Selenium-enriched yeast strain, selenium-enriched yeast and application thereof

Abstract

The invention relates to a selenium-enriched yeast strain, a selenium-enriched yeast product and application of the selenium-enriched yeast strain, the selenium-enriched yeast strain provided by the invention is a saccharomyces cerevisiae SEMCX2Z1 strain which is preserved in the China Center for Type Culture Collection (CCTCC), the preservation number is CCTCC NO: M20232369, the strain can grow in a sulfur-free selenium-containing culture medium, the inorganic selenium absorption rate reaches 91%-96%, and the selenium-enriched yeast product can be used for preparing a selenium-enriched yeast product. The selenium content in the selenium-enriched yeast product is 4600 to 6100 mg / kg.

Description

Technical Field

[0001] The invention belongs to the field of microorganisms and fermentation engineering, and specifically relates to a selenium-enriched yeast strain, selenium-enriched yeast and applications thereof. Background Art

[0002] Selenium (Se) is an indispensable trace element in organisms and plays an important physiological role. Most of the selenium that plays a physiological function exists in organisms in the form of selenoproteins. Selenium acts on the reactions catalyzed by enzymes in organisms and can protect biofilms. Literature reports that selenium has anti-cancer effects, antagonizes harmful metal elements that invade the body, and can also enhance the body's immunity and reproductive ability.

[0003] Yeast is the most widely used, safest and most effective nutritional microorganism. It is rich in protein, trace elements and other minerals, and is also rich in B vitamins (mainly vitamin B1 and B2).

[0004] Yeast can convert toxic inorganic selenium into non-toxic organic selenium during its growth. Supplementing selenium through selenium-enriched yeast is a safe and effective way, and is widely used in human pharmaceutical nutritional supplements and animal breeding.

[0005] At present, the selenium content of selenium-enriched yeast is generally 2000-3000 mg / kg (i.e. 2000-3000 ppm), and the absorption rate of inorganic selenium by selenium-enriched yeast strains is 50-70%. A large amount of inorganic selenium remains in the fermentation wastewater, which requires environmental protection treatment, increasing the process operation cost and causing certain pollution to the environment. Therefore, it is particularly important to obtain strains with high absorption rate of inorganic selenium through strain breeding, which can reduce selenium emissions in fermentation wastewater. Summary of the invention

[0006] In view of the problem that the existing selenium-enriched yeast strain has a low absorption rate of inorganic selenium and the selenium content of the selenium-enriched yeast is low, the present invention provides a selenium-enriched yeast strain, selenium-enriched yeast and applications thereof.

[0007] Specifically, the present invention proposes the following technical solutions:

[0008] In a first aspect, the present invention provides a selenium-enriched yeast strain, characterized in that the selenium-enriched yeast strain is Saccharomyces cerevisiae SEMCX2Z1 strain, which is deposited in China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: M 20232369.

[0009] Preferably, the selenium-enriched yeast strain is characterized in that the strain can grow in a sulfur-free selenium-containing medium;

[0010] Preferably, the inorganic selenium absorption rate of the strain reaches 91%-96%;

[0011] And / or, the inorganic selenium is sodium selenite.

[0012] In a second aspect, the present invention provides a selenium-enriched yeast, characterized in that it is prepared by fermenting the selenium-enriched yeast strain, and has a selenium content of 4600-6100 mg / kg based on the dry weight of the selenium-enriched yeast.

[0013] In a third aspect, the present invention provides a method for preparing the selenium-enriched yeast, characterized in that the method comprises:

[0014] (1) expanding the culture of selenium-enriched yeast strains;

[0015] (2) adding the product obtained in step (1) to a sulfur-free, selenium-containing medium for fermentation;

[0016] (3) After solid-liquid separation of the fermentation liquid obtained in step (2), yeast cells are collected.

[0017] Preferably, the preparation method is characterized in that in step (2), the sulfur-free selenium-containing culture medium comprises sulfur-free nutrient elements, sodium selenite solution, glucose solution and ammonia water which are added simultaneously or separately, and the components are added to the selenium-enriched yeast fermentation culture medium;

[0018] Preferably, the concentration of the sodium selenite solution is 9.0-15.2 g / L, the mass percentage of the glucose solution is 25-35%, and the mass percentage of the ammonia water is 16-25%.

[0019] Preferably, the sulfur-free nutrient elements, measured in grams per liter, include: 35-50 g / L ammonium dihydrogen phosphate, 12.5-17.5 g / L calcium chloride, 0.025-0.035 g / L manganese chloride, 7.5-17.5 g / L magnesium chloride, 0.01-0.02 g / L ammonium molybdate, 3-6 g / L zinc gluconate, 0.15-0.35 g / L ferrous chloride, 0.00 5-0.01g / L potassium iodide, 0.025-0.05g / L sodium tetraborate, 0.015-0.035g / L copper chloride, 0.0025-0.005g / L biotin, 0.01-0.025g / L riboflavin (VB2), 0.03-0.05g / L pyridoxine (VB6), 0.25-0.5g / L niacin (B3) and 0.1-0.2g / L calcium pantothenate (VB5);

[0020] Preferably, the sulfur-free nutrient elements also include sulfur-free amino acids, which include 5-12 g / L glutamic acid, and / or 4.5-12 g / L threonine, and / or 2-5 g / L serine, and / or 3-8 g / L lysine, and / or 4-12 g / L alanine, measured in grams (g) of the substance contained in each liter of volume of the sulfur-free nutrient elements.

[0021] Preferably, the preparation method is characterized in that, in step (2), the flow rate of the sulfur-free nutrient element is 20-60 ml / h, calculated per liter of fermentation liquid during fermentation culture;

[0022] And / or, the flow rate of the sodium selenite solution is 8.5-54 ml / h;

[0023] And / or, the flow rate of the glucose solution is 10-30 ml / h;

[0024] Preferably, the pH of the selenium-enriched culture medium is adjusted to 4.0-6.0 by adding ammonia water.

[0025] Preferably, the preparation method is characterized in that in step (2), the culture time is 20-28h; and / or the culture temperature is 28-31°C.

[0026] Preferably, the preparation method is characterized in that, in step (3), solid-liquid separation is performed by centrifugation; preferably, the centrifugal speed is 4000-5000 rpm;

[0027] Preferably, the preparation method is characterized in that step (3) further comprises a drying step, and preferably, the drying is selected from spray drying.

[0028] In a fourth aspect, the present invention provides the use of the selenium-enriched yeast strain or the selenium-enriched yeast or the selenium-enriched yeast prepared by the preparation method in food, health products, medicines and feed.

[0029] In a fifth aspect, the present invention provides a selenium-enriched yeast product, characterized in that it is prepared using the organic selenium-enriched yeast or the selenium-enriched yeast prepared by the preparation method as a raw material.

[0030] In a sixth aspect, the present invention provides a method for treating pollutants using the selenium-enriched yeast strain, characterized in that the selenium-enriched yeast strain is added to the pollutants to absorb inorganic selenium to treat the pollutants.

[0031] Preferably, the method for treating pollutants using a selenium-enriched yeast strain is characterized in that the pollutants are sewage.

[0032] Beneficial effects of the present invention:

[0033] The present invention utilizes the characteristic that brewer's yeast cannot grow in a medium without sulfur, adopts plasma mutagenesis and sulfur-free selenium-containing medium to carry out directional breeding of selenium-enriched yeast strains, and obtains strains that can efficiently use selenium to replace sulfur to synthesize intracellular functional products. The absorption rate of inorganic selenium by the new selenium-enriched yeast strain reaches more than 91%, which is significantly improved compared with the current industry average absorption rate of 50-70%. It reduces selenium residues in fermentation wastewater, reduces process operation costs, and protects the environment. This selenium-enriched yeast strain can be added to selenium-enriched pollutants to absorb inorganic selenium to treat pollutants.

[0034] Strain deposit information

[0035] The Saccharomyces cerevisiae SEMCX2Z1 strain provided by the present invention was deposited in the China Center for Type Culture Collection (CCTCC) on November 28, 2023, with a deposit number of CCTCC NO: M 20232369, and a deposit address: Wuhan University, Wuhan, China, Postal Code: 430072; Telephone: 027-68754052. DETAILED DESCRIPTION

[0036] The technical solution of the present invention is further described in detail below in conjunction with specific embodiments and comparative examples, but the present invention is not limited to the following technical solution.

[0037] The present invention uses plasma mutagenesis combined with sulfur-free selenium-containing medium for the first time to screen selenium-enriched yeast. The mechanism is as follows: selenium and sulfur are elements of the same family and are also competitive elements. The two elements can replace each other when entering the strain to synthesize amino acids or other functional compounds. However, most brewer's yeast strains have weak functions of replacing sulfur with selenium and cannot grow in sulfur-free selenium-containing medium. After plasma mutagenesis, a large number of strains that have not produced positive mutations will die directly, and very few strains that have produced positive mutations can grow in sulfur-free selenium-containing medium, indicating that these strains can efficiently use selenium to replace sulfur to synthesize intracellular functional products. The faster the strain grows, the higher the absorption rate of selenium in theory, and the fast-growing strains are selected as target strains. This method can greatly improve the screening efficiency of selenium-enriched yeast strains.

[0038] The starting strain used for the screening of selenium-enriched yeast of the present invention is a strain of S. cerevisiae SEMCX2 isolated from a naturally fermented koji block of a winery in Jiujiang, Guangdong. The specific separation and purification method is: take 0.2g of koji block, add sterile water in turn according to the solid-liquid ratio of 1:10, 1:100, 1:1000, 1:10000 for dilution, take 50μl of dilutions of different concentrations, and spread them on YPD solid culture medium (sucrose 5%, yeast extract 2%, magnesium sulfate 0.1%, potassium dihydrogen phosphate 0.1%, agar powder 1.5%, add 50μg / ml ampicillin) with a coating rod, and after culturing in a 30°C incubator for 1-3 days, pick a milky white, large and thick, smooth, moist and sticky single colony, streak culture on YPD solid culture medium, repeat 2 times, and obtain a pure strain of yeast. The identification result of the strain is: the cell morphology of the strain is oval under an optical microscope, budding, and the single colony grown on the solid plate has a cheese-like texture, milky white color, smooth surface, and neat edges. The 26S rDNA gene was used for molecular biological identification and NCBI database comparison analysis, and the strain with the final identification number SEMCX2 was a Saccharomyces cerevisiae strain. The gene sequence of the 26S rDNA of the strain is shown in SEQ ID NO.1:

[0039] ACTCGTCTATGCCGCTCCTTGACTTACGTCGCAGTCCTCAGTCCCAGCT

[0040] GGAGATTCCCAAAGGTTATAATACTTACCGAGGCAAGTTACTTTCCTATG

[0041] GATTTATCCTGCCACCAAAACTGATGCTGGCCCAGGGAAAGGCAAAAT

[0042] TCCCCTACCCACAAGGAGCAAAGGGCACAAAACACCATGTCTGATCAA

[0043] AGGCCCTTCCCTTTCAACAATTTCACGAACTTTTTCACTCTCTTTTCAAA

[0044] GTTCTTTTCATCTTTCCATCACTGAACTTGTTCGCTATCGGCCTCTCGCC

[0045] AATATTTAGTTTTAAAGGGAATTTACCACCCACTTAAAGTTGCATTCCCA

[0046] AACAACTCGACTCTTCAAGGGCACTTTACAAAAAACCGCACTCCTCGC

[0047] CACACGGAATTCTCACCCTCTATGACGTCCTGTTCCAAGGAACATAAAC

[0048] AAGGAACGGCCCCAAAGTTGCCCTCTCCAAATTACAACTCGGGCACCG

[0049] AAGGAACCAAATTTCAAATTGAGCTTTTGCCGCTTCACTCGCCGTTACTAAGGCAATCCCGGTTGGTTTCTTTTCTTTTT.

[0050] In some specific embodiments, a method for preparing selenium-enriched yeast is provided, wherein the selenium-enriched yeast strain is expanded and cultured, and then fermented and cultured in a sulfur-free selenium-containing medium, and yeast cells are collected after solid-liquid separation of the fermentation liquid.

[0051] In other specific embodiments, the sulfur-free selenium-containing culture medium includes sulfur-free nutrient elements, sodium selenite solution, glucose solution and ammonia water which are added simultaneously or separately, and the components are added to the selenium-enriched yeast fermentation culture medium.

[0052] In other specific embodiments, the concentration of the sodium selenite solution can be any value between 9.0 and 15.2 g / L: 9.0 g / L, 10.0 g / L, 11.0 g / L, 12.0 g / L, 13.0 g / L, 14.0 g / L or 15.0 g / L.

[0053] In other specific embodiments, the mass percentage of the glucose solution can be any value between 25-35%, including 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34% or 35%.

[0054] In other specific embodiments, the mass percentage of the ammonia water can be any value between 16-25%, such as 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24% or 25%.

[0055] Unless otherwise specified, the various reagents and instruments used in the examples and comparative examples of the present invention are conventional commercially available products. The source information of the instruments and reagents used in the examples and comparative examples of the present invention is shown in Table 1 below.

[0056] Table 1

[0057]

[0058]

[0059]

[0060] Example 1 Preparation of sulfur-free selenium-containing culture medium and screening of selenium-enriched yeast

[0061] 1. Preparation of sulfur-free selenium-containing culture medium

[0062] (1) Preparation of sulfur-free and selenium-free culture medium

[0063] The culture medium includes: glucose 20g / L, ammonium chloride 5g / L, potassium dihydrogen phosphate 0.85g / L, magnesium chloride 0.2g / L, potassium chloride 0.4g / L, calcium chloride 0.1g / L, zinc gluconate 0.15g / L, copper chloride 0.6mg / L, potassium iodide 0.1mg / L, ferrous chloride 6mg / L, manganese chloride 0.4mg / L, sodium tetraborate 0.2mg / L, biotin 0.08mg / L, calcium pantothenate 3mg / L, inositol 2mg / L, riboflavin (VB 2 )0.4mg / L, niacin (VB 3 )4mg / L, pyridoxine (VB 6 )0.75mg / L. Obtained after sterilization by filtration with a 0.45um filter membrane.

[0064] (2) Preparation of 60 PPM sulfur-free and selenium-containing culture medium: 60 mg / L sodium selenite was added to the sulfur-free and selenium-free culture medium prepared in step (1), and the mixture was sterilized by filtration with a 0.45 um filter membrane.

[0065] (3) Preparation of 500 PPM sulfur-free and selenium-containing culture medium: 500 mg / L sodium selenite is added to the sulfur-free and selenium-free culture medium prepared in step (1), and the culture medium is sterilized by filtration through a 0.45 um filter membrane.

[0066] (4) Preparation of 1200 PPM sulfur-free and selenium-containing culture medium: 1200 mg / L sodium selenite is added to the sulfur-free and selenium-free culture medium prepared in step (1), and the culture medium is sterilized by filtration with a 0.45 um filter membrane.

[0067] (5) Preparation of 3000 PPM selenium-containing solid culture medium: Add 3000 mg / L sodium selenite to the sulfur-free and selenium-free culture medium prepared in step (1), filter and sterilize with a 0.45 um filter membrane, then add to sterilized hot agar with a final concentration of 1.5%, and cool to obtain.

[0068] 2. Screening of Selenium-enriched Yeast

[0069] (1) Mutagenesis of starting strain

[0070] From the brewer's yeast SEMCX2 slant strain, pick a loop and inoculate it in a test tube containing YPD medium. After culturing at 30℃ for 24 hours, take the bacterial solution and spread it on the slide. The coating amount of the slide is 20μl. EP tube is filled with 1ml of 60PPM sulfur-free and selenium-containing medium for plasma mutagenesis (ARTP mutagenesis). The mutagenesis power is 120w, the gas volume is 10L / min, and the mutagenesis time is 60s.

[0071] (2) Gradient screening of the mutagenic strain using the sulfur-free selenium-containing medium prepared in Example 1

[0072] a.60PPM sulfur-free selenium-containing medium culture

[0073] Take the mutagenesis EP tube and culture it at a temperature of 30°C and a rotation speed of 200 rpm for 24 hours; after the culture is completed, if there is no yeast growth under microscopic examination, repeat the mutagenesis and culture, if there is yeast growth under microscopic examination, proceed to the subsequent steps.

[0074] b.500PPM sulfur-free selenium-containing culture medium

[0075] Take 1 ml of culture solution a and inoculate it into 50 ml of 500 PPM sulfur-free selenium-containing fermentation medium, and culture it at a temperature of 30°C and a rotation speed of 200 rpm for 48 hours.

[0076] c.1200PPM sulfur-free selenium-containing culture medium

[0077] Take 1 ml of culture solution b and inoculate it into 50 ml of 500 PPM sulfur-free selenium-containing fermentation medium, and culture it at a temperature of 30°C and a rotation speed of 200 rpm for 48 hours.

[0078] d. 3000PPM selenium-containing solid culture medium coating

[0079] Take 1 ml of culture medium c and dilute it 10,000 times with sterile water. Take 50 μl of the diluted bacterial solution and spread it on a 3000 PPM selenium-containing solid culture medium plate. The culture temperature in the biochemical incubator is 30°C. Observe the growth of the colonies every 24 hours. Colonies will appear in about 96-120 hours. The colony morphology is white oval with a protrusion in the middle.

[0080] (3) The strains after gradient screening are subjected to pure culture and screening.

[0081] Pick multiple single colonies on the 3000PPM selenium-containing solid culture medium plate, inoculate them into 1200PPM sulfur-free selenium-containing culture medium, culture them at 30°C, 200RPM speed, and 48 hours. After the culture, take 200μl of the fermentation liquid, transfer it into a 96-well plate, put it into a microplate spectrophotometer, select 600nm as the wavelength, and measure the optical density, i.e., OD600 value. Select strains with OD600 values ​​greater than 1.5 for seed preservation. The obtained strains can grow in sulfur-free selenium-containing culture medium and can efficiently use selenium to replace sulfur.

[0082] By using the above method, a strain with an OD600 value of 1.89 was finally screened, which is the highest OD600 value among all the selected strains, namely the Saccharomyces cerevisiae SEMCX2Z1 strain of the present invention. The strain was deposited in the China Center for Type Culture Collection (CCTCC) on November 28, 2023, with a deposit number of CCTCC NO: M20232369, and the deposit address is: Wuhan University, Wuhan, China, Postal Code: 430072; Telephone: 027-68754052.

[0083] Example 2 Preparation of selenium-enriched yeast

[0084] Example 2-1

[0085] From the slant strain of Saccharomyces cerevisiae SEMCX2Z1, a loop was picked and inoculated into a test tube containing 10 ml 60 PPM sulfur-free selenium-containing medium prepared in Example 1, and the culture temperature was 30 ° C, the rotation speed was 200 rpm, and after culturing for 24 hours, a test tube seed solution was obtained. Take 5 ml of the test tube seed solution and inoculate it in a shake flask containing 500 ml 60 PPM sulfur-free selenium-containing medium for cultivation, the culture temperature was 30 ° C, the rotation speed was 200 RPM, and the culture was cultured for 24 hours to obtain a shake flask seed solution. All 500 ml of the shake flask seed solution was inoculated into a 50L fermenter. Prepare 16L of bottom water in the fermenter in advance.

[0086] The Saccharomyces cerevisiae SEMCX2Z1 in the fermentation tank was subjected to selenium-enriched culture, and the selenium-enriched culture used a sulfur-free selenium-containing medium, which was added to a 50L fermentation tank containing the fermentation liquid of the Saccharomyces cerevisiae SEMCX2Z1 strain by a feeding method. The sulfur-free selenium-containing medium included: sulfur-free nutrient elements, 1L of 15.2g / L sodium selenite, 25.2% by mass glucose solution, and 16.1% by mass ammonia water, which were added according to the needs of yeast growth.

[0087] Sulfur-free nutrient elements include 35g / L diammonium phosphate, 12.5g / L calcium chloride, 0.025g / L manganese chloride, 7.5g / L magnesium chloride, 0.01g / L ammonium molybdate, 3g / L zinc gluconate, 0.15g / L ferrous chloride, 0.005g / L potassium iodide, 0.025g / L sodium tetraborate, 0.015g / L cupric chloride, 4.5g / L threonine, 2g / L serine, 3g / L lysine, 5g / L glutamic acid, 4g / L alanine, 0.0025g / L biotin, 0.01g / L riboflavin (VB2), 0.03g / L pyridoxine (VB6), 0.25g / L niacin (B3) and 0.1g / L calcium pantothenate (VB5), with a total of 2L.

[0088] Calculated per liter of fermentation liquid during fermentation culture, the amount of sulfur-free nutrient elements added is 20-60 ml / h, the amount of 15.2 g / L sodium selenite solution added is 8.5-27 ml / h, and the amount of 25.2% glucose solution added is 10-30 ml / h. The amount of addition gradually increases as the fermentation proceeds. By adding 16.1% ammonia water by mass, the pH is adjusted to 4.0-6.0, and the pH gradually increases during the fermentation process. After the yeast is cultured at a temperature of 31°C for 20 hours, the fermentation liquid is centrifuged at 4000 rpm, the heavy phase is taken, and an equal volume of water is added for washing once, and the selenium-enriched yeast is obtained by spray drying, and the dry weight of the selenium-enriched yeast is 1.45 kg.

[0089] Among them, the total selenium content (mg / kg) and inorganic selenium absorption rate (%) of selenium-enriched yeast are shown in Table 2.

[0090] Example 2-2

[0091] From the slant strain of Saccharomyces cerevisiae SEMCX2Z1, a loop was inoculated into a test tube containing 10 ml 60 PPM sulfur-free selenium-containing medium prepared in Example 1, and the culture temperature was 30 ° C, the rotation speed was 200 rpm, and after culturing for 24 hours, a test tube seed solution was obtained. Take 5 ml of the test tube seed solution and inoculate it in a shake flask containing 500 ml 60 PPM sulfur-free selenium-containing medium for culturing, the culture temperature was 30 ° C, the rotation speed was 200 RPM, and the culture was cultured for 24 hours to obtain a shake flask seed solution. All 500 ml of the shake flask seeds were inoculated into a 50 L fermenter for culturing. Prepare 16 L of bottom water in the fermenter in advance.

[0092] The Saccharomyces cerevisiae SEMCX2Z1 in the fermentation tank was subjected to selenium-enriched culture, and the selenium-enriched culture used a sulfur-free selenium-containing medium, which was added to a 50L fermentation tank containing the fermentation liquid of the Saccharomyces cerevisiae SEMCX2Z1 strain by a feeding method. The selenium-enriched medium included: sulfur-free nutrient elements, 2L of 9g / L sodium selenite solution, 34.6% by mass glucose solution and 24.8% by mass ammonia water, which were added according to the needs of yeast growth.

[0093] Sulfur-free nutrient elements, measured in grams (g) per liter of volume, include 50g / L diammonium phosphate, 17.5g / L calcium chloride, 0.035g / L manganese chloride, 17.5g / L magnesium chloride, 0.02g / L ammonium molybdate, 6g / L zinc gluconate, 0.35g / L ferrous chloride, 0.01g / L potassium iodide, 0.05g / L sodium tetraborate, 0.035g / L cupric chloride, 12g / L threonine, 5g / L serine, 8g / L lysine, 12g / L glutamic acid, 12g / L alanine, 0.005g / L biotin, 0.025g / L riboflavin (VB2), 0.05g / L pyridoxine (VB6), 0.5g / L niacin (B3) and 0.2g / L calcium pantothenate (VB5), with a total of 2L.

[0094] Calculated per liter of fermentation liquid during fermentation culture, the amount of sulfur-free nutrient elements added is 20-60 ml / h, the amount of 9 g / L sodium selenite solution added is 17-54 ml / h, and the amount of glucose solution with a mass percentage of 34.6% is 10-30 ml / h. The amount of addition gradually increases as the fermentation proceeds. By adding 24.8% ammonia water by mass, the pH is adjusted to 4.0-6.0, and the pH gradually increases during the fermentation process. After the yeast is cultured at a temperature of 28°C for 28 hours, the fermentation liquid is centrifuged at 5000 rpm, the heavy phase is taken, and an equal volume of water is added for washing once, and spray drying is performed to obtain selenium-enriched yeast, and the dry weight of the selenium-enriched yeast is 1.23 kg.

[0095] The total selenium content (mg / kg) and inorganic selenium absorption rate (%) of selenium-enriched yeast are shown in Table 2, and the calculation method is as follows.

[0096] For the detection method of total selenium content in selenium-enriched yeast, please refer to the first method hydride atomic fluorescence spectrometry in GB5009.93-2017.

[0097] Inorganic selenium absorption rate (%) = (dry weight of selenium-enriched yeast * total selenium content of selenium-enriched yeast / 1000) / (mass of added sodium selenite * 78.96 / 172.94) * 100;

[0098] The unit of dry weight of selenium-enriched yeast is kg, the unit of total selenium content in selenium-enriched yeast is mg / kg, and the unit of mass of added sodium selenite is g.

[0099] Table 2

[0100]

[0101] As can be seen from Table 2, the Saccharomyces cerevisiae SEMCX2Z1 strain can efficiently utilize selenium to replace sulfur to synthesize intracellular functional products. The strain's absorption rate of inorganic selenium is ≥91%, and the selenium content of the obtained selenium-enriched yeast is 4600-6100 mg / kg.

[0102] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention shall be included in the protection scope of the present invention.

Claims

1. A selenium-enriched yeast strain, characterized in that: The selenium-enriched yeast strain is Saccharomyces cerevisiae SEMCX2Z1 strain, which is deposited in China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCCNO: M 20232369.

2. The selenium-enriched yeast strain according to claim 1, characterized in that The strain can grow in a sulfur-free, selenium-containing medium; Preferably, the inorganic selenium absorption rate of the strain reaches 91%-96%; And / or, the inorganic selenium is sodium selenite.

3. A selenium-enriched yeast, characterized in that: The selenium-enriched yeast is prepared by fermenting the selenium-enriched yeast strain according to claim 1 or 2, and has a selenium content of 4600-6100 mg / kg based on the dry weight of the selenium-enriched yeast.

4. A method for preparing selenium-enriched yeast according to claim 3, characterized in that: The method comprises: (1) expanding the culture of selenium-enriched yeast strains; (2) adding the product obtained in step (1) to a sulfur-free, selenium-containing medium for fermentation; (3) After solid-liquid separation of the fermentation liquid obtained in step (2), yeast cells are collected.

5. The preparation method according to claim 4, characterized in that: In step (2), the sulfur-free selenium-containing culture medium includes sulfur-free nutrient elements, sodium selenite solution, glucose solution and ammonia water, which are added simultaneously or separately, and each component is added to the selenium-enriched yeast fermentation culture medium; Preferably, the concentration of the sodium selenite solution is 9.0-15.2 g / L, the mass percentage of the glucose solution is 25-35%, and the mass percentage of the ammonia water is 16-25%.

6. The preparation method according to claim 5, characterized in that: In step (2), the sulfur-free nutrient elements, measured in grams (g) per liter of volume, include: 35-50 g / L of diammonium phosphate, 12.5-17.5 g / L of calcium chloride, 0.025-0.035 g / L of manganese chloride, 7.5-17.5 g / L of magnesium chloride, 0.01-0.02 g / L of ammonium molybdate, 3-6 g / L of zinc gluconate, 0.15-0.35 g / L of ferrous chloride, 0.0 05-0.01g / L potassium iodide, 0.025-0.05g / L sodium tetraborate, 0.015-0.035g / L copper chloride, 0.0025-0.005g / L biotin, 0.01-0.025g / L riboflavin (VB2), 0.03-0.05g / L pyridoxine (VB6), 0.25-0.5g / L niacin (B3) and 0.1-0.2g / L calcium pantothenate (VB5); Preferably, the sulfur-free nutrient elements also include sulfur-free amino acids, which include 5-12 g / L glutamic acid, and / or 4.5-12 g / L threonine, and / or 2-5 g / L serine, and / or 3-8 g / L lysine, and / or 4-12 g / L alanine, measured in grams (g) of the substance contained in each liter of volume of the sulfur-free nutrient elements.

7. The preparation method according to claim 5 or 6, characterized in that: In step (2), the amount of the sulfur-free nutrient element added is 20-60 ml / h, calculated per liter of fermentation liquid during fermentation culture; And / or, the flow rate of the sodium selenite solution is 8.5-54 ml / h; And / or, the flow rate of the glucose solution is 10-30 ml / h; Preferably, the pH of the selenium-enriched culture medium is adjusted to 4.0-6.0 by adding ammonia water.

8. The preparation method according to any one of claims 4 to 7, characterized in that: In step (2), the culture time is 20-28 hours; and / or the culture temperature is 28-31°C.

9. The preparation method according to any one of claims 4 to 8, characterized in that: In step (3), solid-liquid separation is performed by centrifugation; preferably, the centrifugal speed is 4000-5000 rpm.

10. The preparation method according to any one of claims 4 to 9, characterized in that: The step (3) further includes a drying step, and preferably, the drying is selected from spray drying.

11. The selenium-enriched yeast strain according to claim 1 or 2, the selenium-enriched yeast according to claim 3, or the selenium-enriched yeast prepared by the preparation method according to any one of claims 4 to 10 is used in food, health products, medicines and feed.

12. A selenium-enriched yeast product, characterized in that: The raw material is the organic selenium-enriched yeast according to claim 3 or the selenium-enriched yeast prepared by the preparation method according to any one of claims 4 to 10.

13. A method for treating pollutants using the selenium-enriched yeast strain according to claim 1 or 2, characterized in that: The selenium-enriched yeast strain according to claim 1 or 2 is added to pollutants to absorb inorganic selenium to treat the pollutants.

14. The method for treating pollutants using selenium-enriched yeast strains according to claim 13, characterized in that: The pollutant is sewage.

Images