Screening and culturing method of protein-rich thermosynechococcus

Abstract

The invention provides screening of protein-rich thermosynechococcus and a culture method and application of the protein-rich thermosynechococcus, and relates to the technical field of algae. The thermosynechococcus sp. LBV 12 is preserved in the China Center for Type Culture Collection on June 27, 2024, and the preservation number of the thermosynechococcus sp. LBV 12 is CCTCC (China Center for Type Culture Collection) NO: 20241317. According to the method, a Yunnan Tengchong hot sea water sample is separated and purified under the conditions that the temperature is 40-50 DEG C, the illumination intensity is 9000 Lux, the humidity is 45% and the light-dark ratio is 12 h: 12 h, and dominant algae strains are screened out according to the heat resistance degree and the growth condition. The thermosynechococcus shows a remarkable growth speed in an optimized culture medium, rapidly propagates and reaches high density, rich protein can be effectively synthesized and accumulated in the metabolic process, the content of essential amino acid is balanced, and the thermosynechococcus can serve as a high-protein source with great potential. And the product is rich in natural pigment phycocyanin, and has unique color and luster and oxidation resistance. Therefore, the thermosynechococcus has important application potential in the fields of food, feed, health care products and the like, and particularly provides powerful support for sustainable development of related industries in the aspect of developing natural products rich in nutrition.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a screening method for a thermosynechococcus strain that is resistant to high temperatures and has a high protein content, and the nutrient content thereof. Background Art

[0002] In the food and feed industry, photosynthetic single-cell organisms (microalgae) are gaining attention as potential alternative protein sources. Common microalgae with high protein content include Spirulina and Chlorella. Compared with plant protein, microalgae protein has the advantages of controllability, industrial production, extremely high yield per unit land, environmental friendliness, low carbon or even negative carbon production. These organisms are biologically diverse, with more than 11 categories. Cyanobacteria are producers of proteins, carbohydrates and pigments (chlorophyll, phycocyanin and carotenoids), which provides the possibility for widespread application in nutritional supplements, pharmaceuticals and food industries.

[0003] However, studies have shown that Spirulina (protein content is about 68-72%), which is the main source of single-cell protein, has a maximum tolerance temperature of 35°C, which is defective in high temperature resistance, because high temperature may cause the denaturation of protein structure, break hydrogen bonds and hydrophobic interactions, and thus make its three-dimensional structure lose stability. This usually leads to loss of function. Therefore, it is difficult to meet the demand for high temperature resistant proteins in food, industry and other industries, which limits its application under high temperature conditions. According to literature reports, some high temperature resistant microalgae have rich nutritional value, rich in protein, fat, vitamins and other nutrients, and can be used as an important source of food and feed. It has a high protein content and excellent quality, is suitable for human consumption or animal feed addition, and has a positive effect on improving the human diet structure and improving the efficiency of aquaculture, so it is urgent to develop and screen new high temperature resistant algae strains.

[0004] Thermosynechococcus is an extreme thermophilic algae belonging to the group of cyanobacteria that grows primarily in high-temperature environments, such as tropical hot springs and geothermal areas. It has received extensive attention for its ability to survive extreme conditions and its biochemical properties, such as its high efficiency in carbon dioxide fixation, biomass growth, and production of byproducts. In addition, Thermosynechococcus has high temperature tolerance and special metabolic pathways that enable it to perform effective biochemical reactions in extreme environments. Some proteins, such as thermophilic enzymes, have high thermal stability and can remain active in high-temperature environments. This makes them very valuable in biotechnology and industrial applications.

[0005] In existing research, there are few studies on Thermosynechococcus protein. Only a small number of literature studies focus on the application of wastewater treatment. There is no research on the content and heat resistance temperature of Thermosynechococcus protein. There is a lack of research describing the detailed chemical composition of Thermosynechococcus and the protein isolates derived from it. Therefore, the protein-rich Thermosynechococcus screened out from the water quality of high temperature extreme environment is suitable for biomass production under high temperature environment, and improves the high temperature resistance and nutritional value of protein. In particular, the content of phycocyanin is much higher than that of Spirulina, which expands the application range of Thermosynechococcus, promotes the development of related industries, and provides new solutions for sustainable economy.

[0006] Therefore, the present invention develops a screening of a protein-rich Thermosynechococcus strain and a culture method and application thereof, which has important research significance and application value for high temperature resistant proteins. Summary of the invention

[0007] The purpose of the present invention is to overcome the defects of the prior art and provide a method for screening the thermophilic microalgae. The screening method has the advantages of simple operation and low cost.

[0008] The second object of the present invention is to provide a microalgae that is resistant to high temperatures and has a high protein content, and to analyze its nutritional components to solve the problem of insufficient heat resistance of the microalgae.

[0009] The third object of the present invention is to provide the nutritional content of the above-mentioned Thermosynechococcus.

[0010] To achieve the above object, the present invention adopts the following technical solutions:

[0011] A strain of Thermosynechococcus sp. LBV12 was deposited in China Center for Type Culture Collection on June 20, 2024, with a deposit number of CCTCC NO: 20241317.

[0012] Furthermore, the algae species preservation information of the microalgae is: a strain of Thermosynechococcus, deposited on June 20, 2024 in the China Type Culture Collection located at Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province, with a preservation number of CCTCC NO: 20241317, and it is named Thermosynechococcus sp. LBV12.

[0013] The present invention obtains water samples from Tengchong Rehai in Baoshan City, Yunnan Province, and uses BG11 culture medium for separation, purification and identification. The screening method adopts the following steps:

[0014] (1) Water samples were collected from multiple locations in Tengchong Rehai, Baoshan City, Yunnan Province, and stored in a light incubator at a temperature of 40°C, a light intensity of 9000 Lux, a humidity of 45%, and a light-dark ratio of 12h:12h.

[0015] (2) The water sample from step (1) was concentrated by centrifugation, and the concentrate was graded diluted with sterile water. 100 uL of each graded dilution was spread on solid BG11 culture medium, followed by light culture until a single algal colony appeared and then streaking culture was performed. This step was repeated for purification.

[0016] (3) Pick a single algae colony from step (2) and transfer it to 150 ml of liquid BG11 for enrichment culture as seed liquid.

[0017] (4) The algae solution in step (3) was concentrated by centrifugation at 4°C and 10,000 rpm for 10 min, and then transferred to 200 mL of liquid culture medium. The culture was cultured in a light incubator at 40°C, with a light intensity of 9,000 Lux, a humidity of 45%, and a light-dark ratio of 12h:12h. The dominant algae strains were selected based on their heat resistance and growth conditions.

[0018] (5) Identify and analyze the algae strain obtained in step (4) by combining morphology and molecular biology.

[0019] Furthermore, in step (2), the centrifugal concentration is carried out at 4°C, with a rotation speed of 8000 rpm and centrifugation for 10 min.

[0020] The gradient dilution multiples were 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 .

[0021] The solid BG11 medium is BG11 medium with 5% agar powder added.

[0022] The streaking needs to be observed with the aid of an optical microscope until the algae are purified to the point where a single algae colony appears in the field of vision.

[0023] Furthermore, in step (3), the seed solution is ventilated continuously every day during the culture process so that the microalgae can grow evenly without adhering to the wall.

[0024] The method for determining the heat resistance is: culturing at 40° C., taking 1 mL of algae solution every 24 hours, determining the absorbance at 680 nm, and using the optical density to reflect the biomass.

[0025] Furthermore, in step (5), a single algae colony was taken, 20 uL of sterile water was added, and the mixture was heated for 20 min and used as a template. The primers used in the molecular biological identification process were: 27F (CGGACGGGTGAGTAACG CGTGA) and 1492R (GACTACTGGGGTATCTAATCCCATT).

[0026] Furthermore, the protein determination method is carried out with reference to the Kjeldahl nitrogen determination method in GB / T 33862-2017.

[0027] The phycobilin determination method is performed by extraction with a buffer solution (PBS pH 6.8).

[0028] The chlorophyll determination method uses anhydrous ethanol solvent for extraction, and uses an enzyme marker to determine and calculate the content;

[0029] The carbohydrate content is determined by the phenol-sulfuric acid method.

[0030] Advantages of the present invention

[0031] The present invention provides a microalgae that is resistant to high temperatures and has a high protein content. The present invention selects microalgae that is resistant to high temperatures by setting different temperature gradients. This helps solve the problem of microalgae dying due to excessively high temperatures during the culture process. By measuring the content of microalgae nutrients, an algae strain with a high protein content is selected, the algae strain has a tolerable temperature of 50°C, a protein content of up to 61.59%, and a phycocyanin content of 266.67 mg / g. This screening method has simple steps and saves screening time and cost. The novel microalgae selected by the present invention has the characteristics of being resistant to high temperatures and having a high protein content, which is conducive to promoting the development of the microalgae protein application industry and has important application value.

[0032] Description of the drawings

[0033] Figure 1 This is a field sampling map;

[0034] Figure 2 Microscope observation picture of Thermosynechococcus sp., magnified 40 times;

[0035] Figure 3 This is a phylogenetic tree constructed based on the partial 16S rDNA sequence of Thermosynechococcus;

[0036] Figure 4 This is the growth curve of Thermosynechococcus at different temperatures;

[0037] Figure 5The contents of various nutrients in Thermosynechococcus sp. at 40℃ and 50℃: (A) protein; (B) phycobilin; (C) pigment; (D) carbohydrate content;

[0038] Figure 6 This is a diagram of phycocyanin extraction. DETAILED DESCRIPTION

[0039] The present invention is further described in detail with reference to the following examples, but the embodiments of the present invention are not limited thereto. The experimental methods involved in the examples are carried out in a conventional manner unless otherwise specified. The chemical reagents or experimental instruments used are commercially available unless otherwise specified.

[0040] Example 1: Collection and storage of water samples

[0041] In November 2023, water samples were collected from many places in Tengchong Rehai, Baoshan City, Yunnan Province. Figure 1 . Invert the sampling bottle, slowly immerse it in water to a depth of 0.2 meters, turn the bottle mouth downward, collect the water sample, and avoid bubbles. After the collection is completed, immediately seal the bottle mouth, mark the sample information and quickly airlift it back to the laboratory. After the water sample arrives at the laboratory, it should be immediately placed in a light incubator, maintaining the temperature at 40°C, the light intensity at 9000Lux, the humidity at 45%, and the light-dark ratio at 12h:12h. Screw the cap to exchange the gas at regular intervals to ensure the survival and physiological activity of the microorganisms.

[0042] Example 2: Isolation and purification of microalgae

[0043] Transfer the water sample to a centrifuge tube and centrifuge for 10 min at 4°C and 8000 rpm to precipitate the microalgae. Carefully remove the supernatant, retain the precipitate, add an appropriate amount of BG11 medium, and stir evenly. -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 The gradient was diluted with sterile water. Then, the algae colonies were separated by plate separation technology multiple times. 100uL of each gradient dilution was spread on solid BG11 medium (with 5% agar powder), followed by light culture until single algae colonies appeared. Finally, single algae colonies of different shapes, sizes, and colors were cloned and streaked on solid BG-11 medium for purification culture. They were selected on the screening plate and the purification of the microalgae was preliminarily judged by fluorescence inverted microscope.

[0044] Figure 1This is a microscopic observation picture of the algae strain. It is rod-shaped and single-celled. Based on 40x microscopic morphological observation, it was preliminarily determined to be a rod-shaped algae.

[0045] Example 3: Identification of algae strains

[0046] Pick a single algae colony and add it to a PCR tube containing 20uL sterile water. Repeatedly blow and beat to disperse the algae colony. It can be observed that the sterile water is slightly green, and the solution is uniform without large algae colonies. Then place the PCR tube in a metal bath and heat it at 99°C for 20 minutes, then cool it in a refrigerator at 4°C to obtain a DNA template. The reaction system is 1.4uL 16s-F, 1.4uL 16s-R, 1.4uL DNA template, 25uL 2×tap enzyme, and make up to 35uL with sterile water. The primer sequences involved are 27F (CGGACGGGTGAGTAACGCGTGA) and 1492R (GA CTACTGGGGTATCTAATCCCATT). PCR amplification conditions are 95°C for 5min; 95°C for 30

[0047] s, 55℃30s, 72℃1.5min, 35 cycles in total; 72℃ extension for 10min. The PCR products were verified by 1% agarose gel electrophoresis, and the positive band products with clear and no impurities were sent to the company for S anger sequencing to obtain 16srDNA sequencing results. BLAST comparison analysis was performed with existing homologous sequences in the GenBank database, and the results showed that the homology of the screened microalgae with Thermosynechococcus sp. could reach 100%. Figure 3 The phylogenetic tree constructed using software and combined with the morphological observation results showed that the screened microalgae belonged to the genus Thermosynechococcus and was named Thermosynechococcus sp.LBV12.

[0048] Example 4: Cultivation of Thermococcus

[0049] The identified thermophilic algae were transferred to 150 ml of liquid BG11 for enrichment culture as seed liquid. The seed liquid was manually shaken 3 to 4 times a day during the culture process to prevent it from growing on the wall and accelerate its growth rate.

[0050] The seed solution was set at an initial OD 680 Inoculate into 200mL BG11 medium at 0.2-0.3. Place at 40℃ and 50℃ respectively. Keep other culture conditions (light intensity of 9000Lux, humidity of 45% and light-dark ratio of 12h:12h) consistent. Each group has three parallels. The biomass is reflected by optical density. Take 1mL of algae solution every 24h and measure the absorbance at 680nm to develop a growth curve. Figure 4It can be seen that Thermococcus can grow normally at 50°C, but the growth is slightly slower than that at 40°C. After 12 days of culture, centrifuge at 4°C and 10,000 rpm for 10 minutes, carefully pour out the supernatant, wash three times with ultrapure water, place in a -80°C refrigerator overnight, dry with a freeze dryer, and grind into algae powder with a mortar.

[0051] Example 5: Determination of nutritional components of Thermococcus

[0052] The test methods involved in this example are as follows: the protein content was determined by the national standard Kjeldahl method to determine the total nitrogen content in the algae powder; the phycobilin content was determined by extraction with a buffer solution (PBS pH 6.8) and then calculated; the chlorophyll content was determined by extraction with anhydrous ethanol solvent and then determined and calculated by an ELISA instrument; the carbohydrate content was determined by the phenol-sulfuric acid method.

[0053] Results of nutrient composition determination: The nutrient composition of algae powder obtained under different temperature culture conditions was determined. Figure 5 The results showed that the protein content of Thermosynechococcus sp. at 40°C accounted for 61.59% of the dry weight, of which phycocyanin was 266mg / g, allophycocyanin was 160mg / g, total chlorophyll content was 10.7mg / g, and carbohydrates were 9.55%. At the same time, when the temperature was as high as 50°C, the content of protein, phycobilin and carbohydrates decreased compared with that at 40°C, and the total chlorophyll content increased. However, no death occurred at this high temperature.

[0054] The results showed that this strain of Thermosynechococcus is rich in protein and can grow in a high temperature environment, overcoming the limitations of extreme high temperature environments on microalgae.

[0055] The above implementation cases illustrate that the present invention provides a separation and purification method, identification method and nutritional component analysis of a Thermosynechococcus sp. that is resistant to high temperatures and has a high protein content. However, the implementation methods of the present invention are not limited to the above embodiments, and improvements and modifications made on the basis of the present invention are all included in the protection scope of the present invention.

Claims

1. A strain of Thermosynechococcus, deposited on June 20, 2024 in the China Type Culture Collection located at Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province, with a deposit number of CCTCC NO: 20241317, and named Thermosynechococcus sp. LBV12.

2. The method for separation, purification and identification of microalgae according to claim 1, characterized in that: The screening and culturing method adopts the following steps: (1) Water samples were collected from multiple locations in Tengchong Rehai, Baoshan City, Yunnan Province, and stored in a light incubator at a temperature of 40°C, a light intensity of 9000 Lux, a humidity of 45%, and a light-dark ratio of 12 h:12 h. (2) The water sample from step (1) was concentrated by centrifugation, and the concentrate was graded diluted with sterile water. 100 uL of each graded dilution was spread on BG11 solid culture medium, followed by light culture until a single algal colony appeared and then streaking culture was performed. This step was repeated for purification. (3) Pick a single algae colony from step (2) and transfer it to 150 mL of BG11 liquid culture medium for enrichment culture as seed liquid. (4) The algae solution in step (3) was concentrated by centrifugation at 4°C and 10,000 rpm for 10 min, and then transferred to 200 mL of liquid culture medium. The culture was cultured in a light incubator at 40°C, with a light intensity of 9,000 Lux, a humidity of 45%, and a light-dark ratio of 12 h:12 h. The dominant algae strains were selected based on their heat resistance and growth conditions. (5) Identify and analyze the algae strain obtained in step (4) by combining morphology and molecular biology.

3. The screening method according to claim 2, characterized in that In step (2), the rotation speed of the centrifugal concentration is 8000 rpm, and the centrifugation is performed for 10 minutes. The gradient dilution multiples were 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 . The solid BG11 medium is BG11 medium with 5% agar powder added. The streaking needs to be observed with the aid of an optical microscope until the algae are purified to the point where a single algae colony appears in the field of vision.

4. The culture method according to claim 2 is characterized in that In step (2), the optimized culture medium formula is characterized by: NaNO3 concentration is 1 g / L, K2HPO4 concentration is 0.04 g / L; other components, concentrations and conditions remain unchanged.

5. The culture method according to claim 2, characterized in that: In step (3), the seed solution is aerated continuously every day during the culture process for 12 days.

6. Use of a thermotolerant and high-protein Thermosynechococcus algae, characterized in that: The LBV12 cultured in the above method was harvested by centrifugation at 4°C and 10000 rpm for 10 min. The algae mud was resuspended in distilled water for 3 times, placed in a -80°C refrigerator overnight, and then freeze-dried in a freeze dryer.

7. Use of a thermotolerant and high-protein Thermosynechococcus algae, characterized in that: After culturing Thermosynechococcus LBV12 at 40°C for 12 days, the protein content was measured to be 61.59% and the phycocyanin content was 266.73 mg / g.

Images