Genetically engineered bacterium of O-acetyl-L-homoserine without auxotroph as well as construction method and application of genetically engineered bacterium

Abstract

The invention relates to the technical field of microbial metabolism engineering, in particular to a genetically engineered bacterium for producing O-acetyl-L-homoserine without auxotroph as well as a construction method and application of the genetically engineered bacterium. The invention relates to a genetically engineered bacterium of no-auxotroph O-acetyl-L-homoserine, which is characterized in that a threonine efflux protein encoding gene rhtC, a threonine dehydrogenase encoding gene tdcB and a threonine 3-dehydrogenase encoding gene tdh are knocked out in a chassis strain Escherichia coli W3110, a homoserine kinase encoding gene thrB dynamically regulated by threonine concentration is supplemented, and the homoserine kinase encoding gene thrB is transformed into the homoserine kinase encoding gene thrB, so that the O-acetyl-L-homoserine with no auxotroph is obtained. And the genetically engineered bacterium of the O-acetyl-L-homoserine without the auxotrophy is obtained. The recombinant Escherichia coli is an auxotroph-free strain, amino acid does not need to be additionally added, the cost is greatly reduced, the yield is greatly increased, and the recombinant Escherichia coli has important industrial application value.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial metabolic engineering, and in particular to a genetically engineered bacterium producing O-acetyl-L-homoserine without nutritional deficiency, a construction method and application thereof. Background Art

[0002] O-acetyl-L-homoserine (OAH) is an important non-protein synthetic amino acid with a molecular formula of C6H11NO4 and a molecular weight of 161.16. It is a potential important platform metabolic intermediate for the production of homoserine lactone, methionine, 1,4-butanediol and 1,3-propanediol, and has great market value. O-acetyl-L-homoserine can be used as a precursor to synthesize methionine through an enzymatic reaction with methyl mercaptan. Therefore, the construction of a high-yield O-acetyl-L-homoserine strain may have broad application prospects in methionine production.

[0003] As a model strain, Escherichia coli has been successfully used for the biosynthesis of aspartate-derived products due to its clear genetic background and ease of genetic manipulation. Wei Liang et al. from the Institute of Engineering and Technology redistributed metabolic fluxes and used protein engineering to transform the homoserine O-acetyltransferase MetX from Leptospira meyeri, and then regulated cofactors including acetyl-CoA and NADPH, so that the shake flask production of O-acetyl-L-homoserine in the engineered strain reached 12.1 g / L. Li Bo et al. from Zhejiang University of Technology screened exogenous MetX, knocked out degradation and competition pathways, and then redistributed the carbon flux of central carbon metabolism, which could accumulate 8.29 g / L O-acetyl-L-homoserine.

[0004] These studies have achieved remarkable results, but the existing studies have blocked the synthesis pathways of other amino acids in order to improve the metabolic flow of the target product, resulting in strains that are deficient in multiple amino acids, requiring the addition of one or more amino acids during fermentation, which undoubtedly increases production costs. And when the amount of amino acid added is inappropriate, the production capacity of the engineered strain will also be affected. Therefore, it is the goal of those skilled in the art to reduce the nutritional deficiencies of O-acetyl-L-homoserine engineered bacteria while improving production performance. Summary of the invention

[0005] The purpose of the present invention is to overcome the problems of low yield and high fermentation cost of O-acetyl-L-homoserine production strains in the prior art in the fermentation production of O-acetyl-L-homoserine, better utilize carbon source materials such as glucose to produce O-acetyl-L-homoserine, and provide a genetically engineered bacterium for producing O-acetyl-L-homoserine without nutritional deficiency, a construction method and an application thereof.

[0006] In order to achieve the above object, the present invention is implemented by the following technical solutions: In a first aspect, the present invention first provides a genetically engineered bacterium that is free of nutritional deficiencies in O-acetyl-L-homoserine, characterized in that the threonine efflux protein encoding gene rhtC, the threonine dehydrogenase encoding gene tdcB, and the threonine 3-dehydrogenase encoding gene tdh are knocked out in the chassis strain Escherichia coli W3110, and the homoserine kinase encoding gene thrB that is dynamically regulated by the threonine concentration is supplemented, so as to obtain the genetically engineered bacterium that is free of nutritional deficiencies in O-acetyl-L-homoserine.

[0007] In order to make the genetically engineered bacteria of O-acetyl-L-homoserine free of nutritional deficiency and to increase its yield as much as possible, the present invention can reduce the efflux and degradation of threonine and dynamically regulate the intensity of the threonine pathway according to the threonine concentration. The present invention knocks out the threonine efflux protein encoding gene rhtC in the previously constructed Escherichia coli W3110 (i.e., Escherichia coli OAH7-X, disclosed in patent application number CN202410775092.4, application publication number CN118531032A, and provided by the Microbial Culture Collection of Zhejiang University of Technology) to reduce the export of threonine; knocks out the threonine dehydrogenase encoding gene tdcB, and knocks out the threonine 3-dehydrogenase encoding gene tdh to reduce the degradation of threonine, thereby reducing the carbon flow of intracellular threonine; when the amino acid concentration is insufficient (aminoacylated tRNA), the ribosome will stop translating thrL, and the subsequent genes can continue to be transcribed, and when a certain amount of threonine accumulates in the cell, the aminoacylated tRNA is not restricted so that the ribosome continues to translate, and then a termination signal is formed, transcription is terminated, and the transcription of the connected homoserine kinase encoding gene thrB is weakened, thereby achieving the purpose of regulating the intensity of the threonine pathway. The mutation of thrL reduces the initial translation speed of thrL, which allows sufficient time for the transcription termination signal to be generated. Through the combination of the above transformation strategies, the present invention successfully obtains a genetically engineered bacterium without auxotrophic O-acetyl-L-homoserine.

[0008] The genes encoding threonine efflux protein, threonine dehydrogenase, threonine 3-dehydrogenase and homoserine kinase are generally represented as rhtC, tdcB, tdh, thrB. The gene sequences can be obtained from the public database National Center for Biotechnology Information (NCBI). For example, GenBank ID No. 85676228 for rhtC, GenBank ID No. 85675916 for tdcB, GenBank ID No. 85676426 for tdh, and GenBank ID No. 85674277 for thrB.

[0009] In a second aspect, the present invention provides a method for constructing a genetically engineered bacterium that produces O-acetyl-L-homoserine without amino acid deficiency, which specifically comprises the following steps: 1. Steps for knocking out the threonine efflux protein encoding gene rhtC; 2. The step of knocking out the threonine dehydrogenase encoding gene tdcB; 3. The step of knocking out the threonine 3-dehydrogenase encoding gene tdh; 4. The step of replenishing the homoserine kinase encoding gene thrB that is dynamically regulated by threonine concentration.

[0010] Preferably, the thrB gene is expressed by the promoter Pthr, and the nucleotide sequence of the promoter is SEQ ID NO.1.

[0011] Preferably, the dynamic regulation of threonine concentration is achieved by connecting a leader peptide thrL mutant in front of the thrB gene.

[0012] Preferably, compared with the leader peptide encoded by the thrL gene from Escherichia coli, the second codon AAA of the thrL mutant is mutated to CAC, and the nucleotide sequence of the thrL mutant is SEQ ID NO.2.

[0013] Preferably, the thrB is integrated into the yjiT gene site.

[0014] In a third aspect, the present invention provides a genetically engineered bacterium having no nutritional deficiency of O-acetyl-L-homoserine, and its use in the fermentation production of O-acetyl-L-homoserine.

[0015] Preferably, the application is to inoculate the genetically engineered bacteria into a fermentation medium, ferment and culture at 30-33°C and 180-220rpm, separate and purify the culture solution to obtain O-acetyl-L-homoserine.

[0016] The final concentration of the fermentation medium of the present invention is as follows: 30 g / L of glucose, 2 g / L of potassium dihydrogen phosphate, 20 g / L of ammonium sulfate, 4 g / L of yeast powder, 20 g / L of calcium carbonate, 0.20 g / L of L-threonine, 0.0001 g / L of vitamin B1, 0.0001 g / L of vitamin B12, 0.2 g / L of L-isoleucine, 2 g / L of MgSO4, 0.005 g / L of FeSO4, 0.005 g / L of MnSO4 and 0.005 g / L of ZnSO4, the solvent is deionized water, and the pH value is 6.8.

[0017] Preferably, slant activation and seed culture are performed before the fermentation culture, and the seed liquid is inoculated into the fermentation medium.

[0018] Preferably, the seed culture method comprises the following steps: picking a single bacterial colony from the slant and inoculating it into LB liquid culture medium, culturing it overnight under appropriate conditions to obtain a seed solution, and inoculating the seed solution into a fermentation medium.

[0019] The overnight culture conditions of the present invention are 37° C. and 200 rpm. The seed solution inoculation amount is 2% by volume concentration and inoculated into the fermentation medium.

[0020] Preferably, the slant activation method is: inoculating the recombinant E. coli on an LB plate, culturing at 37° C. overnight to obtain slant bacteria.

[0021] The present invention has the following beneficial effects: (1) Compared with the wild-type and chassis strains, the modified recombinant Escherichia coli provided by the present invention can better utilize carbon sources such as glucose to produce O-acetyl-L-homoserine.

[0022] (2) This strain has no nutritional deficiencies and does not require the addition of any additional amino acids. It has lower production costs and is more stable.

[0023] (3) The production of O-acetyl-L-homoserine increased from 12.66 g / L in the chassis threonine-deficient strain to 18.84 g / L in the non-nutrient-deficient strain.

[0024] (4) The genetically engineered bacteria provided by the present invention have important industrial application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a fermentation result diagram of shake flask fermentation of all strains in the present invention. DETAILED DESCRIPTION

[0026] The present invention is further described below in conjunction with specific embodiments. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are generally only embodiments of a part of the present invention, rather than all embodiments. Therefore, based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work should belong to the scope of protection of the present invention.

[0027] The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0028] Unless otherwise specified, the test materials used in the following examples are all conventional biochemical reagents.

[0029] LB liquid culture medium composition: peptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L, solvent is deionized water, pH value is natural.

[0030] LB plates were prepared by adding agar to LB liquid medium at a final concentration of 2 g / L.

[0031] Example 1 Construction of Genetically Engineered Bacteria Producing O-Acetyl-L-Homoserine without Auxotrophy (1) Knockout of rhtC In order to reduce the export of threonine and reduce the carbon flow of intracellular threonine synthesis, the threonine efflux protein encoding gene rhtC was knocked out in the genome. This was achieved using the CRISPR-Cas9 system, see Jiang Y, Chen B, Duan C, et al. Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System [J]. Applied & Environmental Microbiology, 2015, 81 (7): 2506. The pTargetF vector (plasmid from Addgene) was diluted and used as a template. Primers 1 and 2 were used to construct the pTarget-ΔrhtC mutant vector that can express the sgRNA targeting the target gene rhtC by PCR. The PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, 30 cycles; 72 ℃ 5 min. The PCR product was transformed into E. coli DH5α competent medium and screened on a plate with spectinomycin hydrochloride (SD) resistance to obtain the pTarget-ΔrhtC vector with correct sequencing.

[0032] Subsequently, primers 3 and 4 were used to amplify the upstream homologous sequence of rhtC according to the rhtC gene of Escherichia coli published on NCBI. The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 5 min. In the same way, primers 5 and 6 were used to amplify the downstream homologous sequence of rhtC. The PCR product was purified using a purification kit.

[0033] The purified upstream and downstream homologous fragments of rhtC were subjected to fusion PCR using primers 3 and 6 to obtain the knockout frame. The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 5 min.

[0034] The process of preparing competent cells by chemical transformation is as follows: pick a single colony of Escherichia coli W3110 and inoculate it into a test tube containing 5 mL LB medium, and culture it overnight at 37°C and 200 rpm in a constant temperature shaker. Pipette 1 mL of the overnight culture solution and transfer it to a 250 mL conical flask containing 40 mL LB medium, and culture it at 37°C and 200 rpm in a constant temperature shaker for 1-2 hours until the OD value of the culture solution reaches 1.5. 600 The concentration of the cultured bacterial solution is between 0.4 and 0.6. Place the cultured bacterial solution on ice to cool for about 10 minutes, pour it into a 50 mL centrifuge tube, centrifuge it at 4°C, 5500 rpm for 5 minutes, remove the supernatant and retain the bacteria in a clean bench, add about 40 mL of pre-sterilized and pre-cooled 0.1 MCaCl2 solution, resuspend it in an ice-water bath, and ice-bath it for 30 minutes. After centrifugation at 6000 rpm for 5 minutes, add 1 mL of pre-cooled solution containing 0.1 MCaCl2 and 15% glycerol, resuspend it in an ice-water bath, and dispense it into 1.5 mL sterile centrifuge tubes (100 μL per tube), keep one tube for later use, and store the rest at -80°C.

[0035] The process of chemical transformation of pCas plasmid is as follows: take a competent cell and place it on ice, add 1 μL of plasmid to the competent cell in a clean bench, mix well and then place it on ice for 30 min. Then place the EP tube containing competent cells in a 42 ℃ constant temperature water bath for 90 s, and quickly insert it into ice to cool for 5 min. Add 700 μL of pre-cooled LB medium to the EP tube in the clean bench and culture it in a constant temperature shaker at 37 ℃ and 200 rpm for 1-2 h. Pipette 200 μL of bacterial solution and spread it on the LB solid plate of the corresponding resistance, invert it in a 37 ℃ constant temperature incubator and culture it overnight to obtain the Escherichia coli W3110 strain containing the pCas vector.

[0036] The electroporation competent cell preparation process is as follows: pick a single colony from the Escherichia coli W3110 pCas streak plate, inoculate it into a 5 mL LLB tube (kan resistance), add 100 μL of L-Ara stock solution, and culture it at 30°C, 180 rpm overnight as seed solution. Inoculate 500 μL of the seed solution into a 50 mL shake flask LLB (kan resistance), add 500 μL of L-Ara stock solution, and culture it at 30°C, 180 rpm for 3-4 h until the OD reaches 0. 600= 0.6. Precool the shake flask and centrifuge tube in an ice bath for 10 min, pour the bacterial solution into the centrifuge tube in the clean bench, and centrifuge at 4°C, 6000 rpm for 5 min. Discard the supernatant in the clean bench and add 40 mL of precooled sterile ultrapure water. Gently resuspend the cells in an ice water bath, centrifuge at 4°C, 6000 rpm for 6 min, and repeat once. Discard the supernatant in the clean bench (pay attention to the loss of bacteria), add 20 mL of precooled 10% glycerol to a centrifuge tube, and resuspend in an ice water bath. Centrifuge at 4°C, 6000 rpm for 5 min. Discard the supernatant in the clean bench (pay attention to the loss of bacteria), add 1 mL of precooled 10% glycerol, resuspend in an ice water bath, and dispense 100 μL into sterile 2mL EP tubes in each tube, keep one tube for later use, and store the rest at -80°C.

[0037] The electroporation process is as follows: Take an electroporation competent cell and place it in an ice bath. Add 2 μL of pTarget-ΔrhtC vector and 2 μL of knockout frame PCR purification product in the clean bench, mix gently with a medium gun, and place on ice for 1 minute. Use a medium gun to transfer to a pre-cooled 2mm electroporation cup and place on ice for 1 minute. Use a paper towel to wipe off the water mist on the outside of the electroporation cup, place it in the electroporator, and use ECO 2 for electroporation. Add 1 mL of pre-cooled LLB medium to the groove of the electroporation cup in the clean bench, tilt the electroporation cup, absorb all the bacterial liquid from the mouth of the electroporation cup, and transfer it to a 2 mL sterile ep tube. Resuscitate at 30°C, 180 rpm for 3 hours. Take 400 μL and spread it on LLB solid medium (SD+kan resistance) and culture it at 30°C overnight.

[0038] A single colony was picked as a template for colony PCR verification to confirm the knockout of rhtC. The strain that passed this confirmation was cultured overnight at 30°C in LB medium containing 50 mg / L kanamycin and 5 mM IPTG to remove the pTarget-ΔrhtC vector. The strain from which the pTarget-ΔrhtC vector had been removed was then cultured overnight at 37°C in LB medium to remove the pCas vector. The strain constructed in this way was recorded as Escherichia coli OAHT1.

[0039] (2) Knockout of tdcB In order to reduce the degradation of threonine, the tdcB gene encoding threonine dehydrogenase in the genome of OAHT1 strain was knocked out by CRISPR-Cas9 system. The pTargetF vector was diluted and used as a template. Primers 7 and 8 were used to construct the pTarget-ΔtdcB mutant vector that can express sgRNA targeting the target gene tdcB by PCR. The PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, 30 cycles; 72 ℃ 5 min. The PCR product was transformed into E. coli DH5α competent medium and screened on a plate with spectinomycin hydrochloride (SD) resistance to obtain the pTarget-ΔtdcB vector with correct sequencing.

[0040] Subsequently, primers 9 and 10 were used to amplify the upstream homologous sequence of tdcB according to the tdcB gene of Escherichia coli published on NCBI. The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 5 min. In the same way, primers 11 and 12 were used to amplify the downstream homologous sequence of tdcB. The PCR product was purified using a purification kit.

[0041] The purified tdcB upstream and downstream homologous fragments were subjected to fusion PCR using primers 9 and 12 to obtain the knockout frame. The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 5 min.

[0042] The process of preparing competent cells by chemical transformation is as follows: pick a single colony of OAHT1 and inoculate it into a test tube containing 5 mL LB medium, and culture it overnight at 37°C and 200 rpm in a constant temperature shaker. Pipette 1 mL of the overnight culture solution and transfer it to a 250 mL conical flask containing 40 mL LB medium, and culture it at 37°C and 200 rpm in a constant temperature shaker for 1-2 hours until the OD value of the culture solution reaches 0. 600The concentration of the cultured bacterial solution is between 0.4 and 0.6. Place the cultured bacterial solution on ice to cool for about 10 minutes, pour it into a 50 mL centrifuge tube, centrifuge it at 4 °C and 5500 rpm for 5 minutes, remove the supernatant and retain the bacteria in a clean bench, add about 40 mL of pre-sterilized and pre-cooled 0.1 M CaCl2 solution, resuspend it in an ice water bath, and ice bath it for 30 minutes. After centrifugation at 6000 rpm for 5 minutes, add 1 mL of pre-cooled 0.1 M CaCl2 and 15% glycerol, resuspend it in an ice water bath, and dispense it into 1.5 mL sterile centrifuge tubes (100 μL per tube), keep one tube for use, and store the rest at -80 °C.

[0043] The process of chemical transformation of pCas plasmid is as follows: take a competent cell and place it on ice, add 1 μL of plasmid to the competent cell in a clean bench, mix well and then place it on ice for 30 min. Then place the EP tube containing competent cells in a 42 ℃ constant temperature water bath for 90 s, and quickly insert it into ice to cool for 5 min. Add 700 μL of pre-cooled LB medium to the EP tube in the clean bench, and culture it in a constant temperature shaker at 37 ℃ and 200 rpm for 1-2 h. Pipette 200 μL of bacterial solution and spread it on the LB solid plate of the corresponding resistance, invert it in a 37 ℃ constant temperature incubator and culture it overnight to obtain the OAHT1 strain containing the pCas vector.

[0044] The electroporation competent preparation process is as follows: pick a single colony from the OAHT1 pCas streak plate, inoculate it into a 5 mL LLB tube (kan resistance), add 100 μL of L-Ara stock solution, and culture it at 30°C, 180 rpm overnight as seed solution. Inoculate 500 μL of the seed solution into a 50 mL shake flask LLB (kan resistance), add 500 μL of L-Ara stock solution, and culture it at 30°C, 180 rpm for 3-4 h until the OD reaches 0. 600 = 0.6. Precool the shake flask and centrifuge tube in an ice bath for 10 min, pour the bacterial solution into the centrifuge tube in the clean bench, and centrifuge at 4℃, 6000 rpm for 5 min. Discard the supernatant in the clean bench and add 40 mL of precooled sterile ultrapure water. Gently resuspend the cells in an ice water bath, centrifuge at 4℃, 6000 rpm for 6 min, and repeat once. Discard the supernatant in the clean bench (pay attention to the loss of bacteria), add 20 mL of precooled 10% glycerol to a centrifuge tube, and resuspend in an ice water bath. Centrifuge at 4℃, 6000 rpm for 5 min. Discard the supernatant in the clean bench (pay attention to the loss of bacteria), add 1 mL of precooled 10% glycerol, resuspend in an ice water bath, and dispense 100 μL into sterile 2mL EP tubes in each tube, keep one tube for later use, and store the rest at -80℃.

[0045] The electroporation process is as follows: Take an electroporation competent cell and place it in an ice bath. Add 2 μL of pTarget-ΔtdcB vector and 2 μL of knockout frame PCR purification product in the clean bench, mix gently with a medium gun, and place on ice for 1 minute. Use a medium gun to transfer to a pre-cooled 2mm electroporation cup and place on ice for 1 minute. Use a paper towel to wipe off the water mist on the outside of the electroporation cup, place it in the electroporator, and use ECO 2 for electroporation. In the clean bench, add 1 mL of pre-cooled LLB medium to the groove of the electroporation cup, tilt the electroporation cup, absorb all the bacterial liquid from the mouth of the electroporation cup, and transfer it to a 2 mL sterile ep tube. Resuscitate at 30°C, 180 rpm for 3 hours. Take 400 μL and spread it on LLB solid medium (SD+kan resistance) and culture it at 30°C overnight.

[0046] A single colony was picked as a template for colony PCR verification to confirm the knockout of tdcB. The strain that passed this confirmation was cultured overnight at 30°C in LB medium containing 50 mg / L kanamycin and 5 mM IPTG to remove the pTarget-ΔtdcB vector. The strain from which the pTarget-ΔtdcB vector had been removed was then cultured overnight at 37°C in LB medium to remove the pCas vector. The strain constructed in this way was recorded as Escherichia coli OAHT2.

[0047] (3) Knockout of tdh In order to reduce the degradation of threonine and thus weaken the carbon flow to threonine, the threonine 3-dehydrogenase gene tdh was knocked out in the genome. The tdh gene encoding threonine 3-dehydrogenase in the genome of the OAHT2 strain was knocked out by the CRISPR-Cas9 system. The pTargetF vector was diluted and used as a template. Primers 13 and 14 were used to construct the pTarget-Δtdh mutant vector that can express the sgRNA targeting the target gene tdh by PCR. The PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, 30 cycles; 72 ℃ 5 min. The PCR product was transformed into E. coli DH5α competent cells and screened on a plate with spectinomycin hydrochloride (SD) resistance to obtain the pTarget-Δtdh vector with correct sequencing.

[0048] Subsequently, primers 15 and 16 were used to amplify the upstream homologous sequence of tdh according to the tdh gene of Escherichia coli published on NCBI. The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 5 min. In the same way, primers 17 and 18 were used to amplify the downstream homologous sequence of tdh. The PCR product was purified using a purification kit.

[0049] The purified tdh upstream and downstream homologous fragments were subjected to fusion PCR using primers 15 and 18 to obtain the knockout frame. The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 5 min.

[0050] The process of preparing competent cells by chemical transformation is as follows: pick a single colony of OAHT2 and inoculate it into a test tube containing 5 mL LB medium, and culture it overnight at 37°C and 200 rpm in a constant temperature shaker. Pipette 1 mL of the overnight culture solution and transfer it to a 250 mL conical flask containing 40 mL LB medium, and culture it at 37°C and 200 rpm in a constant temperature shaker for 1-2 hours until the OD value of the culture solution reaches 0. 600 The concentration of the cultured bacterial solution is between 0.4 and 0.6. Place the cultured bacterial solution on ice to cool for about 10 minutes, pour it into a 50 mL centrifuge tube, centrifuge it at 4 °C and 5500 rpm for 5 minutes, remove the supernatant and retain the bacteria in a clean bench, add about 40 mL of pre-sterilized and pre-cooled 0.1 M CaCl2 solution, resuspend it in an ice water bath, and ice bath it for 30 minutes. After centrifugation at 6000 rpm for 5 minutes, add 1 mL of pre-cooled 0.1 M CaCl2 and 15% glycerol, resuspend it in an ice water bath, and dispense it into 1.5 mL sterile centrifuge tubes (100 μL per tube), keep one tube for use, and store the rest at -80 °C.

[0051] The process of chemical transformation of pCas plasmid is as follows: take a competent cell and place it on ice, add 1 μL of plasmid to the competent cell in a clean bench, mix well and then place it on ice for 30 min. Then place the EP tube containing competent cells in a 42 ℃ constant temperature water bath for 90 s, and quickly insert it into ice to cool for 5 min. Add 700 μL of pre-cooled LB medium to the EP tube in the clean bench, and culture it in a constant temperature shaker at 37 ℃ and 200 rpm for 1-2 h. Pipette 200 μL of bacterial solution and spread it on the LB solid plate of the corresponding resistance, invert it in a 37 ℃ constant temperature incubator and culture it overnight to obtain the OAHT2 strain containing the pCas vector.

[0052] The electroporation competent preparation process is as follows: pick a single colony from the OAHT2 pCas streak plate, inoculate it into a 5 mL LLB tube (kan resistance), add 100 μL L-Ara stock solution, and culture it at 30°C, 180 rpm overnight as seed solution. Inoculate 500 μL of the seed solution into a 50 mL shake flask LLB (kan resistance), add 500 μL L-Ara stock solution, and culture it at 30°C, 180 rpm for 3-4 h until the OD reaches 0. 600= 0.6. Precool the shake flask and centrifuge tube in an ice bath for 10 min, pour the bacterial solution into the centrifuge tube in the clean bench, and centrifuge at 4℃, 6000 rpm for 5 min. Discard the supernatant in the clean bench and add 40 mL of precooled sterile ultrapure water. Gently resuspend the cells in an ice water bath, centrifuge at 4℃, 6000 rpm for 6 min, and repeat once. Discard the supernatant in the clean bench (pay attention to the loss of bacteria), add 20 mL of precooled 10% glycerol to a centrifuge tube, and resuspend in an ice water bath. Centrifuge at 4℃, 6000 rpm for 5 min. Discard the supernatant in the clean bench (pay attention to the loss of bacteria), add 1 mL of precooled 10% glycerol, resuspend in an ice water bath, and dispense 100 μL into sterile 2mL EP tubes in each tube, keep one tube for later use, and store the rest at -80℃.

[0053] The electroporation process is as follows: Take an electroporation competent cell and place it in an ice bath. Add 2 μL of pTarget-Δtdh vector and 2 μL of knockout frame PCR purification product in the clean bench, mix gently with a medium gun, and place on ice for 1 minute. Use a medium gun to transfer to a pre-cooled 2mm electroporation cup and place on ice for 1 minute. Use a paper towel to wipe off the water mist on the outside of the electroporation cup, place it in the electroporator, and use ECO 2 for electroporation. Add 1 mL of pre-cooled LLB medium to the groove of the electroporation cup in the clean bench, tilt the electroporation cup, absorb all the bacterial liquid from the mouth of the electroporation cup, and transfer it to a 2 mL sterile ep tube. Resuscitate at 30°C, 180 rpm for 3 hours. Take 400 μL and spread it on LLB solid medium (SD+kan resistance) and culture it at 30°C overnight.

[0054] A single colony was picked as a template for colony PCR verification to confirm the knockout of tdh. The strain that passed this confirmation was cultured overnight at 30°C in LB medium containing 50 mg / L kanamycin and 5 mM IPTG to remove the pTarget-Δtdh vector. The strain from which the pTarget-Δtdh vector had been removed was then cultured overnight at 37°C in LB medium to remove the pCas vector. The strain constructed in this way was recorded as Escherichia coli OAHT3.

[0055] (4) Threonine concentration dynamically regulates the replenishment of the homoserine kinase encoding gene thrB In order to make the strength of the threonine pathway change with the intracellular threonine concentration, a copy of the homoserine kinase encoding gene thrB driven by the promoter Pthr and connected to the leader peptide thrL mutant was integrated into the genome. The genome of the OAHT3 strain was edited by the CRISPR-Cas9 system. The pTargetF vector was diluted and used as a template. Primers 19 and 20 were used to construct the pTarget-ΔyjiT mutant vector that can express the sgRNA targeting the target gene yjiT by PCR. The PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, 30 cycles; 72 ℃ 5min. The PCR product was transformed into E. coli DH5α competent cells and screened on a plate with spectinomycin hydrochloride (SD) resistance to obtain the pTarget-ΔyjiT vector with correct sequencing.

[0056] Then, according to the yjiT gene of Escherichia coli published on NCBI, primers 21 and 22 were used to amplify the upstream homologous sequence of yjiT. The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 5 min. In the same way, primers 23 and 24 were used to amplify the downstream homologous sequence of yjiT. The PCR product was purified using a purification kit.

[0057] By PCR, using the Escherichia coli genome as a template, the promoter Pthr was amplified using primers 25 and 26, and its nucleotide sequence is SEQ ID NO.1. ThrL was amplified and mutated by primers 27 and 28, and its nucleotide sequence is SEQ ID NO.2. ThrB (GenBank ID. No. 85674277) was amplified by primers 29 and 30. The PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, 30 cycles; 72 ℃ 5min. The PCR product was purified using a purification kit. The purified upstream and downstream homologous fragments of yjiT were subjected to fusion PCR using primers 21 and 24 to obtain the knock-in frame. The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 5 min.

[0058] The process of preparing competent cells by chemical transformation is as follows: pick a single colony of OAHT3 and inoculate it into a test tube containing 5 mL LB medium, and culture it overnight at 37 ℃ and 200 rpm in a constant temperature shaker. Pipette 1 mL of the overnight culture solution and transfer it to a 250 mL conical flask containing 40 mL LB medium, and culture it at 37 ℃ and 200 rpm in a constant temperature shaker for 1-2 hours until the OD600 of the culture solution is 0.4-0.6. Place the cultured bacterial solution on ice to cool for about 10 minutes, pour it into a 50 mL centrifuge tube, centrifuge it at 4 ℃ and 5500 rpm for 5 minutes, remove the supernatant and retain the bacteria in the clean bench, add about 40 mL of pre-sterilized pre-cooled 0.1 M CaCl2 solution, resuspend it in an ice water bath, and ice bath it for 30 minutes. After centrifugation at 6000 rpm for 5 min, add 1 mL of pre-cooled medium containing 0.1 M CaCl2 and 15% glycerol, resuspend in an ice-water bath, and dispense into 1.5 mL sterile centrifuge tubes (100 μL per tube), keep one tube for later use, and store the rest at -80°C.

[0059] The process of chemical transformation of pCas plasmid is as follows: take a competent cell and place it on ice, add 1 μL of plasmid to the competent cell in a clean bench, mix well and then place it on ice for 30 min. Then place the EP tube containing competent cells in a 42 ℃ constant temperature water bath for 90 s, and quickly insert it into ice to cool for 5 min. Add 700 μL of pre-cooled LB medium to the EP tube in the clean bench, and culture it in a constant temperature shaker at 37 ℃ and 200 rpm for 1-2 h. Pipette 200 μL of bacterial solution and spread it on the LB solid plate of the corresponding resistance, invert it in a 37 ℃ constant temperature incubator and culture it overnight to obtain the OAHT3 strain containing the pCas vector.

[0060] The electroporation competent preparation process is as follows: pick a single colony from the OAHT3 pCas streak plate, inoculate it into a 5 mL LLB tube (kan resistance), add 100 μL L-Ara stock solution, and culture it at 30°C, 180 rpm overnight as seed solution. Inoculate 500 μL of the seed solution into a 50 mL shake flask LLB (kan resistance), add 500 μL L-Ara stock solution, and culture it at 30°C, 180 rpm for 3-4 h until the OD reaches 0. 600= 0.6. Precool the shake flask and centrifuge tube in an ice bath for 10 min, pour the bacterial solution into the centrifuge tube in the clean bench, and centrifuge at 4℃, 6000 rpm for 5 min. Discard the supernatant in the clean bench and add 40 mL of precooled sterile ultrapure water. Gently resuspend the cells in an ice water bath, centrifuge at 4℃, 6000 rpm for 6 min, and repeat once. Discard the supernatant in the clean bench (pay attention to the loss of bacteria), add 20 mL of precooled 10% glycerol to a centrifuge tube, and resuspend in an ice water bath. Centrifuge at 4℃, 6000 rpm for 5 min. Discard the supernatant in the clean bench (pay attention to the loss of bacteria), add 1 mL of precooled 10% glycerol, resuspend in an ice water bath, and dispense 100 μL into sterile 2mL EP tubes in each tube, keep one tube for later use, and store the rest at -80℃.

[0061] The electroporation process is as follows: Take an electroporation competent cell and place it in an ice bath. Add 2 μL of pTarget-ΔyjiT vector and 2 μL of knock-in frame PCR purification product in the clean bench, mix gently with a medium gun, and place on ice for 1 minute. Use a medium gun to transfer to a pre-cooled 2mm electroporation cup and place on ice for 1 minute. Use a paper towel to wipe off the water mist on the outside of the electroporation cup, place it in the electroporator, and use ECO 2 for electroporation. Add 1 mL of pre-cooled LLB culture medium to the groove of the electroporation cup in the clean bench, tilt the electroporation cup, absorb all the bacterial liquid from the mouth of the electroporation cup, and transfer it to a 2 mL sterile ep tube. Resuscitate at 30°C, 180 rpm for 3 hours. Take 400 μL and spread it on LLB solid culture medium (SD+kan resistance) and culture it at 30°C overnight.

[0062] A single colony was picked as a template for colony PCR verification to confirm the knock-in of thrB. The strain that passed this confirmation was cultured overnight at 30°C in LB medium containing 50 mg / L kanamycin and 5 mM IPTG to remove the pTarget-ΔyjiT vector. The strain from which the pTarget-ΔyjiT vector had been removed was then cultured overnight in LB medium at 37°C to remove the pCas vector. The strain constructed in this way was recorded as E. coli OAHT4.

[0063] Table 1 Primer list Primer 1 TAATACTAGTCATACGCTGATTATGGTGGGGTTTTAGAGCTAGAAATAGC Primer 2 GCTCTAAAACCCCACCATAATCAGCGTATGACTAGTATTATACCTAGGAC Primer 3 GCCATGAACATTGGGTGAGC Primer 4 TCACCGCGAAATAATCAAAT Primer 5 ATTTGATTATTTCGCGGTGATGCCAGACGCGTCTTCAGAG Primer 6 GGGGACGCTATTTTCCCGCT Primer 7 TAATACTAGTATTAAGTTCACTGACCGATGGTTTTAGAGCTAGAAATAGC Primer 8 GCTCTAAAACCATCGGTCAGTGAACTTAATACTAGTATTATACCTAGGAC Primer 9 TCCCGAACATGCACCGGCAC Primer 10 TATAAAACCTCTTCGCCTGA Primer 11 TCAGGCGAAGAGGTTTTATATTAATTCGTTGAGGATAGGA Primer 12 ATCAGATCCTTACCAAACCA Primer 13 TAATACTAGTCTTGACACCATGAATCACGGGTTTTAGAGCTAGAAATAGC Primer 14 GCTCTAAAACCCGTGATTCATGGTGTCAAGACTAGTATTATACCTAGGAC Primer 15 CACCGGTACGCTTGGTAAAG Primer 16 CTCACATCCTCAGGCGATAA Primer 17 TTATCGCCTGAGGATGTGAGCACGAACAAGGGCTGGTATT Primer 18 CGACATATTTGCCCGTTGC Primer 19 TAATACTAGTATTGCCGTTCATAATCCCTGGTTTTAGAGCTAGAAATAGC Primer 20 GCTCTAAAACCAGGGATTATGAACGGCAATACTAGTATTATACCTAGGAC Primer 21 AGCAGATGGAATTTCACGAA Primer 22 CACAACTCATTTATCACCTG Primer 23 CAAAACAGCATTACAGCCAG Primer 24 AGGCGTTGTAGGGTATAACC Primer 25 CAGGTGATAAATGAGTTGTGTTGACTTAGGTCACTAAATA Primer 26 GTGGTGCTAATGCGGTGCATGGATTGTTGTGTACTCTGTAA Primer 27 ATGCACCGCATTAGCACCAC Primer 28 GGTTGTTACCTCGTTACCTT Primer 29 AAGGTAACGAGGTAACAACCATGGTTAAAGTTTATGCCCC Primer 30 CTGGCTGTAATGCTGTTTTGTTAGTTTTCCAGTACTCGTG Example 2 Shake flask fermentation experiment The above-mentioned bacteria were tested in a fermentation experiment in a shake flask to compare the ability of each genotype strain to produce O-acetyl-L-homoserine. The shake flask fermentation experiment was carried out according to the following scheme: each strain was streaked on an LB plate, cultured in a 37°C incubator overnight, a single colony was picked and inoculated into 5 ml of LB medium, and cultured in a 37°C incubator at a speed of 200 rpm overnight to obtain a seed solution.

[0064] 50 ml of fermentation medium was added to a 500 ml shake flask, and 1 ml of seed solution of each strain was inoculated into the fermentation medium. The final concentration of the fermentation medium was as follows: glucose 30 g / L, potassium dihydrogen phosphate 2 g / L, ammonium sulfate 20 g / L, yeast powder 4 g / L, calcium carbonate 20 g / L, L-threonine 0.20 g / L, vitamin B1 0.0001 g / L, vitamin B12 0.0001 g / L, L-isoleucine 0.2 g / L, MgSO4 2 g / L, FeSO4 0.005 g / L, MnSO4 0.005 g / L, ZnSO4 0.005 g / L, the solvent was deionized water, and the pH value was 6.8. Cultivate at 200 rpm in a 30°C incubator for 48 hours, take a certain amount of fermentation broth from the shake flask, dilute it 100 times with ultrapure water, filter it through a membrane, and use an amino acid analyzer to detect the content of O-acetyl-L-homoserine in the fermentation broth. Finally, compare the amount of O-acetyl-L-homoserine obtained by strains of different genotypes. The results of the shake flask fermentation experiment of the metabolically modified strains are shown in Figure 2. Figure 1 shown.

[0065] according to Figure 1 It can be seen that the metabolically modified OAHT4 strain has no amino acid deficiency, has the ability to produce and accumulate O-acetyl-L-homoserine extracellularly, and can better utilize carbon sources such as glucose to produce O-acetyl-L-homoserine compared to the wild-type and chassis strains. The strain with the best performance after modification increased the level of O-acetyl-L-homoserine fermentation from 12.66 g / L to 18.84 g / L compared to the chassis strain, and has no amino acid deficiency, does not require additional amino acids, and fermentation is more stable. The levels of O-acetyl-L-homoserine production of other modified strains have been improved to varying degrees compared to the original strains.

Claims

1. A genetically engineered bacterium that produces O-acetyl-L-homoserine without nutritional deficiency, characterized in that: In the chassis strain Escherichia coli W3110, the threonine efflux protein encoding gene rhtC, the threonine dehydrogenase encoding gene tdcB, and the threonine 3-dehydrogenase encoding gene tdh are knocked out, and the homoserine kinase encoding gene thrB dynamically regulated by the threonine concentration is supplemented to obtain the genetically engineered bacteria without nutritional deficiency of O-acetyl-L-homoserine.

2. The genetically engineered bacterium producing O-acetyl-L-homoserine without auxotrophy according to claim 1, characterized in that: The thrB gene is expressed by the promoter Pthr, and the nucleotide sequence of the promoter is SEQ ID NO.

1.

3. The genetically engineered bacterium of claim 1 that is free of auxotrophic O-acetyl-L-homoserine, characterized in that: The dynamic regulation of threonine concentration is achieved by connecting a leader peptide thrL mutant in front of the thrB gene.

4. The genetically engineered bacterium producing O-acetyl-L-homoserine without auxotrophy as claimed in claim 3, characterized in that: Compared with the leader peptide encoded by the thrL gene from Escherichia coli, the second codon AAA of the thrL mutant is mutated to CAC, and the nucleotide sequence of the thrL mutant is SEQ ID NO.

2.

5. The genetically engineered bacterium of claim 1 that is free of auxotrophic O-acetyl-L-homoserine, characterized in that: The thrB is integrated into the yjiT gene site.

6. Use of a genetically engineered bacterium having no auxotrophic O-acetyl-L-homoserine according to any one of claims 1 to 5 in fermentation production of O-acetyl-L-homoserine.

7. The use according to claim 6, characterized in that The application is to inoculate the genetically engineered bacteria into a fermentation medium, ferment and culture at 30-33°C and 180-220rpm, separate and purify the culture solution to obtain O-acetyl-L-homoserine.

8. The use according to claim 7, characterized in that Before the fermentation culture, slant activation and seed culture are first performed, and the seed liquid is inoculated into the fermentation medium.

9. The use according to claim 8, characterized in that The seed culture method comprises the following steps: picking a single bacterial colony from a slant and inoculating it into an LB liquid culture medium, culturing it overnight under appropriate conditions to obtain a seed solution, and inoculating the seed solution into a fermentation culture medium.

10. The use according to claim 8, characterized in that The steps of the slant activation method are as follows: inoculating the recombinant E. coli on an LB plate, culturing at 37° C. overnight, and obtaining slant bacteria.

Images