Reagent and method for detecting berberine-resistant virus

Abstract

The invention discloses a reagent and a method for detecting berberine-resistant viruses. The reagent provided by the invention comprises an antibody or an antigen binding fragment thereof, the antibody or the antigen binding fragment thereof comprises a heavy chain antigen complementarity determining region CDR1-3 and / or a light chain antigen complementarity determining region CDR1-3, the heavy chain antigen complementarity determining region CDR1-3 has a sequence as shown in SEQ ID NO.5-7, and the light chain antigen complementarity determining region CDR1-3 has a sequence as shown in SEQ ID NO.8-10. The reagent can be used for detecting the berberine-resistant herpes simplex virus type 1, so that the treatment effect can be evaluated in advance before berberine is applied for treatment.

Description

Technical Field

[0001] The invention belongs to the field of microbial detection, in particular to a reagent and a method for detecting berberine-resistant viruses. Background Art

[0002] Berberine (BE) is a protoberberine alkaloid found in many plant families such as Berberidaceae and Ranunculaceae. BE has a variety of medicinal effects, including anti-inflammatory, antibacterial and antifungal activities, and acts on a series of signaling pathways to improve a variety of diseases. In vitro studies have found that BE can inhibit the proliferation, migration and metastasis of cancer cells and induce apoptosis, and promote apoptosis by increasing some related signals (such as JNK / p38 signaling molecules). The accumulated signaling molecules can activate the JNK / p38 pathway, downregulate the anti-apoptotic protein Bcl-XL, and lead to the release of cytochrome C and the activation of caspases. In recent years, BE has been found to have antiviral effects on a variety of viruses, including common viruses such as influenza A virus, respiratory syncytial virus, chikungunya virus, enterovirus, and herpes simplex virus.

[0003] The inventor's previous study explored the effect of BE on the activity of HEp-2 cells infected with HSV-1 virus and its related molecular mechanism. The results showed that BE reduced the mRNA expression of gD, ICP-4, ICP-8, and ICP-27, increased cell activity, inhibited cell apoptosis, and promoted the expression of miR-299-3p by inhibiting LncRNANRAV and RAB5C, while inhibiting the protein expression levels of PI3K, AKT, JNK, and p38 in the PI3K / AKT signaling pathway and JNK / p38 MAPK signaling pathway proteins. This improves the activity of HEp-2 cells infected with HSV-1 and inhibits their apoptosis.

[0004] Previous studies on berberine have shown that berberine inhibits viruses such as HSV-1 through different mechanisms. After further research, the inventors found that there are berberine-resistant HSV-1 strains. Therefore, there is a potential risk of ineffectiveness when treating related viral infections based on berberine. In order to avoid potential ineffective treatment, it is necessary to distinguish berberine-resistant viruses.

[0005] The information in the background technology is only for illustrating the general background of the present invention and should not be regarded as admitting or suggesting in any form that such information constitutes the prior art known to a person skilled in the art. Summary of the invention

[0006] In order to solve at least some of the problems in the prior art, the present invention provides a method and reagent capable of specifically detecting or distinguishing berberine-resistant viruses. Specifically, the present invention includes the following contents.

[0007] In a first aspect of the present invention, an antibody or an antigen-binding fragment thereof is provided, which is capable of targeting and binding to berberine-resistant herpes simplex virus type 1, wherein the antibody or the antigen-binding fragment thereof comprises a heavy chain antigen complementary determining region CDR1-3 and / or a light chain antigen complementary determining region CDR1-3, wherein the heavy chain antigen complementary determining region CDR1-3 respectively has the sequence shown in SEQ ID NO.5-7, and the light chain antigen complementary determining region CDR1-3 respectively has the sequence shown in SEQ ID NO.8-10.

[0008] In certain embodiments, the antibody or antigen-binding fragment thereof according to the present invention comprises any one of the amino acid sequences shown in (I)-(III):

[0009] (I) the heavy chain variable region sequence shown in SEQ ID NO.2 and / or the light chain variable region sequence shown in SEQ ID NO.4;

[0010] (II) an amino acid sequence that has at least 90% homology to the amino acid sequence shown in (I) and has the same function;

[0011] (III) An amino acid sequence obtained by modifying, replacing, deleting or adding one or more amino acids to the amino acid sequence shown in (I) or (II) and having the same function.

[0012] In certain embodiments, according to the antibody or antigen-binding fragment thereof of the present invention, the antibody includes a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a humanized antibody or a murine antibody; the antigen-binding fragment includes Fab, Fab', F(ab)2, F(ab')2, scFv, scFv Fc fragment or a single-chain antibody ScAb.

[0013] In a second aspect, the present invention provides a nucleic acid molecule comprising a nucleotide sequence encoding the antibody or antigen-binding fragment thereof according to the present invention.

[0014] The third aspect of the present invention provides a method for preparing the antibody or antigen-binding fragment thereof according to the present invention, wherein the antibody or antigen-binding fragment thereof is prepared by artificial synthesis or genetic engineering.

[0015] A fourth aspect of the present invention provides a detection product for berberine-resistant herpes simplex virus type 1, which comprises the antibody or antigen-binding fragment thereof described in the present invention.

[0016] In certain embodiments, the detection product according to the present invention comprises a kit, a test strip or a chip.

[0017] In certain embodiments, according to the detection product described in the present invention, the kit includes at least one of an ELISA detection kit, a plate chemiluminescence detection kit, a fully automatic chemiluminescence detection kit, a radioimmunoassay kit, a fluorescence immunoassay kit, a chemiluminescence immunoassay kit, an immunoblotting kit, an immunoprecipitation kit, a flow cytometry detection kit, a colloidal gold detection kit, a bioluminescence immunoassay kit, an immunochromatography detection kit, an electrophoresis analysis kit, a latex-based kit, and a kit based on a direct competition method or an indirect competition method.

[0018] In a fifth aspect, the present invention provides a method for detecting berberine-resistant herpes simplex virus type 1 in a biological sample from a subject, comprising the step of contacting the herpes simplex virus type 1 antigen from the biological sample with the antibody or antigen-binding fragment according to the present invention.

[0019] In certain embodiments, according to the method of the present invention, the sample is a fluid sample.

[0020] In certain embodiments, according to the method of the present invention, the sample is a tissue sample.

[0021] The reagent of the present invention can be used to detect berberine-resistant herpes simplex virus type 1, thereby enabling pre-evaluation of the therapeutic effect before administering berberine for treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the effect of BE on the proliferation and toxicity of HEp-2 cells infected with HSV-1 virus strain No. 1 (i.e., 1#-HSV-1 virus).

[0023] Figure 2 Schematic diagram of infection with BE-resistant HSV-1 virus (i.e., 2#-HSV-1 virus).

[0024] Figure 3 A is the relative expression levels of gD, ICP4, ICP5 and ICP8 proteins in HSV-1 virus-infected cells inhibited by BE, and B is the relative expression levels of gD, ICP4, ICP5 and ICP8 proteins in HSV-1 virus-infected cells with BE resistance.

[0025] Figure 4 BE inhibits the cell activity after infection with 1#-HSV-1 virus and 2#-HSV-1 virus.

[0026] Figure 5 2#-The expression levels of inflammasome-related proteins NLRP3, ASC and Caspase-1 in cells infected with HSV-1 virus. DETAILED DESCRIPTION

[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0028] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that the upper and lower limits of the scope and each intermediate value therebetween are specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0029] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which the invention belongs. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0030] Antibodies or antigen-binding fragments thereof

[0031] In one aspect of the present invention, an antibody or an antigen-binding fragment thereof is provided, which can target berberine-resistant herpes simplex virus type 1, wherein the antibody or the antigen-binding fragment thereof comprises a heavy chain antigen complementary determining region CDR1-3 and / or a light chain antigen complementary determining region CDR1-3, wherein the heavy chain antigen complementary determining region CDR1-3 respectively has the sequence shown in SEQ ID NO.5-7, and the light chain antigen complementary determining region CDR1-3 respectively has the sequence shown in SEQ ID NO.8-10.

[0032] In a preferred embodiment, the antibody or antigen-binding fragment thereof comprises any one of the amino acid sequences shown in (I)-(III):

[0033] (I) the heavy chain variable region sequence shown in SEQ ID NO.2 and / or the light chain variable region sequence shown in SEQ ID NO.4;

[0034] (II) an amino acid sequence that has at least 90% homology to the amino acid sequence shown in (I) and has the same function;

[0035] (III) An amino acid sequence obtained by modifying, replacing, deleting or adding one or more amino acids to the amino acid sequence shown in (I) or (II) and having the same function.

[0036] Herein, the term "resistance" refers to the drug resistance or tolerance of herpes simplex virus type 1 to berberine treatment, that is, the therapeutic effect of berberine is significantly reduced or even ineffective. Its resistance can be determined by inflammatory indicators related to viral infection, such as the quantification of inflammatory factors or the amount of virus.

[0037] As used herein, the term "antibody" refers to an immunoglobulin molecule that has the ability to specifically bind to a specific antigen. Antibodies typically contain a variable region and a constant region in each heavy chain and light chain. The variable regions of the antibody heavy and light chains contain binding domains that interact with the antigen. The constant region of the antibody can mediate the binding of the immunoglobulin to host tissues or factors. Therefore, most antibodies have a heavy chain variable region (VH) and a light chain variable region (VL), which together form the antibody portion that binds to the antigen.

[0038] The "light chain variable region (VL)" or "heavy chain variable region (VH)" of the present invention consists of a "framework" region interspersed with three "complementarity determining regions (CDRs)". The framework region is used to adjust the CDRs for specific binding to antigenic epitopes. The CDRs contain the amino acid residues in the antibody that are primarily responsible for antigen binding. From the amino terminus to the carboxyl terminus, both the VL and VH domains contain the following framework (FR) regions and CDR regions: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4.

[0039] As used herein, the terms "homology" and "identity" are used interchangeably. Homologous sequences include amino acid sequences that are at least 90%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identical to the sequences of the present invention. To determine sequence identity, sequence alignments may be performed, which may be performed in a variety of ways known to those skilled in the art, such as using BLAST, BLAST-2, ALIGN, NEEDLE or Megalign (DNASTAR) software, etc. Those skilled in the art can determine appropriate parameters for alignment, including any algorithm required for achieving optimal alignment in the full-length sequence being compared.

[0040] Herein, the antibody sequences obtained by modification also belong to the protection scope of the present invention. The term "modification" refers to any chemical modification of the amino acid sequence, such as substitution, deletion, insertion and / or addition of amino acids. The term "substitution" refers to the replacement of one or more amino acids by different amino acids. "Deletion" refers to the reduction of one or more amino acids in an amino acid sequence. "Insertion" or "addition" refers to a change in an amino acid sequence that results in an increase of one or more amino acids compared to a naturally occurring molecule. It should be noted that in the modified antibodies provided by the present invention, the modification preferably occurs in a region outside the variable region, such as in the framework region or constant region of the antibody, and the modified antibody still retains the desired functional properties of the antibody of the present invention or its antigen-binding fragment, or has improved antigen-binding properties.

[0041] In the present invention, the antibody includes monoclonal antibody, polyclonal antibody, chimeric antibody, humanized antibody or mouse antibody.

[0042] The term "monoclonal antibody" as used herein, sometimes also referred to as "monoantibody" or Ab, refers to an immunoglobulin obtained from a pure cell line, having the same structure and chemical properties, and being specific to a single antigenic determinant. Monoclonal antibodies are different from conventional polyclonal antibody preparations (usually having different antibodies against different determinants), in that each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, the advantage of monoclonal antibodies is that they are obtained through hybridoma or recombinant engineered cell culture and are not mixed with other immunoglobulins. This characteristic contrasts with polyclonal antibody preparations, which generally include antibodies against different antigenic determinants. The modifier "monoclonal" indicates the characteristic of the antibody, which is obtained from a homogeneous antibody population, but this should not be interpreted as requiring any special method to produce the antibody.

[0043] Herein, the term "chimeric antibody" generally refers to an antibody in which a portion of each heavy chain or light chain amino acid sequence is homologous to the corresponding amino acid sequence in an antibody from a specific species, or belongs to a specific category, while the remaining segments of the chain are homologous to the corresponding sequence in another species. For example, the variable regions of the light chain and the heavy chain are all from the variable regions of antibodies of one animal species (such as mice, rats, etc.), while the constant portion is homologous to the antibody sequence from another species (such as humans). For example, to obtain chimeric antibodies, non-human B cells or hybridoma cells can be used to produce variable regions, while the constant regions combined therewith are from humans. The variable region has the advantage of being easy to prepare, and its specificity is not affected by the source of the constant region combined therewith. At the same time, since the constant region of the chimeric antibody can be derived from humans, the possibility of the chimeric antibody triggering an immune response during injection is lower than that of using antibodies with non-human constant regions.

[0044] Herein, the term "humanized antibody" generally refers to a chimeric antibody that contains fewer sequences from non-human immunoglobulins, thereby reducing the immunogenicity of heterologous antibodies when introduced into humans, while maintaining the complete antigen binding affinity and specificity of the antibody. Antibody humanization is the process of increasing the proportion of human sequences in heterologous antibodies. Preferably, the variable region in the humanized antibody is more than 85%, preferably 90%, further preferably 95%, for example, 95%, 96%, 97%, 98%, or even more than 99% of the human genes are humanized antibodies. It is understandable that the framework region or constant region in the humanized antibody may be partially or entirely encoded by human antibody genes.

[0045] Herein, the term "murine antibody" generally refers to an antibody whose variable region framework and CDR region are derived from mouse germline immunoglobulin sequences. In addition, if the antibody comprises a constant region, it is also derived from mouse germline immunoglobulin sequences. In the present invention, the murine antibody may comprise amino acid residues not encoded by mouse germline immunoglobulin sequences, for example, mutations introduced by random mutations or point mutations in vitro or by somatic mutations in vivo.

[0046] As used herein, the term "antigen-binding fragment" generally refers to one or more fragments of an antibody that specifically bind to an antigen. The antigen-binding function of an antibody can be achieved by a full-length fragment of the antibody. The antigen-binding function of an antibody can also be achieved by a heavy chain comprising a fragment of Fv, scFv, dsFv, Fab, Fab' or F(ab')2, or a light chain comprising a fragment of Fv, scFv, dsFv, Fab, Fab' or F(ab')2.

[0047] In the present invention, the terms "binding", "immunobinding", "specific binding", "directed against" and "targeting" are used interchangeably and generally refer to the non-covalent interaction that occurs between an immunoglobulin molecule and an antigen that is specific for the immunoglobulin. The strength or affinity of the immunological binding interaction can be expressed as a dissociation constant (Kd), where a smaller Kd represents a higher affinity. "Affinity" refers to the strength of the sum of all non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen).

[0048] Nucleic acid molecules

[0049] In one aspect of the present invention, a nucleic acid molecule is provided, which comprises a nucleotide sequence encoding the antibody or antigen-binding fragment thereof of the present invention.

[0050] The term "nucleic acid" as used herein is intended to include polymeric forms of nucleotides of any length, containing deoxyribonucleotides, ribonucleotides and / or their analogs, including DNA, RNA and DNA / RNA hybrids, and also including DNA or RNA analogs, such as those containing modified backbones (e.g., peptide nucleic acids (PNA) or thiophosphates) or modified bases. Therefore, nucleic acids of the present invention include DNA, cDNA, mRNA, recombinant nucleic acids, etc.

[0051] Once the coding sequence of the antibody of the present invention is isolated, the antibody can be obtained in large quantities by recombinant technology. An exemplary method is to clone the coding gene into a vector, transfer it into cells, and then separate it from the propagated host cells by conventional methods.

[0052] Preparation method

[0053] In one aspect of the present invention, a method for preparing the antibody or antigen-binding fragment thereof of the present invention is provided. The preparation method is not particularly limited, and includes preparation by artificial synthesis or genetic engineering.

[0054] In certain embodiments, the antibodies of the present invention are obtained by artificial synthesis. Methods for artificially synthesizing antibodies are known in the art, for example, the antibodies of the present invention or antigen-binding fragments thereof are obtained by direct amino acid synthesis.

[0055] In certain embodiments, the antibodies of the present invention are obtained by genetic engineering expression. Genetic engineering expression systems include prokaryotic cell expression systems, eukaryotic cell expression systems, and cell-free expression systems. Examples of prokaryotic cell expression systems include Escherichia coli expression systems. Eukaryotic cell expression systems include zymocyte expression systems, insect cell expression systems, and mammalian cell expression systems.

[0056] Testing products

[0057] In one aspect of the present invention, a detection product for berberine-resistant herpes simplex virus type 1 is provided, which comprises the antibody or antigen-binding fragment thereof of the present invention. In a preferred embodiment, the detection product of the present invention is a kit for detecting berberine-resistant herpes simplex virus type 1.

[0058] As used herein, the term "kit" refers to a combination of reagents and other materials. The kit is expected to include reagents such as buffers, protein stabilizing agents, signal generating systems (e.g., fluorescent signal generating systems), antibodies, control proteins, and test containers (e.g., microtiter plates, etc.). The term "kit" is not limited to a specific combination of reagents and / or other materials, for example, the kit may also include instructions for using the reagents. The kit may be packaged in any suitable manner, typically having components in a single container or (if necessary) in multiple containers and instructions for performing detection instructions. The kit may be prepared by a variety of methods known in the art.

[0059] In certain embodiments, the kit further comprises at least one of a cleaning solution, a substrate solution, a diluent and a calibration solution. Wherein, the composition of the cleaning solution is not particularly limited, and examples thereof include but are not limited to a buffer, a surfactant, and a preservative. The substrate solution can use a known substrate, and examples thereof include but are not limited to a chromogenic substrate, a fluorescent substrate, a luminescent substrate, and the like. The composition of the diluent is not particularly limited, and examples thereof include but are not limited to a buffer, a surfactant, and the like. The composition of the calibration solution is not particularly limited, and examples thereof include but are not limited to a BSA solution, a trehalose solution, an animal serum, and the like.

[0060] In the present invention, the kit is not particularly limited, as long as it can be used to detect berberine-resistant herpes simplex virus type 1. Examples include but are not limited to ELISA detection kits, plate chemiluminescence detection kits, fully automatic chemiluminescence detection kits, radioimmunoassay kits, fluorescent immunoassay kits, chemiluminescent immunoassay kits, immunoblotting kits, immunoprecipitation kits, flow cytometry detection kits, colloidal gold detection kits, bioluminescent immunoassay kits, immunochromatography detection kits, electrophoresis analysis kits, latex-based kits, and at least one of kits based on direct competition or indirect competition.

[0061] Detection Methods

[0062] In one aspect of the present invention, a method for detecting berberine-resistant herpes simplex virus type 1 in a biological sample from a subject is provided, comprising the step of contacting the herpes simplex virus type 1 antigen from the biological sample with the antibody or antigen-binding fragment according to the present invention.

[0063] In the present invention, the biological sample is from a subject who has been clearly diagnosed with herpes simplex virus type 1 or suspected of being infected with herpes simplex virus type 1. The subject includes mammals, and examples of mammals include but are not limited to mice, rabbits, pigs, cattle, sheep, dogs, chickens, cats, humans, etc.

[0064] It will be understood by those skilled in the art that in order to obtain the herpes simplex virus type 1 antigen from the biological sample, the virus particles or antigens can be extracted and / or purified by methods known in the art, without particular limitation on the extraction and purification steps.

[0065] In a preferred embodiment, the sample is a fluid sample.

[0066] In another preferred embodiment, the sample is a tissue sample.

[0067] Example 1

[0068] 1. Confirmation of BE-resistant virus strains

[0069] 1. Experimental Materials

[0070] (1) 1#-HSV-1 virus strain (purchased from American type culture collection).

[0071] (2) 2#-HSV-1 virus strain (isolated from clinical samples, clinical sample number No.ZYYQ2635).

[0072] (3) Cells: HEp-2 cells (purchased from Shanghai Bojie Medical Technology Co., Ltd.).

[0073] (4) Berberine (BE), purchased from Beijing Solebow Technology Co., Ltd. (CAS No.: 2086-83-1, molecular weight: 336.36, purity: ≥98%);

[0074] 2. Experimental methods

[0075] Control groups 1 and 2: Hep-2 cells were not treated, and 20 μL of dimethyl sulfoxide (DMSO) was added and cultured for 24 h;

[0076] Infection group: Hep-2 cells were infected with 100 μL of 1#-HSV-1 virus strain or 2#-HSV-1 virus strain, and then 20 μL of DMSO was added and cultured for 24 h;

[0077] Low-concentration drug treatment group: Hep-2 cells were infected with 100 μL of 1#-HSV-1 virus strain or 2#-HSV-1 virus strain, and then 20 μL of 5 μmol / L BE solution was added and cultured for 24 h;

[0078] Medium concentration drug treatment group: Hep-2 cells were infected with 100 μL of 1#-HSV-1 virus strain or 2#-HSV-1 virus strain, and then 20 μL of 10 μmol / L BE solution was added and cultured for 24 h;

[0079] High-concentration drug treatment group: Hep-2 cells were infected with 100 μL of 1#-HSV-1 virus strain or 2#-HSV-1 virus strain, and 20 μL of 15 μmol / L BE solution was added and cultured for 24 h.

[0080] All experimental groups were cultured in an incubator at 37°C and 5% CO2.

[0081] 2.1 Cell viability assay

[0082] (1) Cell intervention treatment and grouping

[0083] HEp-2 cells were routinely cultured in RPMI1640 medium containing 10% fetal bovine serum, 1% penicillin, and 1% streptomycin in an incubator at 37°C and 5% CO2. HEp-2 cells in logarithmic growth phase were taken and cultured at 1×10 5 / well inoculated in a 6-well plate, and when the cell growth rate reaches 80%-90%, it is ready for use. 1#-HSV-1 virus strain and 2#-HSV-1 virus strain are plaque purified in agarose medium, and 100 μL of 1#-HSV-1 virus strain and 2#-HSV-1 virus strain culture fluid are added to the reserved HEp-2 cells, and then 2 mL of the above fresh culture medium is added to each well, and the cells are placed in a 37°C, 5% CO2 constant temperature incubator for culture, and the cell morphology changes are observed under a microscope every 4 hours. When more than 80% of the cells are pathological, the culture fluid is centrifuged for 30 minutes (12000r / min, 4°C) to obtain the supernatant for subsequent experiments.

[0084] Take an appropriate amount of BE and add it to DMSO to fully dissolve it, and prepare BE solutions with concentrations of 5μmol / L, 10μmol / L, and 15μmol / L, respectively. Take 100μL of the culture fluid of the spare 1#-HSV-1 virus strain and 2#-HSV-1 virus strain and add them to 6-well plates to propagate in HEp-2 cells, and divide them into high-concentration BE group, medium-concentration BE group, low-concentration BE group, infection group, and control group. Add 20μL of BE solution with a concentration of 15μmol / L to the high-concentration BE group, 20μL of BE solution with a concentration of 10μmol / L to the medium-concentration group, 20μL of BE solution with a concentration of 5μmol / L to the low-concentration group, and 20μL of DMSO to the infection group and the control group. 1#-HSV-1 virus strain and 2#-HSV-1 virus strain infected HEp-2 cells and divided them into groups. The cells were randomly divided into control group: cells were not treated, and 20 μL DMSO was added and cultured for 24 hours; infection group: cells were infected with 100 μL HSV-1, and 20 μL DMSO was added and cultured for 24 hours; low concentration group: cells were infected with 100 μL HSV-1, and 20 μL 5 μmol / L BE solution was added and cultured for 24 hours; medium concentration group: cells were infected with 100 μL HSV-1, and 20 μL 10 μmol / L BE solution was added and cultured for 24 hours; high concentration group: cells were infected with 100 μL HSV-1, and 20 μL 15 μmol / L BE solution was added and cultured for 24 hours. All experimental groups were cultured in an incubator at 37°C and 5% CO2.

[0085] (2) Plaque inhibition assay

[0086] Take the HEp-2 cells treated with the above scheme for 24 hours and culture them in a 6-well plate containing DMEM medium containing 10% FBS for 24 hours until the cells cover the bottom of the well. Prepare 5 1.5mL centrifuge tubes and add 900μL of serum-free DMEM medium to each. Take 100μL of 1#-HSV-1 virus and 2#-HSV-1 virus culture medium and add them to 900μL serum-free DMEM medium in the first tube. Pipette up and down 5 times. The virus dilution in this tube is 10 -1 . Use a new pipette tip to draw 100 μL 10 -1 Add the virus dilution to the second tube of serum-free DMEM medium and pipette 5 times. The virus dilution in this tube is 10 -2 Repeat the above steps to the fourth centrifuge tube. The dilution of each tube is 10 -1 , 10 -2 , 10 -3 , 10 -4. The fifth tube of serum-free DMEM medium was used as a non-infected control. The cell culture medium in the 6-well plate was discarded, and after washing with PBS, 4 tubes of virus dilution and 1 tube of serum-free DMEM medium were added to the wells of the 6-well plate, respectively, and placed in a cell culture incubator for 1-2 hours. Different concentrations of BE solution were added and cultured in an incubator at 37°C and 5% CO2 for 24 hours. The 2×DMEM medium was allowed to stand at room temperature, and the low-melting point agar was melted in a 70-75°C water bath, mixed with an equal volume of 2×DMEM and 2% agar, TPCK trypsin was added to make the final concentration 2μg / mL, and BE was added. The virus solution was discarded and replaced with serum-free DMEM medium containing 1% agar and 2μg / mL TPCK trypsin, placed in a 4°C refrigerator, and cultured in a cell culture incubator for 3-5 days after the agar solidified. During this period, pay attention to the cell pathological changes.

[0087] After the cells were fully cytopathic, the monolayer cells were fixed with 10% formalin, stained with 1% crystal violet, and the plaques were counted. Finally, the maximum BE concentration (IC50) required to inhibit 50% cytopathic effect was calculated by regression analysis of the dose-response curve generated by the data. The selectivity index (SI) was calculated by CC50 / IC50, and 6 replicates were set for each group. Culture in a 6-well plate containing 10% FBS DMEM medium for 24 hours until the cells cover the bottom of the well; take 100 μL of virus sample and add it to the 6-well plate (except the control group), add 20 μL of BE solution with a concentration of 15 μmol / L to the high-concentration BE group, add 20 μL of BE solution with a concentration of 10 μmol / L to the medium-concentration group, and add 20 μL of BE solution with a concentration of 5 μmol / L to the low-concentration group. No BE solution is added to the infection group and the control group. Culture in an incubator at 37°C and 5% CO2 for 24 hours; melt low-melting point agar in a 70-75°C water bath, mix equal volumes of DMEM medium and 2% agar, and add TPCK trypsin to make its final concentration of 2 μg / mL; discard the virus solution and BE solution, replace with serum-free DMEM medium containing 1% agar and 2 μg / mL TPCK trypsin, put it in a 4°C refrigerator, and after the agar solidifies, incubate at 37°C and 5% The cells were cultured in a CO2 incubator for 72 h; during this period, the cell lesions were carefully observed. After the cells were fully lesioned, the monolayer cells were fixed with 10% formalin, stained with 1% crystal violet, and the number of formed plaques was counted.

[0088] (3) Cell activity detection

[0089] Take the HEp-2 cells treated with the above scheme for 24 hours and culture them in a 6-well plate containing DMEM medium containing 10% FBS for 24 hours until the cells cover the bottom of the well. Prepare 4 1.5mL centrifuge tubes and add 900μL of serum-free DMEM medium to each of them. Take 100μL of the cell suspension and add it to the 900μL serum-free DMEM medium in the first tube. Pipette up and down 5 times. The cell dilution of this tube is 10 -1 . Use a new pipette tip to draw 100 μL 10 -1 Add the cell suspension to the second tube of serum-free DMEM medium and pipette 5 times. The cell dilution in this tube is 10 -2 Repeat the above steps to the fourth centrifuge tube. The dilution of each tube is 10 -1 , 10 -2 , 10 -3 , 10 -4 The fifth tube is the original cell suspension, and each group has 6 replicate wells. After the cells were cultured under normal conditions (37°C, 5% CO2) for 48 hours, 10 μL of Cell Counting Kit-8 (CCK-8) solution was added to each well. After incubation for another 4 hours, the optical density (OD) (450 nm) of each well was measured using a microplate reader.

[0090] Cells were harvested in the logarithmic growth phase and used to prepare single-cell suspensions. Cells were stained with crystal violet, and the cell density was adjusted and the cells were plated at 4 × 10 3 The cell viability was calculated by: (I) adding BE solution of different concentrations, and adding DMEM medium containing 10% FBS to the blank group to determine the half cytotoxic concentration (CC 50 ); (II) 1#-HSV-1 virus and 2#-HSV-1 virus were prepared to infect each group of experimental cells. After the cells were cultured under normal conditions (37°C, 5% CO2) for 48 hours, 10 μL of CCK-8 solution was added to each well, and after further incubation for 4 hours, the optical density value (450 nm) of each well was measured using an ELISA reader.

[0091] Cell survival rate = absorbance value of experimental group / absorbance value of control group × 100%.

[0092] The detection steps are as follows:

[0093] (a) Cell suspension was diluted to 4×10 3 / well in a 96-well plate, with 100 μL of culture medium, and cultured in an incubator at 37°C, 5% CO2 for 24 h;

[0094] (b) The cells were transfected with 1#-HSV-1 strain and 2#-HSV-1 strain, respectively, and different concentrations of BE were added to the corresponding wells, and cultured in an incubator at 37°C and 5% CO2 for 48 h;

[0095] (c) Add 10 μL of CCK-8 solution to each well without introducing air bubbles into the wells;

[0096] (d) the culture plate was incubated in a 37°C, 5% CO2 incubator for 4 h;

[0097] (e) Before reading the plate, mix gently with a shaker for 1 min to ensure even color distribution;

[0098] (f) Use an ELISA reader to measure the absorbance of each well at 450 nm.

[0099] 2.2 Western blot detection

[0100] The present invention further explores the changes in NLRP3 inflammasome sensor proteins and infection-related proteins (gD, ICP-4, ICP-5, ICP-8) in the 2#-HSV-1 virus experimental group. Take the cells in the experimental group and harvest HEp-2 cells in RIPA buffer containing 1% PMSF and 1% protease inhibitors. After centrifugation of the lysate (12000r / min, 4°C) for 15min, the insoluble cell portion was removed, and the protein concentration of the total protein was measured by the bicinchoninic acid assay using a BCA kit. Equal amounts of protein (20μg) were separated from each sample by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (Sodium dodecyl sulfate polyacrylamidegel electrophoresis, SDS-PAGE) and transferred to a nitrocellulose membrane (Nitrocellulose membrane, NC membrane). The NC membrane was incubated with 0.05% Tween-20 in Tris buffered saline Tween (TBST) and 5% skim milk at room temperature for 2 h to block nonspecific sites. The NC membrane was then incubated with primary and secondary HRP-conjugated antibodies overnight at 4°C. The membrane was visualized by enhanced chemiluminescence, and the band intensity was measured and quantified.

[0101] Detection method:

[0102] (1) Prepare polyacrylamide gel (SDS) as required;

[0103] (2) Add 1 mL of RIPA lysis buffer containing 1% PMSF and 1% protease inhibitor to lyse the cells, quickly homogenize, and centrifuge (12000 r / min, 4°C) for 2 min. Take a small amount of supernatant for quantification, adjust all protein samples to equal concentration, and then load them. Before each loading, heat at 98°C for 3 min;

[0104] (3) 12% SDS-PAGE electrophoresis to separate proteins, 0.25% Coomassie Brilliant Blue staining for 2-4 h, rinsing, adding destaining solution, diffusion, destaining until the protein band is clear;

[0105] (4) After the NC membrane is soaked in methanol solution and equilibrated in equilibration solution, it is placed on the polyacrylamide gel for transfer at a constant voltage of 110 V for 60 min;

[0106] (5) After taking the membrane, rinse it in TBST solution, transfer it to the blocking solution containing 5% skim milk, and shake it on a decolorizing shaker at room temperature for 1 h;

[0107] (6) Remove the membrane and rinse it twice in TBST buffer, place it in TBST buffer containing 5% skim milk, add the primary antibody to the buffer, and incubate it at 4°C overnight;

[0108] (7) Remove the membrane and rinse it twice in TBST buffer, place it in TBST buffer containing 5% skim milk, add secondary antibody, and incubate at room temperature for 2 h;

[0109] (8) The membrane was imaged using ECL and quantified using Image J software.

[0110] 3. Results

[0111] Table 1 shows the effects of BE on HEp-2 cells infected with different HSV-1 strains.

[0112] Table 1 Effects of BE on HEp-2 cells infected with different HSV-1 strains

[0113]

[0114] The results showed that neither low nor high concentrations of BE had an inhibitory effect on 2#-HSV-1 virus infection ( Figure 1 , 2 and 4).

[0115] After HSV-1 infects host cells, immediate early genes (α genes), early genes (β genes), and late genes (γ genes) begin to express. The expression of infected cell protein (ICP4) reaches a peak at 2-4 hours after infection, activating the expression of β genes; ICP8 and ICP27 regulate viral DNA replication and participate in γ gene transcription; glycoprotein D (gD) is a late protein encoded by the γ gene, reaching a peak at 12-15 hours after infection. It is the main component of the viral envelope and helps the virus to be absorbed into host cells. All these indicators can be used to evaluate the activity of HSV-1. gD, ICP-4, ICP-5, and ICP-8 are active non-structural proteins of herpes viruses, but no inhibitory effect of BE on 2#-HSV-1 virus strain infection was observed ( Figure 3 ).

[0116] NLRP3 is an inflammasome sensor protein. After the virus infects the host cells, activation of NLRP3 will produce oligomeric complexes such as ASC and caspase-1, namely inflammasomes. Excessive activation of NLRP3 inflammasomes will cause cell damage. The expression levels of NLRP3 inflammasome-related proteins NLRP3, ASC, and caspase-1 were detected by WB. Previous studies have found that the activity of NLRP3 inflammasomes decreases with increasing BE concentration. High concentrations of BE have no effect on reducing the levels of NLRP3 inflammasome-related proteins infected with the 2#-HSV-1 virus strain ( Figure 5 ).

[0117] Example 2

[0118] This example demonstrates the screening of BE-resistant virus strain-specific antibodies.

[0119] 1. Immunization of BalB / C mice

[0120] Mice were immunized with inactivated 2#-HSV-1 strain. The specific steps are as follows: an equal volume of PBS containing inactivated HSV-1 strain and complete Freund's adjuvant was prepared into 200μl emulsion, and 6-week-old BalB / C mice were immunized by subcutaneous injection. Four weeks later, an equal volume of PBS containing inactivated HSV-1 strain and incomplete Freund's adjuvant was prepared into 200μl emulsion and injected subcutaneously again. Immunization was performed once a month for a total of 4 times. Finally, 200μl of PBS containing inactivated HSV-1 strain was injected intraperitoneally to boost immunization, and hybridoma fusion was performed 3 days later.

[0121] 2. Fusion of hybridomas

[0122] The mice to be fused after immunization were killed and spleen cells were taken out. By cell counting, mouse spleen cells were mixed with mouse myeloma cells SP2 / 0 (ATCC, CRL1581) at a biological ratio of 1:3, and 50% PEG was used to fuse the cells. The fused cells were added to 60 ml of RPMI 1640 medium (containing 10% fetal bovine serum) containing 1×HAT, and added to a 96-well cell culture plate at an amount of 1-2 drops per well. Subsequently, the hybridoma cells were cultured at 37°C, 5% CO2, and half of the medium was replaced every 3-4 days. Antibody screening was performed about 10 days later.

[0123] 3. Preliminary screening of monoclonal antibodies

[0124] Inactivate the 2#-HSV-1 strain to infect cells, extract proteins after lysis and dilute to 1μg / ml (based on total protein) with PBS, take 100μl of the diluted lysate and add it to the ELISA plate, incubate overnight at 4℃ and wash 3 times with PBST. After coating, add 200μl 0.2% BSA to block at room temperature for 1h, then wash 3 times with PBST. Pipette about 100μl of the supernatant from the 96-well cell culture plate into the ELISA plate, and add 100μl of fresh RPMI 1640 medium containing 1×HAT to the original well, continue to culture cells, and set up Balb / c negative serum and positive serum (1:2000 dilution) as controls. After incubating at room temperature for 1h, wash off the unbound antibodies with PBST. Then add 100μl HRP-goat anti-mouse IgG (1:10000 dilution) to each well, incubate at room temperature for 1h, and wash 5 times with PBST. After adding 100 μl TMB for color development for 2-10 min, add 50 μl H2SO4 to terminate the reaction and read the absorbance at 450 nm. The wells with OD450 values ​​greater than 3 times the OD450 value of the negative wells are positive wells for HSV-1 binding antibodies.

[0125] The top 36 monoclonal hybridoma cell lines were screened according to the OD450 values ​​and named HSV-Ab-1, HSV-Ab-2, HSV-Ab-3, HSV-Ab-4, HSV-Ab-5, HSV-Ab-6, HSV-Ab-7, HSV-Ab-8, HSV-Ab-9, HSV-Ab-10, HSV-Ab-11, HSV-Ab-12, HSV-Ab-13, HSV-Ab-14, HSV-Ab-15, HSV-Ab-16, and HSV-Ab-17. , HSV-Ab-18, HSV-Ab-19, HSV-Ab-20, HSV-Ab-21, HSV-Ab-22, HSV-Ab-23, HSV-Ab-24, HSV-Ab-25, HSV-Ab-26, HSV- Ab-27, HSV-Ab-28, HSV-Ab-29, HSV-Ab-30, HSV-Ab-31, HSV-Ab-32, HSV-Ab-33, HSV-Ab-34, HSV-Ab-35, HSV-Ab-36.

[0126] 4. Monoclonal antibody specificity detection

[0127] Take the cell lysate infected with 1#-HSV-1 and 2#-HSV-1 respectively, dilute with PBS, take 100μl of the diluted lysate and add it to the ELISA plate, incubate at 4℃ overnight and wash with PBST 3 times. Add 200μl 0.2% BSA to block at room temperature for 1h, then wash with PBST 3 times. Dilute each monoclonal antibody to 10μg / ml, and set up negative and positive controls. After incubation at room temperature for 1h, wash with PBST 3 times to wash away the unbound antibodies. Add 100μl HRP-goat anti-mouse IgG (1:10000 dilution) to each well, incubate at room temperature for 1h, and wash with PBST 5 times. Add 100μl TMB to color for 2-10min, then add 50μl H2SO4 to terminate the reaction. Read the absorbance at 450nm on the microplate reader.

[0128] The results are shown in Table 2. There are differences in the binding of HSV-Ab-12, HSV-Ab-16 and HSV-Ab-27 monoclonal antibodies to virus 1# and virus 2#. Among them, the binding difference of HSV-Ab-16 monoclonal antibody to virus 1# and virus 2# is the most significant.

[0129] Table 2

[0130]

[0131]

[0132] 5. Sequence analysis of HSV-Ab-16 monoclonal antibody

[0133] (1) RNA extraction

[0134] Hybridoma cells were lysed with Trizol to extract RNA from hybridoma cells. The specific steps of RNA extraction are as follows: add 200 μl of chloroform to every 1 ml of Trizol, shake thoroughly and let stand for 5 min; centrifuge at 13000 rpm / 4°C / 15 min; draw 400 μl of supernatant into an equal volume of pre-cooled isopropanol, mix well and centrifuge at 13000 rpm / 4°C / 15 min; remove the supernatant, add 70% ethanol to wash the precipitate twice, centrifuge at rpm / 4°C / 10 min; remove the supernatant, add 40 μl of RNase-free water to dissolve to obtain RNA solution.

[0135] (2) Obtaining cDNA

[0136] The RNA obtained in step 1 was reverse transcribed to obtain cDNA. The specific steps of reverse transcription are as follows: take 16 μl of the RNA solution prepared in step 1, add 1 μl of 100 mM oligo dT, react at 70°C for 5 min; immediately place on ice; add 1 μl of RNase inhibitor, 1 μl of dNTPs (concentration of 10 mM), 1 μl of MLV reverse transcriptase and 5 μl of buffer, react at 42°C for 60 min; treat at 72°C for 5 min.

[0137] (3) PCR amplification and sequencing

[0138] Using the cDNA obtained in step 2 as a template, PCR amplification was performed using heavy chain primers F and heavy chain primers R, and light chain primers F and light chain primers R, respectively, to obtain the fragments encoding the heavy chain and light chain and sequence them. The primer sequences are as follows:

[0139] Heavy chain primer F: CAGGTACAGCTGGAGGAGTC;

[0140] Heavy chain primer R: ATAGACAGATGGGGGTGTCGTTTTGGC;

[0141] Light chain primer F: GATATTGTGATGACACAGTCTACA;

[0142] Light chain primer R: GGATACAGTTGGTGCAGCATC.

[0143] The above PCR reaction conditions are: pre-denaturation, 95°C, 3min; denaturation, 95°C, 30s; annealing, 56°C, 32s; extension, 73°C, 38s, for a total of 31 cycles; and finally extension for 10min.

[0144] The sequencing results are shown in Table 2:

[0145] Table 3 HSV-Ab-16 monoclonal antibody variable region sequence

[0146]

[0147] The amino acid sequences of the obtained VH and VL were further analyzed to determine the complementarity determining regions (CDRs). The results are shown in Table 4.

[0148] Table 4 CDR analysis of VH and VL domains of monoclonal antibodies

[0149]

[0150]

[0151] The heavy chain variable region nucleic acid and amino acid sequences of the BE-resistant virus strain-specific antibody are shown in Table 3. The heavy chain variable region nucleotide sequence encoding the BE-resistant virus strain-specific antibody is SEQ ID NO.1, and the heavy chain variable region amino acid sequence is SEQ ID NO.2. The amino acid sequence (SEQ ID NO.5) shown at positions 28-31 of the heavy chain variable region amino acid sequence of the BE-resistant virus strain-specific antibody is named as the heavy chain CDR1 of the BE-resistant virus strain-specific antibody. The amino acid sequence (SEQ ID NO.6) shown at positions 49-58 of the heavy chain variable region amino acid sequence of the BE-resistant virus strain-specific antibody is named as the heavy chain CDR2 of the BE-resistant virus strain-specific antibody. The amino acid sequence (SEQ ID NO.7) shown at positions 92-101 of the heavy chain variable region amino acid sequence of the BE-resistant virus strain-specific antibody is named as the heavy chain CDR3 of the BE-resistant virus strain-specific antibody.

[0152] The nucleotide sequence encoding the light chain variable region of the BE-resistant virus strain-specific antibody is SEQ ID NO.3, and the amino acid sequence of the light chain variable region is SEQ ID NO.4. The amino acid sequence (SEQ ID NO.8) shown at positions 26-31 of the amino acid sequence of the light chain variable region of the BE-resistant virus strain-specific antibody is named as the light chain CDR1 of the BE-resistant virus strain-specific antibody. The amino acid sequence (SEQ ID NO.9) shown at positions 47-57 of the amino acid sequence of the light chain variable region of the BE-resistant virus strain-specific antibody is named as the light chain CDR2 of the BE-resistant virus strain-specific antibody. The amino acid sequence (SEQ ID NO.10) shown at positions 90-101 of the amino acid sequence of the light chain variable region of the BE-resistant virus strain-specific antibody is named as the light chain CDR3 of the BE-resistant virus strain-specific antibody.

[0153] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. An antibody or an antigen-binding fragment thereof, characterized in that The antibody or antigen-binding fragment thereof comprises heavy chain antigen complementary determining regions CDR1-3 and / or light chain antigen complementary determining regions CDR1-3, wherein the heavy chain antigen complementary determining regions CDR1-3 respectively have the sequences shown in SEQ ID NO.5-7, and the light chain antigen complementary determining regions CDR1-3 respectively have the sequences shown in SEQ ID NO.8-10.

2. The antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The antibody or antigen-binding fragment thereof comprises any one of the amino acid sequences shown in (I)-(III): (I) the heavy chain variable region sequence shown in SEQ ID NO.2 and / or the light chain variable region sequence shown in SEQ ID NO.4; (II) an amino acid sequence that has at least 80% homology with the amino acid sequence shown in (I) and has the same function; (III) An amino acid sequence obtained by modifying, replacing, deleting or adding one or more amino acids to the amino acid sequence shown in (I) or (II) and having the same function.

3. The antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The antibodies include monoclonal antibodies, polyclonal antibodies, chimeric antibodies, humanized antibodies or mouse antibodies; the antigen-binding fragments include Fab, Fab', F(ab)2, F(ab')2, scFv, scFv Fc fragment or single-chain antibody ScAb.

4. A nucleic acid molecule, characterized in that It comprises a nucleotide sequence encoding the antibody or antigen-binding fragment thereof according to any one of claims 1 to 3.

5. The method for preparing the antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, characterized in that: Prepared by artificial synthesis or genetic engineering.

6. A product for detecting berberine-resistant herpes simplex virus type 1, characterized in that: It comprises the antibody or antigen-binding fragment thereof according to any one of claims 1 to 3.

7. The detection product according to claim 6, characterized in that: The detection product includes a test kit, a test strip or a chip.

8. The detection product according to claim 7, characterized in that: The kit includes at least one of an ELISA detection kit, a plate chemiluminescence detection kit, a fully automatic chemiluminescence detection kit, a radioimmunoassay kit, a fluorescence immunoassay kit, a chemiluminescence immunoassay kit, an immunoblotting kit, an immunoprecipitation kit, a flow cytometry detection kit, a colloidal gold detection kit, a bioluminescence immunoassay kit, an immunochromatography detection kit, an electrophoresis analysis kit, a latex method-based kit, and a kit based on a direct competition method or an indirect competition method.

9. A method for detecting berberine-resistant herpes simplex virus type 1 in a biological sample from a subject, characterized in that: The method comprises the step of contacting the herpes simplex virus type 1 antigen from the biological sample with the antibody or antigen-binding fragment according to any one of claims 1 to 3.

10. The method according to claim 9, characterized in that The sample is a fluid sample or a tissue sample.

Images