A ferulic acid decarboxylase highly active mutant and its application

Abstract

The present invention discloses a high-activity mutant of ferulic acid decarboxylase and its application, belonging to the technical fields of enzyme engineering and genetic engineering. The amino acid sequence of the ferulic acid decarboxylase mutant of the present invention is SEQ ID NO.7, SEQ ID NO.14 or SEQ ID NO.16. The present invention solves the technical problem of low catalytic activity of natural ferulic acid decarboxylase Fdc1 and can be used for the biosynthesis of 4-acetoxystyrene. The mutant of the present invention improves the decarboxylation activity of ferulic acid decarboxylase towards 4-acetoxycinnamic acid and enhances the industrial application potential of the enzyme.

Description

[0001] This is a divisional application of a Chinese invention with an application date of November 22, 2023, an application number of 202311572551.0, and an invention title of "A High-Activity Combinatorial Mutant of Ferulic Acid Decarboxylase and Its Application". Technical Field

[0002] The present invention relates to a high-activity mutant of ferulic acid decarboxylase and its application, belonging to the technical fields of enzyme engineering and genetic engineering. Background Art

[0003] Ferulic acid decarboxylase Fdc1 (Ferulic acid decarboxylase) is a prenylated flavin mononucleotide (prFMN)-cofactor-dependent reversible aromatic carboxylic acid decarboxylase. Fdc1 was initially found to act on the decarboxylation of ferulic acid to generate 4-vinylguaiacol. Further studies have shown that it has the ability to catalyze the reaction of a series of broad α,β-unsaturated carboxylic acids represented by cinnamic acid and other substrates to generate styrene and the like. Currently, there are few reports on the catalytic reaction of cinnamic acid derivative 4-acetoxycinnamic acid, and the decarboxylation product 4-acetoxystyrene of the latter is an important monomer for synthesizing the photoresist poly-4-acetoxystyrene material. However, the catalytic efficiency of ferulic acid decarboxylase Fdc1 on the non-natural substrate 4-acetoxycinnamic acid is very low, which hinders its industrial application.

[0004] Using ferulic acid decarboxylase Fdc1 as a biocatalyst to synthesize 4-acetoxystyrene, the reaction conditions are mild, green and environmentally friendly. However, the low activity of ferulic acid decarboxylase towards this substrate limits its industrial application potential. Engineering modification of the enzyme is an important method to solve the above problems. Using strategies such as directed evolution and semi-rational design to improve the catalytic activity of ferulic acid decarboxylase Fdc1 is of great significance for improving the industrial application prospects of ferulic acid decarboxylase Fdc1. Summary of the Invention

[0005] In order to solve the problems existing in the prior art, the present invention provides a high-activity mutant of ferulic acid decarboxylase and its application, which solves the technical problem of the low catalytic activity of natural ferulic acid decarboxylase Fdc1 and can be used for the biosynthesis of 4-acetoxystyrene. The present invention uses 4-acetoxycinnamic acid as a substrate, analyzes the potential interaction sites between Fdc1 and 4-acetoxycinnamic acid, constructs a saturation mutant library of the interaction sites between Fdc1 and 4-acetoxycinnamic acid, establishes a high-throughput screening method, screens a series of mutants with improved enzyme activity and conducts iterative combinatorial design, and finally obtains a high-activity Fdc1 mutant and applies it to the biosynthesis of 4-acetoxystyrene.

[0006] To achieve the above object, the technical solution adopted by the present invention includes:

[0007] In a first aspect, the present invention provides a ferulic acid decarboxylase mutant, and the amino acid sequence of the ferulic acid decarboxylase mutant is SEQ ID NO.7, SEQ ID NO.14 or SEQ ID NO.16.

[0008] In a second aspect, the present invention provides a recombinant plasmid carrying the gene encoding the mutant.

[0009] In a third aspect, the present invention provides a recombinant engineering strain carrying and expressing the recombinant plasmid.

[0010] Further, the engineering strain is Escherichia coli.

[0011] In a fourth aspect, the present invention provides the use of the mutant, the recombinant plasmid or the recombinant engineering strain in the preparation of 4-acetoxystyrene.

[0012] Further, using 4-acetoxycinnamic acid as a substrate, the ferulic acid decarboxylase mutant or the recombinant engineering strain is added to a reaction system containing the 4-acetoxycinnamic acid substrate to generate 4-acetoxystyrene.

[0013] Beneficial effects:

[0014] The present invention constructs a ferulic acid decarboxylase mutant containing a P441S mutation site for the wild-type Fdc1 derived from Saccharomyces cerevisiae and uses it to catalyze the production of 4-acetoxystyrene from 4-acetoxycinnamic acid. The present invention confirms that the amino acid residue at position 441 has a great influence on the catalytic action of ferulic acid decarboxylase. The proline at position 441 is mutated to serine, and the activity is increased by 3.8 times compared with that of the wild-type ferulic acid decarboxylase. The present invention provides a certain basis for the study of the catalytic mechanism of this enzyme, and its mutant improves the industrial application potential of this enzyme. Description of the drawings

[0015] Figure 1 Ferulic acid decarboxylase Fdc1 catalyzes the decarboxylation reaction equation of 4-acetoxycinnamic acid;

[0016] Figure 2 Cofactor and substrate binding pocket of ferulic acid decarboxylase Fdc1 derived from Saccharomyces cerevisiae;

[0017] Figure 3 Absorbance wavelength scanning of 4-acetoxycinnamic acid, 4-acetoxystyrene and reaction background;

[0018] Figure 4 Liquid chromatograms of the substrate 4-acetoxycinnamic acid and the product 4-acetoxystyrene;

[0019] Figure 5 Determination of the relative enzyme activity of ferulic acid decarboxylase mutants against the substrate 4 - acetoxycinnamic acid. Detailed implementation manners

[0020] To better explain the present invention for easy understanding, the present invention will be described in detail below in conjunction with the accompanying drawings through specific implementation manners.

[0021] To better understand the above - mentioned technical solutions, the exemplary embodiments of the present invention will be described in more detail below. It should be understood that the present invention can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided so that the present invention can be understood more clearly and thoroughly, and the scope of the present invention can be completely conveyed to those skilled in the art.

[0022] Ferulic acid decarboxylase Fdc1 derived from Saccharomyces cerevisiae mainly acts on α,β - unsaturated carboxylic acids represented by ferulic acid and cinnamic acid, but has a very low decarboxylation efficiency for 4 - acetoxycinnamic acid. The present invention improves the decarboxylation activity of ferulic acid decarboxylase Fdc1 derived from Saccharomyces cerevisiae against 4 - acetoxycinnamic acid through a semi - rational design method. By means of molecular docking and enzyme structure analysis, amino acid residues that directly interact with the substrate are selected around the enzyme catalytic active center, and NNK degenerate primers are designed to construct a mutant library. Mutants with improved catalytic activity against 4 - acetoxycinnamic acid are selected, and then a strategy of combinatorial active - site saturation mutagenesis is adopted for multiple rounds of stacking mutations to further enhance the catalytic activity of ferulic acid decarboxylase.

[0023] The raw materials used in the present invention are all conventional commercially available products without special instructions; the methods used in the present invention are all conventional methods in the art without special instructions.

[0024] The ferulic acid decarboxylase library constructed in the present invention is based on the wild - type Saccharomyces cerevisiae - derived sequence (such as SEQ ID NO.1), and saturation mutagenesis and iterative combinatorial mutagenesis are carried out at one or more of the 397th, 398th, 438th, or 441st amino acid residues of the encoded amino acid sequence SEQ ID NO.3. The obtained ferulic acid decarboxylase mutants contain one or more of the sites F397V, I398L, T438P, P441S, or P441V.

[0025] The present invention screens ferulic acid decarboxylase with high - efficiency decarboxylation of 4 - acetoxycinnamic acid based on spectroscopy, and the selected wavelength is 301 nm at which the substrate and the product have obvious differences.

[0026] The relative enzyme activity of the ferulic acid decarboxylase mutant of the present invention towards the substrate 4-acetoxycinnamic acid was determined based on high performance liquid chromatography. The test conditions were as follows: a certain volume of crude enzyme solution (containing approximately 20 ng of enzyme), 0.5 mM 4-acetoxycinnamic acid, and 50 mM PBS buffer (pH 6.0), reacting at 30 °C for 20 minutes, and the detection wavelength was 254 nm.

[0027] Example 1 Construction of a Ferulic Acid Decarboxylase Saturation Mutant Plasmid Library

[0028] The crystal structure of ferulic acid decarboxylase from Saccharomyces cerevisiae with the accession number 4ZAC was downloaded from the Protein Data Bank (PDB). Chain C of 4ZAC was selected as the initial model through structural analysis and the missing amino acid residues were repaired. Then, preprocessing such as removing water from the structure was performed, and the pdb file was saved. The three-dimensional structure of the small molecule 4-acetoxycinnamic acid was searched and downloaded from the PubChem (https: / / pubchem.ncbi.nlm.nih.gov / ) database, and its mechanical structure was optimized by Gaussian software.

[0029] Docking of the substrate 4-acetoxycinnamic acid with ferulic acid decarboxylase from Saccharomyces cerevisiae was performed by Autodock Vina software to obtain the structure of the protein-substrate-cofactor complex: The first step was to prepare the coordinate files, exporting the protein and the small molecule into specific coordinate file formats pdbqt respectively, adding hydrogen to the protein, calculating charges, and adding atomic types; adding hydrogen to the small molecule, calculating charges, determining the torsional center, and selecting the rotatable bonds. The second step was to set the docking box, including the center coordinates and size parameters, and creating a configuration file containing the docking parameters in AutoDockTools. The third step was to run the AutoDock vina program and extract the binding conformation with the minimum Binding Energy, i.e., the optimal one.

[0030] Finally, through analysis by Pymol software, the amino acid residues near the binding pockets of the substrate and cofactor were determined (see Figure 2, in the figure, the cartoon figure is the Fdc1 protein, the spherical models are the substrate 4-acetoxycinnamic acid and the cofactor prFMN respectively, and the rod-shaped model is the mutation site to be constructed). At the same time, proteins with a sequence similarity of more than 30% to the ferulic acid decarboxylase Fdc1 sequence from Saccharomyces cerevisiae were selected on the NCBI website for sequence alignment, and the distribution of homologous sequences of amino acid residues near the binding pocket of the ferulic acid decarboxylase from Saccharomyces cerevisiae was calculated. Finally, 13 amino acid sites were determined to construct a screening library of NNK (I189, K190, F283, M286, P319, T326, I330, F397, I398, T438, F440, P441, L442), and their distribution positions are shown in Figure 2 .

[0031] After codon optimization for Escherichia coli respectively, the present invention cloned the gene fdc1 (SEQ ID NO.1) encoding ferulic acid decarboxylase from Saccharomyces cerevisiae and the gene ubix (SEQ ID NO.2) encoding isopropyl transferase from Pseudomonas aeruginosa into the BamⅠ / HindⅢ digestion site and the NdeⅠ / XhoⅠ digestion site of the expression vector pACYCDuet-1 to obtain the recombinant plasmid pACYCDuet-UbiX-Fdc1. The ferulic acid decarboxylase mutant provided by the present invention is obtained by mutating the nucleotide sequence shown in SEQ ID NO.1, and the amino acid sequence of the ferulic acid decarboxylase is SEQ ID NO.3.

[0032] Example 2 Obtaining a saturation mutant library of ferulic acid decarboxylase

[0033] Design degenerate primers to construct a mutant library: The NNK degenerate primers contain 32 (4×4×2) codon combinations (N = A / C / G / T, K = G / T), covering all 20 amino acids. Using the site-directed saturation mutagenesis strategy, with the recombinant plasmid pACYCDuet-UbiX-Fdc1 as the template and a pair of oligonucleotides with the mutation site as the amplification primers, PrimeSTAR high-fidelity enzyme was used for whole plasmid amplification to obtain a recombinant plasmid library with specific mutation sites.

[0034] The following amplification primers were used to amplify the target gene, where the underlined part represents the mutation site, and the primers with F in the name represent the upstream primers, and those with R represent the downstream primers:

[0035] I189-F: TACCGGCCTGGTG NNK AAACCGCAGCATATT

[0036] I189-R: TGCTGCGGTTT MNN CACCAGGCCGGTAAT

[0037] K190-F: GCCTGGTGATT NNK CCGCAGCATATTCGT

[0038] K190-R: AATATGCTGCGG MNN AATCACCAGGCCGGT

[0039] F283-F: TGGAAGGCCCG NNK GGCGAAATGCATGGCTAT

[0040] F283-R: GCATTTCGCC MNN CGGGCCTTCCAGATGGGTA

[0041] M286-F: CCGTTTGGCGAA NNK CATGGCTATGTGTTTA

[0042] M286-R: CACATAGCCATG MNN TTCGCCAAACGGGCCTT

[0043] P319-F: GGTTAGCAAC NNK GGCCTGTGCACCGAT

[0044] P319-R: GCACAGGCC MNN GTTGCTAACCGGCAGA

[0045] T326-F: TGCACCGATGAA NNK CATACCCTGATTGGCAG

[0046] T326-R: CAATCAGGGTATG MNN TTCATCGGTGCACAGG

[0047] I330-F: AAACCCATACCCTG NNK GGCAGCCTGGTGGC

[0048] I330-R: GCCACCAGGCTGCC MNN CAGGGTATGGGTTT

[0049] F397-F: CAAAGTGGGC NNK ATTGTGCATGAAATTATTCT

[0050] F397-R: ATTTCATGCACAATMNN GCCCACTTTGGTGCGA

[0051] I398-F:AAGTGGGCTTT NNK GTGCATGAAATTATTCT

[0052] I398-R:TAATTTCATGCAC MNN AAAGCCCACTTTGGT

[0053] T438-F:TTTGATGATGTG NNK AGCTTTCCGCT

[0054] T438-R:AGCGGAAAGCT MNN CACATCATCAAA

[0055] F440-F:TTTGATGATGTGACGAGC NNK CCGCTGGCGCCGTTTGTGA

[0056] F440-R:TCACAAACGGCGCCAGCGG MNN GCTCGTCACATCATCAAA

[0057] P441-F:ATGTGACGAGCTTT NNK CTGGCGCCGTTTGT

[0058] P441-R:ACAAACGGCGCCAG MNN AAAGCTCGTCACAT

[0059] L442-F:ATGATGTGACGAGCTTTCCG NNK GCGCCGTTTGTGAGTCAG

[0060] L442-R:AAACGGCGC MNN CGGAAAGCTCGTCACATCATCAAACGCCAT

[0061] The PrimeSTAR Max high-fidelity enzyme was used to amplify the Fdc1 gene containing specific mutation sites. It should be noted that the extension products of the forward and reverse primers anneal and pair to form a nicked open circular plasmid, and the template plasmid, i.e., the wild-type plasmid, is mixed in the system. The template plasmid needs to be removed by digesting the PCR product with DpnⅠ enzyme.

[0062] Next, the DpnⅠ digestion product was transformed into Escherichia coli competent cell BL21(DE3) by plasmid heat shock transformation. After adding 20 μL of the digestion product to the competent cell BL21(DE3), it was spread on an LB solid plate containing 50 μg / mL chloramphenicol resistance and cultured inverted at 37 °C for 12 hours to obtain a plate colony library of random saturated mutants. The monoclonal colonies on the plate were transferred to another new numbered plate. 5 mL of fresh LB medium containing 50 μg / mL chloramphenicol was added to each well of a 24-well plate, and all the transformants on the plate were picked and inoculated into each well in the order of the numbers. After overnight culture at 37 °C and 220 rpm, 1 mL of the seed liquid was taken from each well and transferred to another 24-well plate containing 5 mL of fresh LB medium with chloramphenicol. After culturing for about 3 hours until the OD600 reached 0.6 - 0.8, IPTG with a final concentration of 0.4 mM was added, and the culture was induced at 37 °C and 220 rpm for 5 hours. After the induction was completed, the cells were collected by centrifugation. 1 mL of buffer containing 1 mg / mL lysozyme and 100 mM Tris-HCl (pH 8.0) was added to each well to resuspend the cells sufficiently. After incubation at 37 °C for 30 minutes, the supernatant was taken by centrifugation and added to a 96-well plate. A multi-channel pipette was used to add the enzyme solution in each well to the corresponding prepared reaction solution to start the reaction, and high-throughput screening of the saturated mutant library was carried out.

[0063] Example 3 Establishment of a Spectrophotometric Method for Screening Ferulic Acid Decarboxylase with High Efficiency in Decarboxylating 4-Acetoxylcinnamic Acid

[0064] The substrate 4-acetoxylcinnamic acid and the product 4-acetoxystyrene of the decarboxylation reaction were respectively subjected to full-wavelength scanning to determine their respective maximum absorption wavelengths. Before measuring the samples, first, full-wavelength scanning was performed on other mixed components in the decarboxylation reaction system except the substrate 4-acetoxylcinnamic acid, including PBS buffer and the crude enzyme supernatant, to remove the influence of the reaction system background. A UV spectrophotometer was used for wavelength scanning from 200 to 450 nm, and measurements were taken every 5 nm. The results showed that the maximum absorption wavelength λ max of the substrate 4-acetoxylcinnamic acid was 280 nm, and the λ max of the product 4-acetoxystyrene was 260 nm. At 301 nm, the substrate 4-acetoxylcinnamic acid had a large absorption and was hardly interfered by the product 4-acetoxystyrene and the reaction system background. Therefore, 301 nm was selected as the detection wavelength for 4-acetoxylcinnamic acid in the decarboxylation reaction, as shown in Figure 3 .

[0065] The enzymatic reaction was carried out in a 200 μL reaction system, which included 0.5 mM 4-acetoxyl cinnamic acid and 50 mM PBS buffer (pH 6.0). The reaction was carried out at 30 °C for 20 minutes. By detecting the change in absorbance value at 301 nm, taking the absolute value of the change in absorbance value of the wild type before and after the reaction as the control, those with a ratio greater than 1.2 times that of the wild type were re-screened and verified by high performance liquid chromatography (HPLC). Finally, the mutants with improved enzyme activity were selected for sequencing. In HPLC, acetonitrile with a volume three times that of the reaction system was added to terminate the reaction, and the supernatant was taken by centrifugation for sample detection. The specific detection conditions were as follows: chromatographic column: Ecllpse XDB-C18 (250 * 4.6 mm * 5 μm); mobile phase: acetonitrile aqueous solution containing 0.1% trifluoroacetic acid (v / v = 1:1); detection wavelength: 254 nm; injection volume: 5 μL; column temperature: 25 °C; flow rate: 1.0 mL / min, isocratic elution for 20 minutes. The enzyme activity was evaluated by the production amount of the product 4-acetoxystyrene. The relationship between the peak area and concentration of the product 4-acetoxystyrene was y = 1253.3x + 18.967, R 2 = 0.9994, where y represents the peak area (mAU) and x represents the concentration of the product 4-acetoxystyrene (mM).

[0066] Among the 1248 mutant libraries planned to be constructed, 5 Fdc1 mutants of ferulic acid decarboxylase with improved enzyme activity were screened out. After gene sequencing, it was shown that they were distributed at 4 sites. There were two mutants at the P441 site, and their mutation sites were: F397V, I398L, T438P, P441S and P441V, and their amino acid sequences were SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8 respectively.

[0067] Example 4 Combinatorial active center saturation mutagenesis

[0068] Using a construction method similar to that of the single point mutants, the single point mutants with improved activity were cumulatively combined. Multiple mutation sites were selected for combination in the amino acid sequence shown in SEQ ID NO.3. 2 - 4 mutation sites were selected from the 5 mutation sites in Example 3 for combination to obtain different combinatorial mutants of ferulic acid decarboxylase respectively:

[0069] Two mutation sites were selected for combination, and eight ferulic acid decarboxylase mutants with improved decarboxylation activity towards 4-acetoxycinnamic acid were constructed. The combined mutation sites were: F397V / I398L, F397V / T438P, F397V / P441S, F397V / P441V, I398L / T438P, I398L / P441S, I398L / P441V, and T438P / P441S. The amino acid sequences of these eight ferulic acid decarboxylase combined mutants with improved catalytic activity were SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, and SEQ ID NO.16, respectively.

[0070] Three mutation sites were selected for combination, and two ferulic acid decarboxylase combined mutants with improved catalytic activity were constructed. The combined mutation sites were: F397V / T438P / P441S and I398L / T438P / P441V. The amino acid sequences of these two ferulic acid decarboxylase combined mutants with improved catalytic activity were SEQ ID NO.17 and SEQ ID NO.18, respectively.

[0071] Four mutation sites were selected for combination, and two ferulic acid decarboxylase combined mutants with improved catalytic activity were constructed. The combined mutation sites were: F397V / I398L / T438P / P441S and F397V / I398L / T438P / P441V. The amino acid sequences of these two ferulic acid decarboxylase combined mutants with improved catalytic activity were SEQ ID NO.19 and SEQ ID NO.20, respectively.

[0072] The relative enzyme activities of the above combined mutants compared to the corresponding wild-type Fdc1 are as Figure 5 shown. Using 4-acetoxycinnamic acid as the substrate, the activities of the above single-site mutants and combined-site mutants were significantly improved. Among them, the activity of the F397V / I398L / T438P / P441V mutant was increased by more than 11 times compared to the wild-type. Therefore, the Fdc1 high-activity combined mutants proposed in the present invention have important application value in the biosynthesis of 4-acetoxystyrene.

[0073] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A ferulic acid decarboxylase mutant, characterized in that, The amino acid sequence of the ferulic acid decarboxylase mutant is SEQ ID NO.7, SEQ ID NO.14 or SEQ ID NO.

16.

2. A recombinant plasmid carrying the mutant gene encoding the mutant as claimed in claim 1.

3. A recombinant engineering strain carrying and expressing the recombinant plasmid as claimed in claim 2.

4. The recombinant engineering strain according to claim 3, wherein The engineering strain is Escherichia coli.

5. Use of the mutant as claimed in claim 1, the recombinant plasmid as claimed in claim 2, or the recombinant engineering strain as claimed in claim 3 or 4 in the preparation of 4-acetoxystyrene.

6. The application according to claim 5, wherein Using 4-acetoxycinnamic acid as a substrate, adding the ferulic acid decarboxylase mutant, the recombinant plasmid or the recombinant engineering strain to a reaction system containing the 4-acetoxycinnamic acid substrate to produce 4-acetoxystyrene.

Images