Honeysuckle leaf-derived exosome-like nano-vesicle functional miRNA and application thereof

Abstract

The invention discloses a honeysuckle leaf-derived exosome-like nano-vesicle functional miRNA (micro Ribonucleic Acid) and application thereof, the honeysuckle leaf-derived exosome-like nano-vesicle functional miRNA is miR-novel1 or ath-miR396b-5p, the nucleotide sequence of the miR-novel1 is as shown in SEQ ID NO.1, and the nucleotide sequence of the ath-miR396b-5p is as shown in SEQ ID NO.2. The invention further discloses a preparation method of the honeysuckle leaf-derived exosome-like nano-vesicle functional miRNA and application of the honeysuckle leaf-derived exosome-like nano-vesicle functional miRNA. The invention also specifically discloses an application of the functional miRNA in preparation of anti-inflammatory drugs. The functional miRNA in the honeysuckle leaf exosome-like nano-particles obviously inhibits transcription of pro-inflammatory cytokine genes and expression of protein for synthesizing pro-inflammatory mediator enzymes (iNOS and COX-2) by inhibiting an STAT3 signal channel under the condition of no cytotoxic effect, so that the anti-inflammatory effect is achieved, and the honeysuckle leaf exosome-like nano-particles can be used as a new choice for preparing anti-inflammatory drugs and other anti-inflammatory products.

Description

Technical Field

[0001] The present invention belongs to the technical field of new medical applications of honeysuckle leaf-derived exosome-like nanovesicles, and specifically relates to honeysuckle leaf-derived exosome-like nanovesicle functional miRNA and applications thereof. Background Art

[0002] Inflammation is an important immune defense mechanism of the body. When the body tissue is damaged, it will enter a normal state of self-protection and damage repair. In the acute phase of the inflammatory response, immune system cells migrate to the damaged site under the influence of soluble mediators such as cytokines, chemokines and acute phase proteins to protect the body from harm, which is beneficial to the human body. However, excessive production of inflammatory mediators or long-term exposure to stimulation may cause damage to the body, causing inflammation to enter a chronic phase. Chronic inflammation plays an important role in cancer, arthritis, atherosclerosis, asthma, obesity, diabetes, autoimmune diseases, neurodegenerative diseases, and aging.

[0003] Clinical treatment of inflammation mainly focuses on inhibiting the production of pro-inflammatory mediators and inhibiting the activation of pro-inflammatory cytokine signaling pathways. Currently, common anti-inflammatory drugs are effective in treating inflammation, but they also cause some serious side effects. For example, non-steroidal anti-inflammatory drugs may cause gastrointestinal discomfort, peptic ulcers, bleeding and other side effects; steroid drugs may cause osteoporosis, induce aggravated infections, metabolic disorders and other side effects; immunosuppressants may cause gastrointestinal reactions, abnormal liver function and other side effects. Therefore, it is of great significance to develop natural, effective and safe anti-inflammatory drugs.

[0004] At present, the role of natural nanovesicles in the treatment of various diseases has gradually become the focus of clinical researchers. Plant-derived exosome-like nanovesicles are nanoscale vesicle structures with similar ultrastructures to animal exosomes. The main components of exosomes are lipids, proteins, nucleic acids and other chemical components. In addition to the potential regulation of plant immunity, these substances can also be delivered to animal cells to mediate cross-border regulation between plants and animals. They have significant effects in anti-oxidation, anti-inflammatory, anti-viral infection, anti-tumor, anti-fungal effects, relief of alcoholic liver disease, relief of colitis, and prevention of skin aging. For example, the patent document with publication number CN114642700A discloses a preparation and application of tea exosomes, which can be absorbed by intestinal epithelial cells, protect cells from damage by bacterial lipopolysaccharides, and protect the barrier function of intestinal epithelial cells. Exosomes are rich in miRNAs, which are small non-coding RNAs that can inhibit the expression of specific target genes through translation inhibition or mRNA degradation, and participate in multiple regulatory pathways. The patent document with publication number CN116790601A discloses functional miRNA in ginger exosome-like nanoparticles and its application as an inflammatory inhibitor. The functional miRNA in ginger exosomes can be used as a TNF signaling pathway inhibitor to exert anti-inflammatory effects. The patent document with publication number CN118304416A discloses the use of an exosome miR-2137 inhibitor in the preparation of anti-inflammatory and endotoxin-induced lung injury protective drugs. Inhibition of miR-2137 can effectively alleviate alveolar epithelial cell pyroptosis and lung injury. The miR-2137 inhibitor can reduce the production of proinflammatory factors, weaken the inflammatory response of the airways, reduce the infiltration of inflammatory cells, and alleviate alveolar epithelial pyroptosis. It is the first time to reveal that miR-2137 is closely related to acute lung injury and promotes the occurrence of acute lung injury. Patent document with publication number CN116814757A discloses that the expression of exosomal miR-26a-5p is significantly decreased in tuberculosis, and the expression of its target gene PTPN3 is significantly increased in tuberculosis. This study provides further evidence that functional miRNA derived from exosomes can be used to treat diseases.

[0005] Honeysuckle leaves are the leaves of Lonicera japonica Thunb., a plant of the genus Lonicera in the family Caprifoliaceae. Honeysuckle is the botanical name of honeysuckle, which is widely distributed in my country. The main production areas are Henan and Shandong, and most of them are cultivated. Honeysuckle has a long history of medicinal use in my country. It has been included in all editions of the Chinese Pharmacopoeia. It is also a commonly used bulk Chinese medicinal material in my country, with antibacterial, antiviral, anti-inflammatory, liver-protecting and choleretic effects. At present, no functional miRNAs in honeysuckle leaf exosome-like nanoparticles have been proven to have anti-inflammatory activity. The development and utilization of functional miRNAs in honeysuckle leaf exosome-like nanoparticles, so that functional miRNAs can be effectively delivered to target cells, and functional miRNAs effectively inhibit gene expression by inhibiting translation and inducing mRNA degradation, is the research focus of the present invention, which is expected to be widely used in the treatment of inflammatory diseases and has good clinical application prospects. Summary of the invention

[0006] In order to solve the above technical problems existing in the prior art, the present invention provides exosome-like nanovesicle functional miRNA derived from honeysuckle leaves, and the functional miRNA can be used to prepare inflammation inhibitors.

[0007] The present invention adopts the following technical solutions to solve the above technical problems:

[0008] The exosome-like nanovesicle functional miRNA derived from honeysuckle leaves is miR-novel1 or ath-miR396b-5p, wherein the nucleotide sequence of miR-novel1 is shown in SEQ ID NO.1, and the nucleotide sequence of ath-miR396b-5p is shown in SEQ ID NO.2.

[0009] Sequence number miRNA Sequence (5'-3') SEQ ID NO:1 miR-novel1 UCGGACCAGGCUUCAUUCCUC SEQ ID NO:2 miR-396b-5p UUCCACAGCUUUCUUGAACUU

[0010] A pharmaceutical composition comprising exosome-like nanovesicle functional miRNA derived from honeysuckle leaves.

[0011] The invention discloses an application of the honeysuckle leaf-derived exosome-like nanovesicle functional miRNA or pharmaceutical composition in the preparation of drugs for preventing and / or treating inflammation.

[0012] Furthermore, the drug reduces the expression of pro-inflammatory cytokines by inhibiting the STAT3 signaling pathway.

[0013] Furthermore, the pro-inflammatory cytokines are one or more of TNF-α, IL-6 or IL-1β.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] 1. The functional miRNA in the honeysuckle leaf exosome-like nanoparticles of the present invention significantly inhibits the transcription of proinflammatory cytokine genes and the expression of proteins that synthesize proinflammatory mediator enzymes (iNOS and COX-2) by inhibiting the STAT3 signaling pathway without cytotoxicity, thereby exerting an anti-inflammatory effect. It can be used as a new choice for preparing anti-inflammatory drugs and other anti-inflammatory products. This regulatory method seeks effective regulators from natural plants, which is safe and efficient; exosomes can be stored at low temperatures, and miRNA can be artificially synthesized, which is low in cost and can achieve large-scale production.

[0016] 2. The present invention includes a method for producing relevant anti-inflammatory drugs by utilizing the principle of inhibiting the STAT3 signaling pathway to reduce the expression of pro-inflammatory mediators.

[0017] 3. The present invention found that miR-novel1 and ath-miR396b-5p inhibited the JAK-STAT signaling pathway by targeting and inhibiting the expression of JAK1 and STAT3 genes, thereby exerting an anti-inflammatory effect. This provides a theoretical basis for miR-novel1 and ath-miR396b-5p to regulate the inflammatory pathway and thus alleviate inflammation. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The test results provided for Example 1 of the present invention (scientific electron microscope, particle size distribution and potential diagram, respectively).

[0019] Figure 2 This is the composition analysis (protein electrophoresis, nucleic acid electrophoresis and lipid pie chart) of Honeysuckle leaves nanotherapeutics (abbreviated as HLNTs in the following pictures).

[0020] Figure 3 The figure shows the uptake of fluorescently labeled honeysuckle leaf exosome-like nanoparticles (HLNTs) by mouse macrophages RAW264.7 at different time periods, as well as the cytotoxicity test of honeysuckle leaf exosome-like nanoparticles (HLNTs) on mouse macrophages RAW264.7.

[0021] Figure 4 To investigate the effect of honeysuckle leaf exosome-like nanoparticles (HLNTs) and their functional miRNA on LPS-induced release of proinflammatory mediator NO in RAW264.7 cells.

[0022] Figure 5 To investigate the effects of honeysuckle leaf exosome-like nanoparticles (HLNTs) and their functional miRNA on the mRNA levels of inflammatory factors (TNF-α, IL-1β, IL-6, iNOS) in LPS-induced RAW264.7 cells.

[0023] Figure 6 The inhibitory effect of honeysuckle exosome-like nanoparticles (HLNTs) and their functional miRNA on the expression of inflammatory factors (IL-6 and IL-1β) in RAW264.7 cells induced by LPS.

[0024] Figure 7 The improvement effect of honeysuckle leaf exosome-like nanoparticles (HLNTs) on the inflammatory response caused by LPS infection or tail amputation in zebrafish.

[0025] Figure 8 Dual luciferase assays verified that miR-novel1 and ath-miR396b-5p targeted STAT3 and JAK1 genes and inhibited STAT3 and JAK1 gene expression.

[0026] Fig. 9 Honeysuckle leaf exosome-like nanoparticles (HLNTs) and functional miRNA regulate the expression of inflammatory pathway target proteins and inflammation-related proteins. DETAILED DESCRIPTION

[0027] The above contents of the present invention are further described in detail by the following examples, but it should not be understood that the scope of the above subject matter of the present invention is limited to the following examples, and all technologies realized based on the above contents of the present invention belong to the scope of the present invention. If no specific conditions are specified, the conditions are carried out according to conventional conditions or the conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be purchased commercially.

[0028] In the first aspect, the present invention provides a method for extracting and preparing honeysuckle leaf exosome-like nanoparticles, which is mainly obtained by the following method: wash and dry fresh honeysuckle leaves, put them into a mortar, add liquid nitrogen and grind them into powder, add them to a 4°C pre-cooled phosphate buffer (PBS=7.4) and vortex mix them, and filter the obtained juice twice with a filter cloth to remove the residue, then continuously perform differential centrifugation at 4°C, take the supernatant after centrifugation, continue to perform ultracentrifugation on the supernatant, take the precipitate after centrifugation, and filter and sterilize with a filter membrane to obtain honeysuckle leaf exosome-like nanovesicles. The above differential centrifugation method is simple and convenient, and can effectively realize the extraction of honeysuckle leaf exosome-like nanoparticles. The crushing method includes but is not limited to grinding and crushing or juicer crushing.

[0029] In the second aspect, the present invention provides the use of the above-mentioned honeysuckle leaf exosome-like nanoparticles (HLNTs) and their functional miRNA in the preparation of anti-inflammatory drugs. The honeysuckle leaf exosome-like nanoparticles and their functional miRNA provided by the present invention have excellent anti-inflammatory properties, and have significant anti-inflammatory effects in the LPS-induced mouse macrophage RAW264.7 inflammation model and the zebrafish tail-breaking, LPS-induced inflammation model without cytotoxicity.

[0030] Example 1

[0031] Preparation of Exosome-like Nanoparticles from Honeysuckle Leaves

[0032] The honeysuckle leaves from Fengqiu, Henan were washed and dried, put into a mortar with liquid nitrogen and ground into powder, added into 4°C pre-cooled phosphate buffer (PBS=7.4), and vortexed to mix well. The obtained juice was filtered twice with filter cloth to remove residue. The juice was collected and the filtrate was treated by differential centrifugation. First, the larger particles in the honeysuckle were removed by centrifugation at 1000×g and 4°C for 20 min. The precipitate was discarded and the supernatant was collected and centrifuged at 3000×g and 4°C for 20 min to remove the plant fibers in the honeysuckle. The precipitate was discarded and the supernatant was collected and centrifuged at 10000×g and 4°C for 60 min and 12000×g and 4°C for 60 min to remove small particles. The precipitate was discarded and the supernatant was collected and filtered using a sterile suction filtration bottle with a pore size of 0.22 μm to sterilize the supernatant. Finally, the supernatant was centrifuged at 100000×g and 4°C for 80 min to collect the precipitate, which was resuspended with pre-cooled PBS and then filtered with a 0.2 μm sterile filter membrane to sterilize again to obtain a honeysuckle leaf exosome-like nanoparticle solution. The collected honeysuckle leaf exosomes were quantified for protein according to the protein BCA quantification kit method and stored at -80°C for later use. The following experiments were all carried out using the honeysuckle leaf exosome-like nanoparticles obtained in Example 1.

[0033] Example 2

[0034] Characterization of Exosome-like Nanoparticles from Honeysuckle Leaves

[0035] The particle size distribution and potential were determined using a Malvern Zetasizer Nano ZS, and the morphology of honeysuckle leaf exosome-like nanoparticles was observed using a transmission electron microscope. Figure 1 As shown in A, B and C in Figure 1, TEM shows that the isolated honeysuckle leaf exosome-like nanoparticles have a typical exosome vesicle structure, and the particle size varies between 68.0nm and 255.0nm, with an average of 122.4nm. TEM electron microscopy also shows that the particle size varies between 60-200nm. The potential of the honeysuckle leaf exosome-like nanoparticles is around -9.98mV.

[0036] Example 3

[0037] Analysis of components of exosome-like nanoparticles from honeysuckle leaves

[0038] The total protein of honeysuckle leaf exosome-like nanoparticles was extracted with RIPA protein extraction solution, and SDS-PAGE protein electrophoresis and silver staining were used to observe the distribution of proteins contained in exosomes ( Figure 2A); Trizol was used to extract the total RNA of honeysuckle leaf exosome-like nanoparticles, and nucleic acid electrophoresis was used to detect the total RNA of honeysuckle leaf exosome-like nanoparticles ( Figure 2 Middle B); The honeysuckle leaf exosome-like nanoparticles were sent to a sequencing company to extract lipids, and the resulting lipid distribution pie chart ( Figure 2 Middle C).

[0039] Example 4

[0040] The uptake of honeysuckle leaf exosome-like nanoparticles by RAW264.7 macrophages and the evaluation of honeysuckle leaf exosome-like nanoparticles' toxicity to RAW264.7 macrophages. Honeysuckle leaf exosome-like nanoparticles labeled with red fluorescent dye Dil were co-incubated with RAW264.7 macrophages for 6h, 12h, and 24h, respectively, and their uptake was observed by the red fluorescence intensity. The cell viability was detected by CCK-8 kit to evaluate the cytotoxicity of honeysuckle leaf exosome-like nanoparticles. The test results are shown in Figure 3 As shown, the honeysuckle leaf exosome-like nanoparticles had no toxicity to cells at a concentration of no more than 300 μg / mL.

[0041] Example 5

[0042] Anti-inflammatory activity of honeysuckle leaf exosome-like nanoparticles and their functional miRNAs on LPS-treated RAW264.7 cells

[0043] The anti-inflammatory activity of honeysuckle leaf exosome-like nanoparticles was evaluated by detecting the changes in the release of inflammatory mediator NO by LPS-induced RAW264.7 cells through the measurement of the effects of honeysuckle leaf exosome-like nanoparticles and their functional miRNA.

[0044] (1) Cell treatment

[0045] Take cells in logarithmic growth phase and firstly culture RAW264.7 cells at 8×10 5 Cells were inoculated into 6 wells at 37°C and 5% CO2 for 24 h, then observed under a microscope. When the cells adhered well to the wall and covered the bottom of the cells, they were used for subsequent experiments.

[0046] A. The exosome incubation group was treated according to the following groups:

[0047] (a) Control group: the culture medium contained an appropriate volume of 1× PBS and was treated for 18 h;

[0048] (b) Model group: the culture medium contained an appropriate volume of 1× PBS, and LPS (final concentration of 1 μg / mL) was added for 18 h;

[0049] (c) Treatment group: The culture medium contained different concentrations of honeysuckle leaf exosome-like nanoparticles, and LPS (final concentration of 1 μg / ml) was added for 18 h. 50 uL of the supernatant was taken, and the absorbance value at 540 nm was read according to the operating instructions of the NO kit to calculate the amount of NO produced in each well.

[0050] B. The small RNA transfection group was treated according to the following groups:

[0051] (a) Control group: add appropriate volume of RNATransMate, RNA transfection reagent, to the culture medium and treat for 24 h;

[0052] (b) Model group: an appropriate volume of RNATransMate was added to the culture medium, and then LPS (final concentration of 1 μg / mL) was added and treated for 24 h;

[0053] (c) Transfection group: RNATransMate was used to transfect NC mimic, miR-novel 1 mimic, and miR-396b-5p mimic, respectively, and LPS (final concentration of 1 μg / mL) was added for 24 h. 50 μL of the supernatant was taken and the absorbance value at 540 nm was read according to the operating instructions of the NO kit to calculate the amount of NO produced in each group.

[0054] (2) Experimental results

[0055] like Figure 4 As shown, the results showed that compared with the control group, the release of NO in the model group was significantly increased, and honeysuckle leaf exosome-like nanoparticles could significantly reduce the LPS-induced release of NO in RAW264.7 (*P<0.05, **P<0.01).

[0056] Example 6

[0057] Effects of honeysuckle leaf exosome-like nanoparticles (HLNTs) and their functional miRNA on mRNA levels of inflammatory factors (TNF-α, IL-1β, IL-6, iNOS) in LPS-induced RAW264.7 cells

[0058] (1) Cell treatment method

[0059] The cells were treated as in Example 5, and then collected from each group.

[0060] (2) The RT-qPCR detection system is as follows:

[0061] (a) Total RNA extraction

[0062] Trizol reagent was used to extract total RNA from each group.

[0063] (b) Reverse transcription system

[0064] The Takara reverse transcription system was used to remove genomic DNA first. The reaction system and conditions are shown in Table 1.

[0065] Table 1 Removal of genomic DNA

[0066]

[0067] Reverse transcription was performed to generate cDNA. The specific reverse transcription system and conditions are shown in Table 2.

[0068] Table 2 Reverse transcription reaction system and conditions

[0069]

[0070] (c) RT-qPCR reaction system

[0071] The primer sequences for detecting inflammatory factors and internal references are shown in Table 3.

[0072] Table 3 RT-qPCR primer sequences

[0073]

[0074] Promega qPCR Master Mix Kit, reaction system and conditions are shown in Table 4.

[0075] Table 4 RT-qPCR reaction system and conditions

[0076]

[0077] (3) Experimental results

[0078] According to the Ct value of the internal reference β-Actin, the relative quantitative formula 2-△△Ct was used to calculate and analyze the fold change of relative expression. The experimental results were analyzed using GraphPad Prism 8 software, and *P<0.05, **P<0.01, ***P<0.001 were considered to be significantly different.

[0079] like Figure 5 As shown, the results showed that the expression level of inflammatory factors in the model group was increased compared with the control group. When LPS-induced RAW264.7 cells were treated with Lonicera exosome-like nanoparticles, the gene expression of inflammatory factors TNF-α, IL-1β, IL-6, and iNOS was significantly reduced, indicating that Lonicera exosome-like nanoparticles can reduce the expression of inflammatory factors in RAW264.7 cells caused by LPS.

[0080] Example 7

[0081] Effects of honeysuckle leaf exosome-like nanoparticles on the secretion of inflammatory factors in RAW264.7 cells treated with LPS

[0082] ELISA technology was used to detect the secretion levels of related inflammatory factors.

[0083] Cell treatment method

[0084] 1. The cells were treated as in Example 5, and then the supernatant of the cell culture fluid of each group was collected. The IL-6 and IL-1β in the supernatant were determined according to the operating instructions of the enzyme-linked immunosorbent assay kit.

[0085] (2) Experimental results

[0086] The experimental results were analyzed using GraphPad Prism 8 software, and the honeysuckle exosome-like nanoparticles group was compared with the model group (*P<0.05, **P<0.01, ***P<0.001).

[0087] The results are as follows Figure 5 As shown in the figure, compared with the control group, the expression level of inflammatory factors in the model group was increased. When LPS-induced RAW264.7 cells were treated with honeysuckle exosome-like nanoparticles, the expression levels of inflammatory factors IL-6 and IL-1β were significantly reduced, indicating that honeysuckle exosome-like nanoparticles can reduce the expression of inflammatory factor proteins in the culture supernatant of RAW264.7 cells caused by LPS. Therefore, honeysuckle exosome-like nanoparticles are safe for cells and have anti-inflammatory effects.

[0088] Example 8

[0089] Anti-inflammatory activity of honeysuckle leaf exosome-like nanoparticles in LPS-induced zebrafish and tail-damaged zebrafish

[0090] Zebrafish have an immune system that is very similar to that of humans. The zebrafish tail amputation inflammation model is a traumatic inflammation model. Amputation of the zebrafish tail can induce local damage to the zebrafish tail and promote immune response in zebrafish immune cells (Belo MAA, Oliveira MF, Oliveira SL, et al. Zebrafish as a model to study inflammation: A tool for drug discovery [J]. Biomedicine & Pharmacotherapy, 2021, 144: 112310-112326.). The zebrafish LPS inflammation model is an inflammation model stimulated by endotoxin. Microinjection of LPS into the yolk sac of zebrafish embryos 2 to 3 days after fertilization can induce an increase in the number of zebrafish immune cells and induce an inflammatory response (Falcao MAP, Dantas MCS, Rios CT, et al. Zebrafish as a tool for studying inflammation: a systematic review [J]. Reviews in Fisheries Science & Aquaculture, 2021: 1-31.). Therefore, the inflammatory response of zebrafish can be evaluated by observing changes in the number of neutrophils.

[0091] Zebrafish culture

[0092] AB wild-type zebrafish were obtained from the Wuhan Zebrafish Resource Center in China. The juvenile fish used in the experiment were bred and hatched in the laboratory. The breeding and reproduction conditions were referred to (The Zebrafishbook) (Westerfield M. The zebrafishbook [M]. Eugene: University of Oregon Press, 1995: 7-196.). Male and female fish were cultured separately. The conductivity of the culture water was 450-550 us / cm, the water temperature was 28°C, natural light was used, and circulating water was used.

[0093] Evaluation of anti-inflammatory activity in LPS-induced zebrafish inflammation model

[0094] Zebrafish incubated at 28°C for 48 hours (hpf) were transferred into a 6-well culture plate. After the residual culture medium was removed, different groups were set up to treat zebrafish at 48 hpf, with 30 to 40 zebrafish in each group randomly.

[0095] (a) Control group: pre-treated with medium containing an equal amount of 1× PBS for 24 h, and then 3-day-old (dpf) zebrafish were cultured for another 6 h;

[0096] (b) Model group: After pretreatment with medium containing an equal amount of 1× PBS for 24 h, 3-day-old (dpf) zebrafish were anesthetized with tricaine, injected with 0.5 mg / ml LPS (2 nL per fish), and then placed back into the 6-well culture plate and cultured for another 6 h;

[0097] (c) Treatment group: Pretreatment with culture medium containing honeysuckle exosome-like nanoparticles (final concentration 200 μg / mL) for 24 h. 3-day-old (dpf) zebrafish were anesthetized with tricaine, injected with 0.5 mg / mL LPS (2 nL per fish), and then returned to the 6-well culture plate for further 6 h; zebrafish in each group were fixed with 4 wt% paraformaldehyde, neutrophils were labeled with Sudan black SB dye, and photographed under a microscope to count the number of neutrophils.

[0098] Evaluation of anti-inflammatory activity in a zebrafish inflammation model induced by mechanical injury

[0099] Zebrafish incubated at 28°C for 48 hours (hpf) were transferred into a 6-well culture plate. After the residual culture medium was removed, different groups were set up to treat zebrafish at 48 hpf, with 30 to 40 zebrafish in each group randomly.

[0100] (a) Control group: pre-treated with medium containing an equal amount of 1× PBS for 24 h, and then 3-day-old (dpf) zebrafish were cultured for another 6 h;

[0101] (b) Model group: pretreated with medium containing an equal amount of 1× PBS for 24 h, 3-day-old (dpf) zebrafish were anesthetized with tricaine, placed on a tail-cutting table, the tail was cut off at the end of the notochord, and then placed back into a 6-well culture plate and cultured for another 6 h;

[0102] (c) Treatment group: After pretreatment with culture medium containing honeysuckle exosome-like nanoparticles (final concentration 200 μg / mL) for 24 h, 3-day-old (dpf) zebrafish were anesthetized with tricaine, placed on a tail-cutting table, the tail was cut off at the end of the notochord, and then placed back into a 6-well culture plate and cultured for another 6 h;

[0103] Zebrafish from each group were collected, fixed with 4 wt % paraformaldehyde, neutrophils were labeled with Sudan black SB dye, the tails were photographed under a microscope, and the number of neutrophils was counted.

[0104] Experimental Results

[0105] The experimental results were analyzed using GraphPad Prism 8 software, and the honeysuckle leaf exosome-like nanoparticle group was compared with the model group (**P<0.01, ***P<0.001). Figure 7As shown in the figure, compared with the control group, the number of zebrafish yolk sac neutrophils in the LPS-induced model group increased significantly, and the treatment with honeysuckle leaf exosome-like nanoparticles significantly reduced the number of zebrafish yolk sac neutrophils induced by LPS; similarly, compared with the control group, the number of zebrafish tail neutrophils in the mechanical injury-induced model group increased significantly, and the treatment with honeysuckle leaf exosome-like nanoparticles significantly reduced the number of zebrafish tail neutrophils induced by mechanical injury. This indicates that honeysuckle leaf exosome-like nanoparticles can reverse the increase in the number of immune cells caused by LPS and tail amputation, indicating that honeysuckle leaf exosome-like nanoparticles have good anti-inflammatory activity.

[0106] Example 9

[0107] Dual luciferase assay to verify the relationship between miR-novel1 and miR-396b-5p targeting STAT3 and JAK1

[0108] (1) Through bioinformatics analysis, miR-novel1 and miR-396b-5p may target and bind to STAT3 and JAK1 gene sequences ( Figure 8 A). The binding sequence of STAT3 and JAK1 and the sequence of about 50 bp upstream and downstream were constructed onto the pMIR-REPORT Luciferase luciferase reporter gene vector. 293T cells were cultured in a 12-well plate at a density of 1.5×105 per well. After 24 hours of attachment, miR-novel1 mimic, miR-396b-5p mimic and NC mimic were co-transfected with STAT3 or JAK1 luciferase reporter gene plasmids using RNATransMate and Lipofectamine 8000, respectively. After 48 hours, the fluorescence activity was identified. The results are shown in Figure 2. Figure 8 As shown in B, compared with NC mimic, the fluorescence expression level of the miR-novel 1 mimic or miR-396b-5p mimic transfection group was significantly reduced, indicating that miR-novel 1 or miR-396b-5p mimi targeted and bound STAT3 and JAK1 genes.

[0109] (2) The cells were treated according to Example 6 and total RNA was extracted for RT-qPCR. The results showed that transfection of miR-novel1 and miR-396b-5p decreased the expression of STAT3 and JAK1 genes in cells ( Figure 8 (C), the above results indicate that miR-novel 1 and miR-396b-5p can silence the expression of STAT3 / JAK1, a key gene in the inflammatory pathway, thereby exerting an anti-inflammatory effect.

[0110] Example 10

[0111] Expression levels of target genes and inflammation-related proteins in the inflammatory pathway. RAW264.7 cells were inoculated in 6-well plates (8×105 cells / well) and cultured for 24 hours. The exosome group was pretreated with different concentrations (100μg / mL, 200μg / mL and 300μg / mL) of honeysuckle exosome-like nanoparticles for 24 hours and LPS was added at a final concentration of 1μg / mL. The blank group did not add LPS but added the corresponding amount of PBS. The transfection group was transfected with NC mimic, miR-novel1mimic, and miR-396b5p mimic using RNATransMate, and finally LPS (final concentration of 1μg / mL) was added for 24 hours. The control group was added with LPS and the corresponding amount of RNATransMate. The blank group was not added with LPS but the corresponding amount of RNATransMate was added. Subsequently, total protein was extracted using RIPA lysis buffer, and protein concentration was quantified using an enhanced BCA protein assay kit. Protein (20-40 μg) was separated by 10wt% SDS-PAGE electrophoresis and transferred to PVDF membrane. After blocking with 5wt% skim milk for 1 hour, the membrane was incubated with primary antibody at 4°C overnight, washed 3 times with TBST, and then exposed to the corresponding secondary antibody at 37°C for 1 hour. The intensity of protein bands was analyzed by imaging with ChemiDoctouch imaging system. The results showed that miR-novel 1 and miR-396b-5p in honeysuckle exosome-like nanovesicles could inhibit the expression of STAT3, p-STAT3, cyclooxygenase-2 (COX-2) and nitric oxide synthase (iNOS) proteins ( Fig. 9 ).

[0112] Through the above experiments, the invention shows that the functional miRNA in the exosome-like nanoparticles derived from honeysuckle leaves can act as an inhibitor of the STAT3 inflammatory pathway to downregulate the expression of inflammatory factors TNF-α, IL-6 and IL-1β, while reducing the expression of pro-inflammatory mediators inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2). It has excellent anti-inflammatory effects on LPS-induced mouse macrophages RAW264.7 and zebrafish tail-breaking and LPS-induced inflammation models, and is expected to be widely used in the treatment of inflammation.

[0113] The basic principles, main features and advantages of the present invention are shown and described above. Without departing from the spirit and scope of the present invention, the present invention may also be subject to various changes and improvements, which all fall within the scope of the present invention to be protected.

Claims

1. Exosome-like nanovesicle functional miRNA from honeysuckle leaves, characterized by: The functional miRNA is miR-novel1 or ath-miR396b-5p, wherein the nucleotide sequence of miR-novel1 is shown as SEQ ID NO.1, and the nucleotide sequence of ath-miR396b-5p is shown as SEQ ID NO.

2.

2. A pharmaceutical composition, characterized in that: The pharmaceutical composition comprises the exosome-like nanovesicle functional miRNA derived from honeysuckle leaves as claimed in claim 1.

3. Use of the honeysuckle leaf-derived exosome-like nanovesicle functional miRNA according to claim 1 or the pharmaceutical composition according to claim 2 in the preparation of drugs for preventing and / or treating inflammation.

4. The use according to claim 3, characterized in that: The drug reduces the expression of pro-inflammatory cytokines by inhibiting the STAT3 signaling pathway.

5. The use according to claim 4, characterized in that: The pro-inflammatory cytokines are one or more of TNF-α, IL-6 or IL-1β.

Images