Morchella sextesii strain meiya no. 8 and application thereof

Abstract

This invention provides a *Morchella esculenta* strain, Meizai 8, and its applications, relating to the field of strain selection and breeding technology. This *Morchella esculenta* strain, Meizai 8, underwent genetic variation induced by spaceflight, followed by screening for stably inherited traits through subculturing, and was obtained through fruiting screening experiments. The Meizai 8 strain exhibits rapid mycelial germination, resistance to low temperatures, resistance to white mold (*Diploöspora longispora*), early and abundant primordia development, strong clustering of young mushrooms, and good-shaped, non-fragile commercial mushrooms, demonstrating broad application prospects.

Description

Technical Field

[0001] This invention relates to the field of strain selection and breeding technology, and more specifically, to a strain of morel mushroom, Meizai No. 8, and its application. Background Technology

[0002] Morel (Morchella sextelata) is an important medicinal and edible fungus. Its attractive commercial appearance, short cultivation cycle, delicious taste, and high economic value have attracted widespread attention from researchers worldwide. Screening for high-quality, high-yield, and stable-yield strains has always been a pursuit of those skilled in the art, and it has immense application value.

[0003] Creating genetic variations and improving genetic characteristics through breeding to cultivate new varieties of morel mushrooms with stable genetic traits, high quality, and high yield has always been a focus of those skilled in the art, and it holds immense application value.

[0004] Space breeding, also known as space cultivation, involves sending crop seeds / fungi strains to space aboard recoverable spacecraft. Utilizing the unique environment of cosmic rays, microgravity, and high vacuum, a small number of these seeds / fungi strains undergo genetic mutations. Upon returning to Earth, they are then selected and cultivated by scientists over multiple generations to ultimately develop new varieties with stable characteristics. From 2021 to the present, the applicant has used Shenzhou-12, 14, and 16 manned spacecraft to carry strains of cultivated edible fungi such as morel mushrooms, red-topped bamboo fungus, enoki mushrooms, oyster mushrooms, and white ginseng into space to select and cultivate new varieties with strong resistance to high temperatures, low temperatures, humidity, drought, and pests and diseases, serving my country's economic development. Summary of the Invention

[0005] The purpose of this invention is to provide a *Morchella esculenta* strain, Meizai No. 8, and its applications. This *Morchella esculenta* strain, Meizai No. 8, has the characteristics of rapid mycelial germination, resistance to low temperature, resistance to white mold (Diploöspora longispora), early and abundant primordia, strong clustering of young mushrooms, and good shape and non-breakability of commercial mushrooms.

[0006] The embodiments of the present invention are implemented as follows:

[0007] A strain of *Morchella sextelata*, known as "Meizai 8", with accession number CGMCC No. 41345, was deposited on June 25, 2024, at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. It is classified and named *Morchella sextelata*.

[0008] Application of the above-mentioned morel strain Meizai No. 8 in morel cultivation and production.

[0009] The beneficial effects of the embodiments of the present invention are:

[0010] This invention provides a *Morchella esculenta* strain, Meizai 8, and its applications. This strain, Meizai 8, underwent genetic variation induced by spaceflight, and its stable heritable traits were screened through subculturing. It was then selected through fruiting screening experiments. This *Morchella esculenta* strain Meizai 8 exhibits rapid mycelial germination, resistance to low temperatures, resistance to white mold (*Diploöspora longispora*), early and abundant primordia development, strong clustering of young mushrooms, and good shape and resistance to breakage of commercial mushrooms, demonstrating broad application prospects. Attached Figure Description

[0011] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0012] Figure 1 This is a schematic diagram of the morphology of the morel mushroom "Meizai No. 8" provided in Embodiment 1 of the present invention;

[0013] Figure 2 The illustration shows a cultivation scenario of the *Morchella esculenta* strain Meizai 8 provided in the application examples of this invention. Detailed Implementation

[0014] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0015] The following is a detailed description of a strain of morel mushroom, Meizai No. 8, and its application according to an embodiment of the present invention.

[0016] This invention provides a strain of *Morchella sextelata*, known as "Meizai 8", with accession number CGMCC No. 41345. It was deposited on June 25, 2024, at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, and is classified as *Morchella sextelata*.

[0017] The cultivation method for this *Morchella esculenta* strain, Meizai No. 8, is as follows:

[0018] S1. Collect fresh morel spore prints and dry them for later use.

[0019] S2. Pure cultured single-cell strains of *Morchella esculenta* were obtained by single-spore isolation.

[0020] S3. The pure culture of a single-spore strain was carried into space for cultivation to obtain the space-borne strain.

[0021] S4. The returned spaceborne strains are activated and systematically screened to obtain single-filament strains.

[0022] S5. Passage culture of single strain mycelia, select strains containing both Mat1-1 and Mat1-2 mating types, with the fastest mycelial germination rate, neat edges, dense sclerotia and low pigment, and complete the preliminary domestication work. Preserve the domesticated strains.

[0023] S6. Multiple screening experiments were conducted at various locations on the domesticated strain to select a new morel strain, known as "Six Sisters Morel." This strain exhibits rapid mycelial germination, resistance to low temperatures and white mold (Diploöspora longispora), early and abundant primordia development, strong clustering of young mushrooms, and good shape and resistance to breakage of marketable mushrooms. This achieved the goal of domesticating and selecting superior strains. This strain was named "Meizai No. 8".

[0024] This strain of *Morchella esculenta*, strain #8, exhibits the following morphological characteristics: Its mycelium is robust and grows rapidly, with neatly aligned ends and branching angles less than 45°; after approximately 3 days of cultivation at 18℃, it fully covers a 9cm diameter petri dish, and after approximately 10 days, it is covered with pale yellow granular sclerotia. The mature fruiting body has a conical to oblong cap, brown to dark brown in color, with a pointed apex, a length of 8-15cm, and a width of 5-8cm; the ridges are of moderate density, with distinct longitudinal ridges, 20-25 longitudinal veins, and 9-14 transverse veins; the flesh is approximately 3mm thick; the stipe is smooth, white, with an indistinct depression at the junction of the cap and stipe, and is 4-5cm long and 3-4cm wide. The fruiting bodies grow in clusters to scattered locations. Figure 1 As shown.

[0025] The *Morchella esculenta* strain 8 was subjected to ITS amplification and sequencing using the universal fungal primers ITS4 / ITS5. The nucleotide sequence of the molecular fragment is shown in SEQ ID NO:1, as follows:

[0026] .

[0027] The nucleotide sequence SEQ ID NO:1 was aligned with GenBank (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome#), and the result showed 100% homology with *Morchella esculenta*, accession number (MG589676), in the database. Therefore, this *Morchella esculenta* strain, Meizai 8, was identified as *Morchella esculenta*.

[0028] Furthermore, through genetic testing, it was discovered that compared to the commonly available *Morchella esculenta* strain "Meizai 8," the *Morchella esculenta* strain "Meizai 8" includes a first specific DNA fragment of approximately 453 bp, a second specific DNA fragment of approximately 491 bp, and a third specific DNA fragment of approximately 337 bp. The nucleotide sequence of the first specific DNA fragment is shown in SEQ ID NO:2, and is as follows:

[0029] CACTGAAATGGTATGTATCTCTAGCAATATACTCAGGGTGTTAATTCTTGGTAGGTCCAGAGAGTTCGGTTCCTCAATTAGTTTTGTTGTATATTGACTGGGCCTGGTCTCCTGAGTACTGATAGGTAAGACCAGCAATATTGACGGGTCACACATTCAACGACGTCTACGTGATCGATTGTGCTGGCCACTCCGAGGAAATGGGTTCCCACTTTGAACGCTAACT CCAAAGGTGCCCACCAACACAAATAGGCTGCCAACCCCGCCTAACACCGCTTCACACTCCATCCCTACCCATCATCCCTTCCCATCACTCTTACTCATGGCTTGCTTCTTCCCACCACCCAGCCACCACATTCCTCGGCTCTGGTTCTTACCCCCCCCCAAGGCCAGGGGATACATCCTAGGGAGTGACGCAGACACGTACGGAACCGAATGTACGACGGAAAAAC.

[0030] The nucleotide sequence of the second specific DNA fragment is shown in SEQ ID NO:3, as follows:

[0031] ACCGAGTGTTTATTGTGACGTAGAAGCCTCCTCCGCCCCTCTCTCGGCATTCCCAATTGTCAACACCTCTAGCCTAAGCCCCCGCGTGACCTCCTACCGTCAGGAACAGGTAAAACGCAACGCTGCGCATGGGGATGGGGTGCGCTGAATCTGAATATCCACCGGTATATATGCCCACCTGTATCACCCGCAATCTTCGCGGGACCAGGTGGAATGACGTCGGGGCAGAGCACCGGTGACAGATTCCGGCAATCATGTATTTCCTAATCAACCACTAGCTTTCACGGCTATTTCCTCTTTGCCCAAAGTCCTAAGTAGTCCAAGCCCGGTATTCAAGCGTAGGCTACGGTATTGAGAGAAGCCCTAACTATAATTCTAAGTTCGCTAAGACTAGACACGTGAAACAGACTTGGCCTAGTGCTGCGACATCCGGGACGAGTTGAAGACAGTGTTAAACCTTCTTTTTATGTGTCCCGGCCACAACCTCTATC。

[0032] The nucleotide sequence of the third specific DNA fragment is as shown in SEQ ID NO:4, specifically as follows:

[0033] CGGACCACCTTATCGGACCTGAATCCTATCCCTGTGTCCCACCTATCTTTGAACCCTATACCTCGCCTTGAGTATCGATGTTTATATCGAGTACGATCAGCTATCATGTATATACTCCTACCAACCAAAGACCTCTCCCTCACTACCTGCCCCTCGCCTTTGAAGGGCACGGGGTATAGAAGAAATGAAACAAACGACTGGGACCCAATACTCTTTCATATACTCTCTTGTGAGAGGACCCCAAGGACGCCATCTATGGCTCGATATAGCTCCTTCCCCTCCTGCTGATTCTCCTATCTTTTTCGAACCCCCACCTCCAAACGCACCCCGAACGGCC。

[0034] The first, second, and third specific DNA fragments were obtained by PCR amplification of the *Morchella esculenta* strain Meizai 8 using specific primers. The specific method involves using conventional fungal whole genome sequencing (WGM) extraction, amplification, and genome sequencing methods for whole genome sequencing and assembly. Furthermore, referring to Wei Chuanzheng et al. (2023), shallow whole genome sequencing was performed on the un-assembled *Morchella spp.* strain and the *Morchella spp.* strain Meizai 8. Then, the genome data was assembled according to conventional methods, and specific target fragments contained in the *Morchella spp.* strain Meizai 8 were selected. Finally, primers were designed using http: / / www.primer3plus.com / , resulting in three pairs of specific primers: Primer_MZ8_1L and Primer_MZ8_1R, Primer_MZ8_2L and Primer_MZ8_2R, and Primer_MZ8_3L and Primer_MZ8_3R. Their nucleotide sequences are shown in SEQ ID NO:5~SEQ ID NO.10, as follows:

[0035] Primer_MZ8_1L:5'-GCGGTTGCGTACGTGTCTA-3';

[0036] Primer_MZ8_1R:5'-GCGGTTGCGTACGTGTCTA-3';

[0037] Primer_MZ8_2L:5'-GATAGAGGTTGTGGCCGGG-3';

[0038] Primer_MZ8_2R:5'- CCGCCCAATAAACATGCCG-3';

[0039] Primer_MZ8_3L:5'-GAGGTAGGTGTGACGGTCG-3';

[0040] Primer_MZ8_3R:5'-TGAATGGGCAAAAAGGCGC-3'.

[0041] During PCR amplification, the primer sets Primer_MZ8_1L / Primer_MZ8_1R, Primer_MZ8_2L / Primer_MZ8_2R, and Primer_MZ8_3L / Primer_MZ8_3R were added to the amplification system, and the results were detected by 2% agarose gel electrophoresis after the reaction was completed.

[0042] The amplification system is as follows:

[0043] PCR Buffer 1×, MgCl2 1.50 mM, dNTPs Mix 0.25 mM, specific primers 1.00 mM each, rTaq Polymerase 1.5 U, template DNA 50 ng;

[0044] The reaction conditions are:

[0045] Pre-denaturation at 95℃ for 5 min, followed by 95℃ for 60 s, 51℃ for 40 s, and 72℃ for 30 s, for 35 cycles; finally extended at 72℃ for 10 min.

[0046] Sequencing of the PCR amplification products was performed at Beijing Biotech Biotechnology Co., Ltd., Shanghai Sangon Biotech Co., Ltd., and Yingjun Biotechnology Co., Ltd. An ABI 3730 DNA sequencer was used, and the sequencing primers were the same as those used for PCR amplification. Only strain 'Meizai 8' yielded the first, second, and third specific DNA fragments. Untransplanted strains or the commonly available *Morchella esculenta* strain failed to amplify these three specific DNA fragments.

[0047] This invention also provides an application of the above-mentioned morel strain Meizai No. 8 in morel cultivation and production.

[0048] The cultivation conditions for this *Morchella esculenta* strain, Meizai No. 8, are as follows:

[0049] During cultivation, the soil temperature should be 5-15℃, and during the mycelial culture period, the soil temperature should be controlled at 8-20℃. During the primordia differentiation and young mushroom growth period, the soil temperature should be controlled at 8-13℃, the relative humidity of the air should be 80%-95%, and the light intensity should be 400-800 Lux.

[0050] For the *Morchella esculenta* strain Meizai No. 8, a suitable nutrient package was obtained after repeated testing. The nutrient package, by weight percentage, includes:

[0051] Common wheat 28%~43%, corn cob 55%~70%, quicklime 1%~2%.

[0052] Its moisture content is 60%~65%, and its pH is 6.5~7.5. This nutrient pack can effectively promote the growth of bacterial strains, improve yield and strain quality.

[0053] The features and performance of the present invention will be further described in detail below with reference to embodiments. Example

[0054] This embodiment provides a *Morchella esculenta* strain, Meizai No. 8, whose cultivation process is as follows:

[0055] S1. Wild morel fruiting bodies were collected in Laojun Mountain, Lijiang, Yunnan Province in August 2007, with the preservation number HKAS62872, and were dried for later use.

[0056] S2. In January 2019, spores obtained from the fruiting body were isolated as single spores, yielding 100 different types of *Morchella spp.* strains, numbered G1-G100. At the Kunming Institute of Botany, Chinese Academy of Sciences, hybrid strains were selected through conventional edible fungi breeding methods. These strains exhibited no antagonism, no fan-shaped mutations, vigorous mycelial growth, slow aging, and abundant sclerotium formation, and were intended for spaceflight (numbered G14-97). They were identified as *Morchella spp.* by conventional ITS molecular biological identification. Morchella sextelata ).

[0057] S3. The strain was carried aboard the Shenzhou-14 manned spacecraft on June 5, 2022, and returned to Earth on December 4, 2022, after being tested and brought back to the Culture Collection Center of the Kunming Institute of Botany, Chinese Academy of Sciences for related research.

[0058] S4. The space-borne strain G14-97 was activated and systematically screened to obtain 500 single-mycelial strains, numbered 97G01-97G500.

[0059] S5. The 500 obtained strains underwent mating type gene testing to determine that they contained two mating types, Mat1-1 and Mat1-2 (refer to DuX.H et al., 2017). Subsequently, referring to GB / T 21125-2007 Technical Specifications for Edible Fungi Variety Breeding, the mycelial growth rate, vigor, uniformity, stability, antagonism, and salt tolerance of these 500 strains were studied. Strains containing both Mat1-1 and Mat1-2 mating types, exhibiting the fastest mycelial germination rate, neat edges, dense sclerotia, and low pigmentation were selected. Multi-point, multiple-stage strain fruiting screening experiments were conducted, referencing the applicant's previously granted national invention patent (authorization announcement number: CN107409763B). A *Morchella esculenta* strain, *Morchella esculenta*, was obtained, exhibiting rapid mycelial germination, resistance to low temperatures, and resistance to white mold (long-spore monoseptate spores). Diploöspora longispora The strain exhibits early and abundant primordia development, strong clustering of young mushrooms, and good shape and resistance to breakage of commercial mushrooms, achieving the goal of domestication and selection of superior strains. This strain was named "Meizai No. 8". The strain was preserved at the Kunming Institute of Botany, Chinese Academy of Sciences (KUNCC) using the 10% glycerol + distilled water preservation method.

[0060] Application examples

[0061] This application example uses the morel strain Meizai No. 8 provided in Example 1 and compares it with the strain G14-97, which was not carried by spacecraft, to examine the mycelial germination speed, resistance to low temperature, resistance to white mold, number of primordia, number of young mushrooms, number of marketable mushrooms, and yield per unit area of ​​the tested strain.

[0062] The cultivar formula used in this embodiment is: 40% common wheat, 58% corn cob, 2% slaked lime, with a moisture content of 55-60% and a pH of 7.

[0063] The nutrient bag formula used in this embodiment is: 30% ordinary wheat, 68% corn cob, 2% slaked lime, with a moisture content of 55-60% and a pH of 7.

[0064] When comparing cultivation methods, it is necessary to keep the cultivation conditions of the two strains consistent, and cultivate them according to the following methods:

[0065] 1) Cultivation materials: The main materials are corn cobs and wheat, and the auxiliary materials are lime, gypsum, etc.

[0066] 2) Cultivation season: October to December when the soil temperature is 5-15℃.

[0067] 3) Cultivation methods: field cultivation with soil covering and film covering.

[0068] 4) Management methods: During the mycelial culture period, the soil temperature should be controlled between 8 and 20℃; during the primordia differentiation and young mushroom growth period, the soil temperature should be controlled between 8 and 13℃, the relative humidity of the air should be 80% to 95%, and the light intensity should be 400 to 800 Lux.

[0069] 5) Harvesting criteria: Mushrooms with caps longer than 6cm can be harvested (e.g., ...). Figure 2 (As shown).

[0070] The results of the cultivation comparison are shown in Table 1.

[0071] Table 1. Comparison results of morel cultivation at Liumei Clinic.

[0072] variety Low temperature resistance (-20℃) Resistant to white mold (Longspore Monoseptospora) Time for the nutrient bag to fully mature (soil temperature 12℃) Number of primordia (units / square centimeter) Number of young mushrooms formed (per square meter) Yield per unit area (kg / mu) Beautiful No. 8 anti- anti- 7 8 250 1300 G14-97 Not resistant Not resistant 10 4 110 400

[0073] As shown in Table 1, compared with strain G14-97 which was not carried by spacecraft, strain Meizai 8 exhibited faster mycelial germination and resistance to low temperatures and white mold. Its primordia formation reached 8 per square centimeter, an increase of approximately 100%. The number of young mushrooms formed was 250 per square meter, an increase of approximately 127% compared to G14-97. The yield reached 1300 kg / mu, more than three times that of G14-97.

[0074] In summary, this invention provides a *Morchella esculenta* strain, Meizai 8, and its applications. This strain, Meizai 8, underwent genetic variation induced by spaceflight, and its stable heritable traits were screened through subculturing. It was then selected through fruiting screening experiments. This *Morchella esculenta* strain Meizai 8 exhibits rapid mycelial germination, resistance to low temperatures, resistance to white mold (*Diploöspora longispora*), early and abundant primordia development, strong clustering of young mushrooms, and good shape and resistance to breakage of commercial mushrooms, demonstrating broad application prospects.

[0075] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A single morel mushroom (Six Sisters) Morchella sextelata The strain Meizai No. 8 is characterized by, The accession number is CGMCC No. 41345. It was deposited on June 25, 2024, at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

2. A type of morel mushroom as described in claim 1 ( Morchella sextelata The cultivation method of strain 8, Meizai, is characterized by: The cultivation conditions for the *Morchella esculenta* strain Meizai No. 8 are as follows: soil temperature of 5-15℃ during cultivation, soil temperature of 8-20℃ during mycelial culture, soil temperature of 8-13℃ during primordia differentiation and young mushroom growth, relative humidity of 80%-95%, and light intensity of 400-800 Lux.

3. The cultivation method according to claim 2, characterized in that, The cultivation cycle of the aforementioned morel strain, Meizai No. 8, is 90-130 days.

4. The cultivation method according to claim 3, characterized in that, The nutritional package of the Liu Mei Morel strain Mei Zai No. 8, by weight percentage, includes: Common wheat 28%~43%, corn cob 55%~70%, and quicklime 1%~2%.

5. The cultivation method according to claim 4, characterized in that, The nutrient pack has a water content of 55% to 60% and a pH of 6.5 to 7.5.

Images