of murine T cells expressing murine T cells.

[0162] It should be understood that the amino acid names herein are represented by single letters or three letters in the internationally accepted manner, and the correspondence between single letters and three letters of the amino acid names is as follows: Ala (A), Arg (R), Asn (N), Asp (D), Cys (C), Gln (Q), Glu (E), Gly (G), His (H), Ile (I), Leu (L), Lys (K), Met (M), Phe (F), Pro (P), Ser (S), Thr (T), Trp (W), Tyr (Y), Val (V).

[0163] Nucleic acid molecules

[0164] The second aspect of the present invention provides a nucleic acid molecule encoding the TCR molecule or a portion thereof of the first aspect of the present invention, wherein the portion may be one or more CDRs, the variable domains of the α and / or β chains, and the α chain and / or β chain.

[0165] The nucleotide sequence encoding the CDR region of the α chain of the TCR molecule of the first aspect of the present invention is as follows:

[0166] CDR1α-accagtgatcaaagttatggt SEQ ID NO:16,

[0167] CDR2α-caggggtcttatgacgagcaaaat SEQ ID NO: 17,

[0168] CDR3α-gcaatgaaaccgggaggaagctacatacctaca SEQ ID NO: 18.

[0169] The nucleotide sequence encoding the CDR region of the β chain of the TCR molecule of the first aspect of the present invention is as follows:

[0170] CDR1β-atgaaccataactac SEQ ID NO:19,

[0171] CDR2β-tcagttggtgctggtatc SEQ ID NO: 20,

[0172] CDR3β-gccagcagttactcggtcaccgagcacagaggaaaacggaatgagcagttc SEQ ID NO: 21.

[0173] Therefore, the nucleotide sequence of the nucleic acid molecule encoding the TCR α chain of the present invention includes SEQ ID NO:16, SEQ ID NO:17 and SEQ ID NO:18, and / or the nucleotide sequence of the nucleic acid molecule encoding the TCR β chain of the present invention includes SEQ ID NO:19, SEQ ID NO:20 and SEQ ID NO:21.

[0174] The nucleotide sequence of the nucleic acid molecule of the present invention may be single-stranded or double-stranded, the nucleic acid molecule may be RNA or DNA, and may or may not contain introns.

[0175] Preferably, the nucleotide sequence of the nucleic acid molecule of the present invention does not contain introns but can encode the polypeptide of the present invention, for example, the nucleotide sequence of the nucleic acid molecule encoding the TCR α chain variable domain of the present invention includes SEQ ID NO: 2, and / or the nucleotide sequence of the nucleic acid molecule encoding the TCR β chain variable domain of the present invention includes SEQ ID NO: 6. Alternatively, the nucleotide sequence of the nucleic acid molecule encoding the TCR α chain variable domain of the present invention includes SEG ID NO: 31, and / or the nucleotide sequence of the nucleic acid molecule encoding the TCR β chain variable domain of the present invention includes SEG ID NO: 33.

[0176] More preferably, the nucleotide sequence of the nucleic acid molecule of the present invention comprises SEQ ID NO: 4 and / or SEQ ID NO: 8. Alternatively, the nucleotide sequence of the nucleic acid molecule of the present invention is SEQ ID NO: 29.

[0177] It should be understood that due to the degeneracy of the genetic code, different nucleotide sequences can encode the same polypeptide. Therefore, the nucleic acid sequence encoding the TCR of the present invention can be the same as the nucleic acid sequence shown in the present invention or a degenerate variant. Taking one of the examples in the present invention as an example, a "degenerate variant" refers to a nucleic acid sequence that encodes a protein sequence having SEQ ID NO: 1, but is different from the nucleotide sequence of SEQ ID NO: 2.

[0178] The nucleotide sequence may be codon optimized. Different cells differ in the use of specific codons, and the codons in the sequence may be altered to increase expression depending on the cell type. Codon usage tables for mammalian cells and a variety of other organisms are well known to those skilled in the art.

[0179] The full-length sequence of the nucleic acid molecule of the present invention or its fragment can usually be obtained by, but not limited to, PCR amplification, recombination or artificial synthesis. At present, the DNA sequence encoding the TCR of the present invention (or its fragment, or its derivative) can be obtained completely by chemical synthesis. The DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. The DNA can be a coding strand or a non-coding strand.

[0180] Carrier

[0181] The present invention also relates to vectors comprising the nucleic acid molecules of the present invention, including expression vectors, i.e. constructs capable of in vivo or in vitro expression. Commonly used vectors include bacterial plasmids, bacteriophages, and animal and plant viruses.

[0182] Viral delivery systems include, but are not limited to, adenoviral vectors, adeno-associated viral (AAV) vectors, herpes viral vectors, retroviral vectors, lentiviral vectors, baculoviral vectors.

[0183] Preferably, the vector can transfer the nucleotide of the present invention into cells, such as T cells, so that the cells express TCR specific for the SSX2 antigen. Ideally, the vector should be able to be expressed at a high level in T cells.

[0184] cell

[0185] The present invention also relates to a host cell produced by genetic engineering using the vector or coding sequence of the present invention. The host cell contains the vector of the present invention or has the nucleic acid molecule of the present invention integrated into the chromosome. The host cell is selected from: prokaryotic cells and eukaryotic cells, such as Escherichia coli, yeast cells or CHO cells.

[0186] In addition, the present invention also includes isolated cells expressing the TCR of the present invention, which may be, but are not limited to, T cells, NK cells, NKT cells, stem cells, and in particular T cells. The T cells may be derived from T cells isolated from a subject, or may be a mixed cell population isolated from a subject, such as a portion of a peripheral blood lymphocyte (PBL) population. For example, the cells may be isolated from peripheral blood mononuclear cells (PBMCs), which may be CD4 + Helper T cells or CD8 + Cytotoxic T cells. These cells can be found in CD4 + Helper T cells / CD8 + In a mixed population of cytotoxic T cells. Generally, the cells can be activated with antibodies (e.g., anti-CD3 or anti-CD28 antibodies) to make them more receptive to transfection, for example, with a vector comprising a nucleotide sequence encoding a TCR molecule of the invention.

[0187] Alternatively, the cells of the present invention may also be or be derived from stem cells, such as hematopoietic stem cells (HSC). Gene transfer to HSC will not result in TCR expression on the cell surface, because CD3 molecules are not expressed on the stem cell surface. However, when stem cells differentiate into lymphoid precursors that migrate to the thymus, the expression of CD3 molecules will initiate the expression of the introduced TCR molecules on the surface of thymocytes.

[0188] There are many methods suitable for transfecting T cells with DNA or RNA encoding the TCR of the present invention (e.g., Robbins et al., (2008) J. Immunol. 180: 6116-6131). T cells expressing the TCR of the present invention can be used for adoptive immunotherapy. Those skilled in the art will be aware of many suitable methods for adoptive therapy (e.g., Rosenberg et al., (2008) Nat Rev Cancer 8(4): 299-308).

[0189] SSX2 antigen-associated diseases

[0190] The present invention also relates to a method for treating and / or preventing SSX2-related diseases in a subject, including but not limited to malignant melanoma, liver cancer, human bile duct epithelial carcinoma cells, human thyroid duct carcinoma, colon cancer, breast cancer, etc., comprising the step of adoptively transferring SSX2-specific T cells to the subject. The SSX2-specific T cells can recognize the AQIPEKIQK-HLAA1101 complex.

[0191] The SSX2-specific T cells of the present invention can be used to treat any SSX2-related diseases presenting the SSX2 antigen short peptide AQIPEKIQK-HLAA1101 complex, including but not limited to malignant melanoma, liver cancer, human bile duct epithelial carcinoma cells, human thyroid duct carcinoma, colon cancer, breast cancer, etc.

[0192] Treatment

[0193] Treatment can be performed by isolating T cells from patients or volunteers suffering from diseases associated with the SSX2 antigen, including but not limited to malignant melanoma, liver cancer, human bile duct epithelial carcinoma cells, human thyroid duct carcinoma, colon cancer, breast cancer, etc., and introducing the TCR of the present invention into the above-mentioned T cells, and then returning these genetically modified cells to the patient. Therefore, the present invention provides a method for treating SSX2-related diseases, including but not limited to malignant melanoma, liver cancer, human bile duct epithelial carcinoma cells, human thyroid duct carcinoma, colon cancer, breast cancer, etc., comprising transferring separated T cells expressing the TCR of the present invention, preferably, the T cells are derived from the patient himself, into the patient. Generally, it includes (1) isolating T cells from the patient, (2) transducing T cells in vitro with the nucleic acid molecules of the present invention or nucleic acid molecules capable of encoding the TCR molecules of the present invention, and (3) transferring the genetically modified T cells into the patient. The number of cells to be isolated, transfected and returned can be determined by the physician.

[0194] The main advantages of the present invention are:

[0195] The TCR of the present invention can specifically bind to the SSX2 antigen short peptide complex AQIPEKIQK-HLA A1101, and the effector cells transduced with the TCR of the present invention can be specifically activated.

[0196] The following specific examples further illustrate the present invention. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually performed under conventional conditions, such as (Sambrook and Russell et al., Molecular Cloning: Laboratory Manual (Molecular Cloning-A Laboratory Manual) (3rd Edition) (2001) CSHL Press), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight. Unless otherwise stated, percentages and parts are calculated by weight. The experimental materials and reagents used in the following examples can be obtained from commercial channels unless otherwise stated.

[0197] Example 1 Cloning of SSX2 antigen short peptide-specific T cells

[0198] The synthetic short peptide AQIPEKIQK (SEQ ID NO: 9, synthesized by Jiangsu GenScript Biotechnology Co., Ltd.) was used to stimulate peripheral blood lymphocytes (PBL) from healthy volunteers with the genotype of HLA-A1101. The AQIPEKIQK short peptide was renatured with HLA-A1101 labeled with biotin to prepare pMHC haploids. These haploids were combined with PE-labeled streptavidin (BD Company) to form PE-labeled tetramers, and the tetramers and anti-CD8-APC double-positive cells were sorted. The sorted cells were amplified, and secondary sorting was performed according to the above method, followed by monocloning by limiting dilution. The monoclonal cells were stained with tetramers, and the double-positive clones screened were as follows. Figure 1 As shown, Figure 1 This is the result of double positive staining of CD8-APC and tetramer-PE of monoclonal cells. Double positive clones obtained after layers of screening need to meet further functional tests.

[0199] IFN-γ is a powerful immunomodulatory factor produced by activated T lymphocytes, so this embodiment detects the number of IFN-γ by an ELISPOT experiment well known to those skilled in the art to verify the activation function and antigen specificity of the cells transfected with the TCR of the present invention. The function and specificity of the T cell clones were further detected by ELISPOT experiments. The effector cells used in the IFN-γ ELISPOT experiment of this embodiment are T cell clones obtained in the present invention, and the target cells are T2-A11 cells (referring to T2 cells transfected with HLA-A1101), A375-A11 (referring to A375 cells transfected with HLA-A1101), K562-A11-PRAME (referring to K562 cells transfected with HLA-A1101 and PRAM) loaded with AQIPEKIQK short peptides, and the control group is T2-A11 cells and K562 loaded with other antigen short peptides. Among them, T2 cells, A375 and K562 are all purchased from ATCC.

[0200] First, prepare the ELISPOT plate. The ELISPOT test steps are as follows: add the components of the test to the ELISPOT plate in the following order: 20,000 target cells / well, 2,000 effector cells / well, add 20 μL of the corresponding short peptide to the experimental group and the control group, the final concentration of the short peptide loaded by T2 is 10-5M, add 20 μL of culture medium (test culture medium) to the blank group, and set up 2 replicates. Then incubate overnight (37°C, 5% CO 2 The plate was then washed and subjected to secondary detection and color development. The plate was dried for 1 hour, and the spots formed on the membrane were counted using an ELISPOT READER system (AID). Figure 6 As shown, Figure 6The results of ELISPOT activation function verification of the obtained T cell clones. The obtained T cell clones highly released IFN-γ to T2-A11 cells and K562-A1101-PRAME loaded with AQIPEKIQK short peptides, but had little reaction to T2-A11 cells loaded with other antigen short peptides, A375-A11 (referring to A375 cells transfected with HLA-A1101) and K562.

[0201] Example 2 Obtaining TCR Genes of SSX2 Antigen Short Peptide Specific T Cell Clones

[0202] Using Quick-RNA TM MiniPrep (ZYMO research) was used to extract the total RNA of the T cell clones that were specific to the antigenic short peptide AQIPEKIQK and restricted to HLA-A1101 screened in Example 1. The cDNA was synthesized using the SMART RACE cDNA amplification kit from clontech, and the primers used were designed in the C-terminal conserved region of the human TCR gene. The sequence was cloned into a T vector (TAKARA) for sequencing. It should be noted that the sequence is a complementary sequence and does not contain introns.

[0203] After sequencing, the TCR expressed by double positive clones was:

[0204] The amino acid sequence of the TCR α chain variable domain is shown in SEQ ID NO: 1, the nucleotide sequence of the TCR α chain variable domain is shown in SEQ ID NO: 2, the amino acid sequence of the TCR α chain is shown in SEQ ID NO: 3, the nucleotide sequence of the TCR α chain is shown in SEQ ID NO: 4, the amino acid sequence of the TCR α chain with a leader sequence is shown in SEQ ID NO: 22, and the nucleotide sequence of the TCR α chain with a leader sequence is shown in SEQ ID NO: 23;

[0205] The amino acid sequence of the variable domain of the TCR β chain is shown in SEQ ID NO:5, the nucleotide sequence of the variable domain of the TCR β chain is shown in SEQ ID NO:6, the amino acid sequence of the TCR β chain is shown in SEQ ID NO:7, the nucleotide sequence of the TCR β chain is shown in SEQ ID NO:8, the amino acid sequence of the TCR β chain with a leader sequence is shown in SEQ ID NO:24, and the nucleotide sequence of the TCR β chain with a leader sequence is shown in SEQ ID NO:25.

[0206] SEQ ID NO: 1:

[0207]

[0208] SEQ ID NO:2:

[0209]

[0210] SEQ ID NO:3:

[0211]

[0212] SEQ ID NO:4:

[0213]

[0214] SEQ ID NO:22:

[0215]

[0216] SEQ ID NO:23:

[0217]

[0218] SEQ ID NO:5:

[0219]

[0220] SEQ ID NO:6:

[0221]

[0222] SEQ ID NO:7:

[0223]

[0224] SEQ ID NO:8:

[0225]

[0226] SEQ ID NO:24:

[0227]

[0228] SEQ ID NO:25:

[0229]

[0230] SEQ ID NO:9: AQIPEKIQK.

[0231] The α chain was identified to contain a CDR having the following amino acid sequence: αCDR1-TSDQSYG SEQ ID NO:10, αCDR2-QGSYDEQN SEQ ID NO:11, αCDR3-AMKPGGSYIPT SEQ ID NO:12. The beta chain contains a CDR with the following amino acid sequence:

[0232] βCDR1-MNHNY SEQ ID NO: 13,

[0233] βCDR2-SVGAGI SEQ ID NO: 14,

[0234] βCDR3-ASSYSVTEHRGKRNEQF SEQ ID NO:15.

[0235] Example 3 Expression, refolding and purification of SSX2 antigen short peptide-specific soluble TCR

[0236] To obtain a soluble TCR molecule, the α and β chains of the TCR molecule of the present invention may respectively contain only their variable domains and part of the constant domains, and a cysteine ​​residue is introduced into the constant domains of the α and β chains to form an artificial interchain disulfide bond, and the amino acid sequence of the α chain is shown in SEQ ID NO: 26; the amino acid sequence of the β chain is shown in SEQ ID NO: 27. The target gene sequences of the above-mentioned TCR α chain and TCR β chain were synthesized and inserted into the expression vector pET28a+ (Novagene) by the standard method described in Molecular Cloning a Laboratory Manual (3rd edition, Sambrook and Russell), and the upstream and downstream cloning sites were Nco I and Not I, respectively. The inserted fragment was confirmed to be correct by sequencing.

[0237] SEQ ID NO:26:

[0238]

[0239] SEQ ID NO:27:

[0240]

[0241] The expression vectors of TCRα chain and TCRβ chain were transformed into expression bacteria BL21(DE3) by chemical transformation, and the bacteria were grown in LB medium. 600=0.6, induced with a final concentration of 0.5 mM IPTG, the α and β chains of TCR expressed, the formed inclusion bodies were extracted with BugBuster Mix (Novagene), and repeatedly washed with BugBuster solution. The inclusion bodies were finally dissolved in a solution containing 6 M guanidine hydrochloride, 10 mM dithiothreitol (DTT), 10 mM ethylenediaminetetraacetic acid (EDTA), and 20 mM Tris (pH 8.1).

[0242] The dissolved TCR α chain and TCR β chain were quickly mixed in a solution containing 5M urea, 0.4M arginine, 20mM Tris (pH 8.1), 3.7mM cystamine, and 6.6mM β-mercapoethylamine (4°C) at a mass ratio of 1:1, with a final concentration of 60mg / mL. After mixing, the solution was dialyzed in 10 volumes of deionized water (4°C). After 12h, the deionized water was replaced with buffer (20mM Tris, pH 8.0) and continued to be dialyzed at 4°C for 12h. After the dialysis was completed, the solution was filtered through a 0.45μM filter membrane and purified by an anion exchange column (HiTrap Q HP, 5ml, GE Healthcare). The elution peak contained TCRs with successfully refolded α and β dimers, which were confirmed by SDS-PAGE gel. TCR was then further purified by gel filtration chromatography (HiPrep 16 / 60, Sephacryl S-100HR, GE Healthcare). The purity of the purified TCR was greater than 90% as determined by SDS-PAGE, and the concentration was determined by the BCA method. The SDS-PAGE electrophoresis gel of the soluble TCR obtained after purification of the present invention is shown in FIG. Figure 2a and Figure 2b As shown, Figure 2a and Figure 2b The right lanes are non-reducing gel and reducing gel, and the left lanes are molecular weight markers.

[0243] Example 4 Generation of soluble single-chain TCR specific for SSX2 antigen short peptide

[0244] According to the patent document WO2014 / 206304, the variable domains of the TCR α chain and the TCR β chain in Example 2 were constructed into a stable soluble single-chain TCR molecule connected by a flexible short peptide (linker) by using a site-directed mutagenesis method. The amino acid sequence of the single-chain TCR molecule is shown in SEQ ID NO: 28, and the nucleotide sequence of the single-chain TCR molecule is shown in SEQ ID NO: 29; the amino acid sequence and nucleotide sequence of its linker are marked with a single underline. The amino acid sequence of its α chain variable domain is shown in SEQ ID NO: 30, and the nucleotide sequence of the α chain variable domain is shown in SEQ ID NO: 31; the amino acid sequence of its β chain variable domain is shown in SEQ ID NO: 32, and the nucleotide sequence of the β chain variable domain is shown in SEQ ID NO: 33.

[0245] The target gene was double-digested with Nco I and Not I, and connected to the pET28a vector double-digested with Nco I and Not I. The ligation product was transformed into E. coli DH5α, coated with LB plates containing kanamycin, and inverted and cultured at 37°C overnight. Positive clones were picked for PCR screening, and positive recombinants were sequenced. After confirming that the sequence was correct, the recombinant plasmid was extracted and transformed into E. coli BL21 (DE3) for expression.

[0246] SEQ ID NO:28:

[0247]

[0248]

[0249] SEQ ID NO:29:

[0250]

[0251] SEQ ID NO:30:

[0252]

[0253] SEQ ID NO:31:

[0254]

[0255] SEQ ID NO:32:

[0256]

[0257] SEQ ID NO:33:

[0258]

[0259] Example 5 Expression, refolding and purification of soluble single-chain TCR specific for SXX2 antigen short peptide

[0260] All BL21 (DE3) colonies containing the recombinant plasmid pET28a-template chain prepared in Example 4 were inoculated into LB medium containing kanamycin and cultured at 37°C until OD 600 The concentration of IPTG was 0.6-0.8, and IPTG was added to a final concentration of 0.5mM. The culture was continued at 37°C for 4h. The cell precipitate was harvested by centrifugation at 5000rpm for 15min, and the cell precipitate was lysed with Bugbuster Master Mix (Merck). The inclusion bodies were recovered by centrifugation at 6000rpm for 15min, and then washed with Bugbuster (Merck) to remove cell debris and membrane components. The inclusion bodies were collected by centrifugation at 6000rpm for 15min. The inclusion bodies were dissolved in a buffer (20mM Tris-HCl pH8.0, 8M urea), and the insoluble matter was removed by high-speed centrifugation. The supernatant was quantified by BCA method and then packaged and stored at -80°C for later use.

[0261] To 5 mg of dissolved single-chain TCR inclusion body protein, add 2.5 mL of buffer (6M Gua-HCl, 50 mM Tris-HCl pH 8.1, 100 mM NaCl, 10 mM EDTA), then add DTT to a final concentration of 10 mM, and treat at 37°C for 30 min. Use a syringe to add the above-treated single-chain TCR dropwise to 125 mL of refolding buffer (100 mM Tris-HCl pH 8.1, 0.4 M L-arginine, 5 M urea, 2 mM EDTA, 6.5 mM EDTA, 6.5 mM β-mercapthoethylamine, 1.87 mM Cystamine), stir at 4°C for 10 min, then load the refolding solution into a cellulose membrane dialysis bag with a cutoff of 4 kDa, place the dialysis bag in 1 L of pre-cooled water, and stir slowly at 4°C overnight. After 17 hours, the dialysate was replaced with 1L pre-cooled buffer (20mM Tris-HCl pH 8.0), and the dialysis was continued for 8 hours at 4°C, and then the dialysate was replaced with the same fresh buffer and the dialysis was continued overnight. After 17 hours, the sample was filtered through a 0.45μm filter membrane, vacuum degassed, and passed through an anion exchange column (HiTrap Q HP, GE Healthcare). The protein was purified by a linear gradient eluent of 0-1M NaCl prepared in 20mM Tris-HCl pH 8.0. The collected elution fractions were analyzed by SDS-PAGE, and the fractions containing the single-chain TCR were concentrated and further purified by a gel filtration column (Superdex 7510 / 300, GE Healthcare), and the target fraction was also analyzed by SDS-PAGE.

[0262] The eluted fractions used for BIAcore analysis were further tested for purity by gel filtration. The conditions were: chromatographic column Agilent Bio SEC-3 (300A, Φ7.8×300 mm), mobile phase 150 mM phosphate buffer, flow rate 0.5 mL / min, column temperature 25°C, UV detection wavelength 214 nm.

[0263] The SDS-PAGE electrophoresis gel of the soluble single-chain TCR obtained after purification in this example is shown in Figure 3 As shown, Figure 3 The right lane is a non-reducing gel, and the left lane is a molecular weight marker.

[0264] Example 6 Binding Characterization

[0265] This example demonstrates through BIAcore analysis that soluble TCR molecules can specifically bind to the AQIPEKIQK-HLA A1101 complex.

[0266] The BIAcore T200 real-time analysis system was used to detect the binding activity of the TCR molecule obtained in Example 3 with the AQIPEKIQK-HLAA1101 complex. Anti-streptavidin antibody (GenScript) was added to the coupling buffer (10 mM sodium acetate buffer, pH 4.77), and then the antibody was passed through a CM5 chip pre-activated with EDC and NHS to fix the antibody on the chip surface, and finally the unreacted activated surface was blocked with ethanolamine hydrochloric acid solution to complete the coupling process, and the coupling level was about 15000RU.

[0267] A low concentration of streptavidin was passed through the chip surface coated with antibodies, and then the AQIPEKIQK-HLAA1101 complex was passed through the detection channel. The other channel was used as a reference channel, and 0.05 mM biotin was passed through the chip at a flow rate of 10 μL / min for 2 minutes to block the remaining binding sites of streptavidin.

[0268] The preparation process of the above AQIPEKIQK-HLA A1101 complex is as follows:

[0269] (a) Purification

[0270] Collect 100 mL of E. coli culture induced to express heavy chain or light chain, centrifuge at 4°C and 8000 g for 10 min, wash the cells once with 10 mL of PBS, and then resuspend the cells with 5 mL of BugBuster Master Mix Extraction Reagents (Merck) by vigorous shaking, incubate with rotation at room temperature for 20 min, and then centrifuge at 4°C and 6000 g for 15 min, discard the supernatant, and collect the inclusion bodies.

[0271] The inclusion bodies were resuspended in 5 mL BugBuster Master Mix and incubated with rotation at room temperature for 5 min; 30 mL of 10-fold diluted BugBuster was added, mixed, and centrifuged at 4°C and 6000 g for 15 min; the supernatant was discarded, and 30 mL of 10-fold diluted BugBuster was added to resuspend the inclusion bodies, mixed, and centrifuged at 4°C and 6000 g for 15 min, repeated twice, and 30 mL of 20 mM Tris-HCl pH 8.0 was added to resuspend the inclusion bodies, mixed, and centrifuged at 4°C and 6000 g for 15 min. Finally, 20 mM Tris-HCl 8 M urea was used to dissolve the inclusion bodies, and the purity of the inclusion bodies was detected by SDS-PAGE and the concentration was measured by BCA kit.

[0272] (b) Renaturation

[0273] The synthesized short peptide AQIPEKIQK was dissolved in DMSO to a concentration of 20 mg / mL. The inclusion bodies of the light chain and heavy chain were dissolved with a solution containing 8M urea, 20mM Tris pH 8.0, and 10mM DTT. 3M guanidine hydrochloride, 10mM sodium acetate, and 10mM EDTA were added for further denaturation before renaturation. The AQIPEKIQK peptide was added to the renaturation buffer (0.4M L-arginine, 100mM Tris pH 8.3, 2mM EDTA, 0.5mM oxidized glutathione, 5mM reduced glutathione, 0.2mMPMSF, cooled to 4°C) at 25mg / L (final concentration), and then 20mg / L of light chain and 90mg / L of heavy chain (final concentration, heavy chain was added three times, 8h / time) were added in sequence. The renaturation was carried out at 4°C for at least 3 days until completion, and SDS-PAGE was used to detect whether the renaturation was successful.

[0274] (c) Purification after renaturation

[0275] The renaturation buffer was replaced by dialysis with 10 volumes of 20mM Tris pH 8.0, and the buffer was replaced at least twice to fully reduce the ionic strength of the solution. After dialysis, the protein solution was filtered with a 0.45μm cellulose acetate filter and then loaded onto a HiTrap Q HP (GE General Electric) anion exchange column (5mL bed volume). The protein was eluted with a 0-400mM NaCl linear gradient solution prepared with 20mM Tris pH 8.0 using an Akta purifier (GE General Electric), and pMHC was eluted at about 250mM NaCl. The peak components were collected and the purity was detected by SDS-PAGE.

[0276] (d) Biotinylation

[0277] The purified pMHC molecules were concentrated using Millipore ultrafiltration tubes, and the buffer was replaced with 20 mM Tris pH 8.0. Then, biotinylation reagent 0.05 M Bicine pH 8.3, 10 mM ATP, 10 mM MgOAc, 50 μM D-Biotin, and 100 μg / mL BirA enzyme (GST-BirA) were added. The mixture was incubated at room temperature overnight, and SDS-PAGE was used to detect whether the biotinylation was complete.

[0278] (e) Purification of the biotinylated complex

[0279] The biotinylated pMHC molecules were concentrated to 1 mL using Millipore ultrafiltration tubes, and the biotinylated pMHC was purified by gel filtration chromatography. The Akta purifier (GE General Electric) was used to pre-equilibrate HiPrep with filtered PBS. TM 16 / 60S200 HR column (GE General Electric Company) was loaded with 1 mL of concentrated biotinylated pMHC molecules, and then eluted with PBS at a flow rate of 1 mL / min. The biotinylated pMHC molecules appeared as a single peak eluted at about 55 mL. The protein-containing fractions were combined and concentrated using Millipore ultrafiltration tubes. The protein concentration was determined by the BCA method (Thermo). Protease inhibitor cocktail (Roche) was added and the biotinylated pMHC molecules were aliquoted and stored at -80°C.

[0280] The kinetic parameters were calculated using BIAcore Evaluation software to obtain the kinetic profile of binding to the AQIPEKIQK-HLA A1101 complex, where: Figure 4 This is the BIAcore kinetic profile of the binding of soluble TCR to the AQIPEKIQK-HLA A1101 complex. Figure 5The BIAcore kinetic spectrum of the binding of soluble single-chain TCR to the AQIPEKIQK-HLA A1101 complex. The spectrum shows that the soluble TCR molecule obtained by the present invention can bind to the AQIPEKIQK-HLA A1101 complex. At the same time, the above method was also used to detect the binding activity of the soluble TCR molecule of the present invention to several other unrelated antigen short peptides and HLA complexes, and the results showed that the TCR molecule of the present invention did not bind to any other unrelated antigens.

[0281] Example 7 Effector cell activation experiment of T2 cells loaded with short peptides and transfected with the TCR of the present invention

[0282] The effector cells used in this example are CD3 TCR transfected with the present invention. + T cells were transfected with CD3 TCR (A6) from the same volunteer + T cells were used as the control group. The target cells used were T2 cells loaded with the SSX2 antigen peptide AQIPEKIQK, and T2 cells loaded with other antigen peptides and empty cells were used as controls. The components of the test were added to the ELISPOT well plate: target cells 2×10 4 cells / well, effector cells 2×10 3 Each well was set up with two replicate wells. Then, the AQIPEKIQK short peptide was added to the corresponding wells to make the final concentration of the short peptide in the ELISPOT well plate 10 -6 M.

[0283] ELISPOT plates were activated with ethanol and coated at 4°C overnight. On the first day of the experiment, the coating solution was removed, the cells were washed and blocked, and the cells were incubated at room temperature for two hours. The blocking solution was removed and the components of the test were added to the ELISPOT plates: 1×10 target cells 4 / well, effector cells: 2×10 3 =100 / well (calculated according to the transfection positive rate), and set up two duplicate wells. Incubate overnight (37°C, 5% CO 2 On the second day of the experiment, the plates were washed and subjected to secondary detection and color development. The plates were dried and the spots formed on the membrane were counted using an ELISPOT READER system (AID20).

[0284] Figure 7 The results of ELISPOT activation function verification of effector cells transfected with the TCR of the present invention for T2-A11 cells loaded with short peptides are shown in Figure 2. Figure 7It can be seen that T2-A11 cells loaded with the AQIPEKIQK short peptide and T cells transfected with the TCR of the present invention have a significant activation effect, while T2-A11 cells loaded with other short peptides or empty cells and T cells transfected with the TCR of the present invention have basically no activation effect.

[0285] Example 8 Activation function experiment of effector cells transfected with TCR of the present invention on tumor cell lines

[0286] This example also uses ELISPOT assay to detect the function and specificity of the TCR of the present invention in cells. The effector cells used are CD3 expressing the SSX2 antigen short peptide specific TCR of the present invention. + T cells, and CD3+T cells transfected with other TCRs (A6) from the same volunteer were used as the control group. The positive tumor cell lines used were MOG-G-UVW (simultaneously transfected with HLA-A1101 and B2M), HUH-1 (HLA-A11 overexpression), and SKM-1 (simultaneously transfected with HLA-A1101 and B2M); the negative tumor cell lines used were HUCC-Tl, SNU423, SW480 (HLA-A11 overexpression), and only effector cells as the control group. Among them, HUH-1 was purchased from Nanjing Kebai Biotechnology Co., Ltd.; SW480 was purchased from ATCC; SKM-1, MOG-G-UVW, SNU423, and HUCC-Tl were all purchased from Guangzhou Saiku Biotechnology Co., Ltd.

[0287] First, prepare the ELISPOT plate. Activate the ELISPOT plate with ethanol and incubate overnight at 4°C. On the first day of the experiment, remove the coating solution, wash and block, incubate at room temperature for two hours, remove the blocking solution, and add the various components of the test to the ELISPOT plate: 2×10 target cells 4 / well, effector cells: 2×10 3 =100 / well (calculated according to the positive rate of transfection), and set up two duplicate wells. Incubate overnight (37°C, 5% CO 2 On the second day of the experiment, the plates were washed and subjected to secondary detection and color development. The plates were dried and the spots formed on the membrane were counted using an ELISPOT READER system (AID20).

[0288] Figure 8 The results of the activation function experiments of the effector cells transfected with the TCR of the present invention for tumor cell lines are shown in FIG. Figure 8 The results showed that the effector cells transfected with the TCR of the present invention had a significant activation effect on the SSX2-positive tumor cell line, while the effector cells transfected with other TCRs and only target cells were basically inactive; at the same time, the effector cells transfected with the TCR of the present invention were basically inactive on the SSX2-negative cell line.

[0289] Example 9 Experiment on killing function of effector cells transfected with TCR of the present invention against tumor cell lines

[0290] Lactate dehydrogenase (LDH) is abundant in the cytoplasm and cannot pass through the cell membrane under normal circumstances. When the cell is damaged or dead, it can be released outside the cell. At this time, the LDH activity in the cell culture medium is proportional to the number of cell deaths. In this example, the release of LDH is also measured by a non-radioactive cytotoxicity experiment well known to those skilled in the art, thereby verifying the killing function of the cells transfected with the TCR of the present invention. In this example, the LDH experiment uses CD3 isolated from the blood of healthy volunteers. + T cells were transfected with the TCR of the present invention as effector cells, and CD3 T cells of the same volunteer were transfected with other TCRs (A6) or wild-type TCRs (WT-TCR) + T cells were used as controls. The positive tumor cell lines used in the examples were SK-MEL-28-SSX2 (SSX2 overexpression), and the negative tumor cell lines were A375, 8305C, COV504, and HUCC-T1. Among them, SK-MEL-28, HUCC-T1, 8305C, and COV504 were purchased from Guangzhou Saiku Biotechnology Co., Ltd., and A375 was purchased from ATCC.

[0291] Experimental steps: First, prepare the LDH plate and add the components of the test to the plate in the following order: 3×10 target cells 4 cells / well, effector cells 3×10 4 cells / well (calculated according to the transfection positive rate), add them to the corresponding wells, and set up three replicate wells. At the same time, set up the effector cell spontaneous well, target cell spontaneous well, target cell maximum well, volume correction control well and culture medium background control well. Incubate overnight (37°C, 5% CO 2 On the second day of the experiment, the color development was detected, and the absorbance value was recorded at 490 nm using a microplate reader (Bioteck) after the reaction was terminated.

[0292] Fig. 9 The results of LDH experiments on the killing function of effector cells transfected with the TCR of the present invention against tumor cell lines. Fig. 9 The results showed that the effector cells transfected with the TCR of the present invention had a very obvious strong killing effect on the SSX2-positive tumor cell line, while the T cells transfected with other TCRs basically did not respond. At the same time, the T cells transfected with the high-affinity TCR of the present invention had almost no killing effect on the negative tumor cell line.

[0293] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

[0294] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention.

Claims

1. A TCR, characterized in that: The TCR comprises a TCR α chain variable domain and a TCR β chain variable domain, the TCR is capable of binding to the AQIPEKIQK-HLA A1101 complex, and the three complementary determining regions of the TCR α chain variable domain are: αCDR1-TSDQSYG SEQ ID NO:10, αCDR2-QGSYDEQN SEQ ID NO:11, αCDR3-AMKPGGSYIPT SEQ ID NO: 12; and The three complementarity determining regions of the TCRβ chain variable domain are: βCDR1-MNHNY SEQ ID NO: 13, βCDR2-SVGAGI SEQ ID NO: 14, βCDR3-ASSYSVTEHRGKRNEQF SEQ ID NO:

15.

2. The TCR according to claim 1, characterized in that The TCR α chain variable domain is an amino acid sequence having at least 90% sequence identity with SEQ ID NO: 1; and / or the TCR β chain variable domain is an amino acid sequence having at least 90% sequence identity with SEQ ID NO:

5.

3. The TCR according to claim 1, characterized in that The C- or N-terminus of the α chain of the TCR is bound to a conjugate, and / or the C- or N-terminus of the β chain of the TCR is bound to a conjugate; Preferably, the conjugate bound to the TCR comprises any one or a combination of at least two of a detectable marker, a therapeutic agent, and a PK modifying moiety; Preferably, the therapeutic agent is an anti-CD3 antibody.

4. A multivalent TCR complex, characterized in that The multivalent TCR complex comprises at least two TCR molecules, and at least one of the TCR molecules is the TCR described in any one of claims 1-3.

5. A nucleic acid molecule, characterized in that The nucleic acid molecule comprises a nucleotide sequence encoding the TCR according to any one of claims 1 to 3, and / or a complementary sequence of a nucleotide sequence encoding the TCR according to any one of claims 1 to 3; Preferably, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO:2 or SEQ ID NO:31 encoding the variable domain of the TCR α chain; and / or the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO:6 or SEQ ID NO:33 encoding the variable domain of the TCR β chain.

6. A carrier, characterized in that The vector contains the nucleic acid molecule of claim 5; Preferably, the vector is a viral vector; Preferably, the viral vector is a lentiviral vector.

7. An isolated host cell, characterized in that The isolated host cell contains the vector according to claim 6, or the exogenous nucleic acid molecule according to claim 5 is integrated into the chromosome of the isolated host cell.

8. A cell, characterized in that The cell is transduced with the nucleic acid molecule of claim 5 or the vector of claim 6; Preferably, the cells comprise T cells or stem cells.

9. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises any one or a combination of at least two of the TCR according to any one of claims 1 to 3, the multivalent TCR complex according to claim 4, the nucleic acid molecule according to claim 5, and the cell according to claim 8; Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

10. Use of any one or a combination of at least two of the TCR according to any one of claims 1 to 3, the multivalent TCR complex according to claim 4, and the cell according to claim 8, characterized in that: The use includes preparing medicines for treating tumors or autoimmune diseases.

Images