Use of abi5 gene to enhance photosynthesis in plants

Abstract

The application discloses application of an ABI5 gene in enhancing photosynthesis of plants and relates to the technical field of plant genetic engineering. The biomass is increased, the chlorophyll content is increased, and the net photosynthetic rate is improved in the abi5-8 mutant of AtABI5, so that the growth of plants under low-nitrogen conditions is promoted and the greening rate of cotyledons is improved. Experiments prove that the expression of the photosynthesis-related gene of Arabidopsis ABI5 can be used for enhancing the photosynthesis efficiency.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant genetic engineering, and particularly relates to application of ABI5 gene in enhancing photosynthesis of plants. BACKGROUND

[0002] In recent years, due to climate change, the yield of major crops in the world has stagnated. The current crop yield is not enough to support the world population. Photosynthesis is the material basis for the formation of crop yield, and 90-95% of the dry weight of crops comes from the products of photosynthesis; however, the efficiency of plants in converting light energy into biomass through photosynthesis is not more than 1%, which has a large space for improvement compared with the theoretical efficiency value (4-6%). It is the trend of the times to develop new breeding and genetic engineering strategies to optimize photosynthetic capacity.

[0003] Plant hormones play a crucial role in the development process from organ initiation to senescence. Because they not only act as growth and development regulators, but also play a key role in regulating photosynthesis. Abscisic acid (ABA) is an important stress hormone involved in various physiological processes of the plant life cycle, including photosynthesis. The bZIPs transcription factors of the AREB / ABF / ABI5 (ABA Insensitive 5) subfamily have been shown to be the main transcription factors regulating ABA-mediated gene expression, and ABI5 is a key component thereof. There are few studies on the regulation of photosynthesis by ABI5. Recent studies have found that ABI5 interacts with FLZ13 and inhibits the expression of genes involved in chlorophyll biosynthesis, photosynthesis and cell wall tissue development, thereby regulating seed germination and early development of seedlings. However, how ABI5 regulates the growth and development of plants after germination and photosynthesis is still worth exploring. SUMMARY

[0004] In order to overcome the shortcomings and deficiencies of the prior art, the purpose of the present application is to provide an application of ABI5 gene in enhancing photosynthesis of plants, a method for enhancing photosynthesis of plants by knocking out or knocking down ABI5, and obtaining a new variety of plants with high photosynthetic efficiency.

[0005] The purpose of the present application is achieved by the following technical solutions:

[0006] The present application provides an application of Arabidopsis thaliana ABI5 gene in enhancing photosynthesis of plants.

[0007] Further, the present application provides an application of Arabidopsis thaliana ABI5 gene in improving growth and development of plants.

[0008] Further, the present application provides an application of Arabidopsis thaliana ABI5 gene in improving chlorophyll content and / or net photosynthetic rate of plants.

[0009] Further, the application provides an application of the Arabidopsis ABI5 gene in improving plant growth and development under low nitrogen conditions.

[0010] Further, the application provides an application of the Arabidopsis ABI5 gene in improving plant cotyledon greening rate under low nitrogen conditions.

[0011] Preferably, the low nitrogen condition is 0.05-1 mM nitrogen source; more preferably, 0.05 mM nitrogen source.

[0012] Preferably, the nitrogen source is nitrate.

[0013] Preferably, the nitrate is at least one of potassium nitrate and calcium nitrate.

[0014] Further, the application provides an application of the Arabidopsis ABI5 gene in plant breeding.

[0015] Further, the application provides an application of the Arabidopsis ABI5 gene in plant breeding.

[0016] The plant includes but is not limited to Arabidopsis, rice, wheat, corn, sorghum, millet, sugarcane, cotton, tomato, alfalfa and elephant grass.

[0017] The Arabidopsis ABI5 gene encodes an amino acid sequence as shown in GenBank No. NP_565840.1.

[0018] The Arabidopsis ABI5 gene has one of the following nucleotide sequences:

[0019] 1) the DNA sequence shown in GenBank No. NM_129185.4;

[0020] 2) the DNA sequence shown in GenBank No. NM_129185.4 from 230 bp to 1558 bp;

[0021] 3) the DNA sequence encoding the protein shown in GenBank No. NP_565840.1.

[0022] The above application is achieved by knocking out or knocking down the Arabidopsis ABI5 gene.

[0023] The knocking out or knocking down is achieved by RNA interference technology or genome editing technology.

[0024] A method for plant breeding, comprising the following steps: obtaining a plant by knocking out or knocking down an ABI5 gene of the plant; the biomass, chlorophyll content and / or net photosynthetic rate of the plant are significantly improved compared with wild plants; the cotyledon greening rate of the plant under low nitrogen conditions is significantly improved.

[0025] A method for enhancing photosynthesis of a plant, comprising the following steps: enhancing photosynthesis of a plant by knocking out or knocking down an ABI5 gene of the plant.

[0026] The method for enhancing photosynthesis of a plant comprises improving chlorophyll content and / or net photosynthetic rate of the plant.

[0027] The present application has the following advantages and effects relative to the prior art:

[0028] The biomass, chlorophyll content and net photosynthetic rate of the AtABI5 mutant abi5-8 in the present application are increased, which promotes the growth of the plant under low nitrogen conditions and improves the cotyledon greening rate. Experiments prove that the expression of the photosynthesis-related gene regulated by Arabidopsis ABI5 can be used to enhance photosynthetic efficiency. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 ABI5 mutation promotes plant growth; wherein A: Col-0 and abi5-8 phenotypes; B: biomass analysis graph; C: chlorophyll content analysis graph; D: net photosynthetic rate graph.

[0030] Figure 2 ABI5 mutation promotes the growth of the plant under low nitrogen conditions; wherein A: growth phenotypes of Col-0 and abi5-8 on high nitrogen and low nitrogen 1 / 2MS medium; B: cotyledon greening rate analysis graph.

[0031] Figure 3 ABI5 inhibits the expression of photosynthesis-related genes; A: Y1H experiment verifies that ABI5 binds to the promoters of RCA, RBCS2B and RBCS3B; B: EMSA experiment verifies that ABI5 binds to the promoters of RCA, RBCS2B and RBCS3B; C: construction schematic diagram of expression vector of the promoters of ABI5, RCA, RBCS2B or RBCS3B; D: ABI5 inhibits transcription of RCA, RBCS2B and RBCS3B.

[0032] Figure 4 Gene expression levels of ABI5, RCA, RBCS2B and RBCS3B. DETAILED DESCRIPTION

[0033] The application will be described in further detail below with reference to the following Examples and accompanying drawings; however, the embodiments of the present application are not limited thereto. The test methods in the following examples, unless otherwise specified, were generally in accordance with conventional test methods or as suggested by the manufacturer. The materials, reagents and the like used were obtained from commercial sources unless otherwise specified.

[0034] Wild type Arabidopsis Columbia (Col-0) and abi5-8 (T-DNA insertion mutant, SALK_013163) were purchased from Arabidopsis Biological Resource Center (http: / / www.arabidopsis.org / ).

[0035] Example 1: Biomass, chlorophyll content and net photosynthetic rate determination

[0036] (1) Cultivation of Arabidopsis: Wild type Arabidopsis plants (Col-0) and Arabidopsis ABI5 mutant abi5-8 were used as the operation objects. The seeds of the above plants were treated at 4°C for 1 day, then sowed on 1 / 2MS medium plates after sterilization. The cultivation conditions were as follows: temperature 22°C, humidity 60%, light / dark cycle 14h / 10h, light intensity 100 μmol / m2s. After 7 days of cultivation, the plants were transferred to pots filled with nutrient soil, and then grown for another 14 days to obtain Arabidopsis plants grown for 21 days in total; which were used for analyzing the application of ABI5 gene in Arabidopsis or other economic crops in growth and development, chlorophyll content regulation and net photosynthetic rate. 2

[0037] (2) Biomass determination: The aerial parts of the Arabidopsis plants grown for 21 days in step (1) were taken, 4 plants per repeat, 3 biological repeats were set for fresh weight determination.

[0038] It was found that the biomass of Arabidopsis ABI5 mutant abi5-8 was significantly increased compared with wild type Col-0 (A and B in Figure 1), which indicated that ABI5 mutation promoted plant growth. Figure 1

[0039] (3) Chlorophyll content determination: About 0.5g of leaves of the Arabidopsis plants grown for 21 days in step (1) (2 leaves per plant, about 0.5g from 20-25 plants as 1 biological repeat) were taken and put into 15 mL centrifuge tubes, 8 biological repeats were set; then 15 mL of 95% ethanol solution was added, and the tubes were dark-treated at 4°C for 24-48h. After the leaves were almost colorless, the spectrophotometer was used to determine the OD665 and OD649 (Figure 2). 665 649 ​​​) at 665 nm, 649 nm, 645 nm, 630 nm, 620 nm, 560 nm, 480 nm, 430 nm, 410 nm, 380 nm, 350 nm, 330 nm, 320 nm, 310 nm, 300 nm, 290 nm, 280 nm, 270 nm, 260 nm, 250 nm, 240 nm, 230 nm, 220 nm, 210 nm, 200 nm, 190 nm, 180 nm, 170 nm, 160 nm, 150 nm, 140 nm, 130 nm, 120 nm, 110 nm, 100 nm, 90 nm, 80 nm, 70 nm, 60 nm, 50 nm, 40 nm, 30 nm, 20 nm, 10 nm, 0 nm, and 5 nm, respectively. The absorbance values were measured using a spectrophotometer (UV-1800, Shimadzu, Japan) with 95% ethanol as a blank control. The contents of chlorophyll a (Chl a) and chlorophyll b (Chl b) were calculated according to the formula (Brain and Solomon, 2007; Jiang et al., 2012). The chlorophyll content (Chlorophyll content) was equal to the content of Chl a plus the content of Chl b. The chlorophyll content was compared after being standardized using the fresh weight of Arabidopsis thaliana. The calculation formula is as follows:

[0040] Chl a (mg / L) = 13.95 x OD 665 - 6.88 x OD 649 ;

[0041] Chl b (mg / L) = 24.96 x OD 649 - 7.32 x OD 665 ;

[0042] It was found that the chlorophyll content of Arabidopsis ABI5 mutant abi5-8 was significantly increased compared with wild type Col-0 (A in the figure), Figure 1 which may improve the efficiency of photosynthesis. Therefore, the net photosynthetic rate was detected next.

[0043] (4) Net photosynthetic rate determination: The net photosynthetic rate of Arabidopsis plants grown for 21 days in step (1) was determined using a portable photosynthesis measurement system (LI-6800). The light quantum flux density of the built-in light source in the instrument leaf chamber was 1000 μmol / m 2 / s, the CO2 concentration was 400 ppm, and the temperature was controlled at the growth temperature of the plants, 22℃. Each plant was a repeat, and one piece of the most vigorous leaf was determined for each plant, with 5 biological repeats.

[0044] The experimental results show that the net photosynthetic rate of Arabidopsis ABI5 mutant abi5-8 is significantly improved compared with wild type Col-0 (D in the figure). Figure 1

[0045] Example 2: High and low nitrogen culture experiment

[0046] The seeds of wild type Arabidopsis plants (Col-0) and Arabidopsis ABI5 mutant abi5-8 were vernalized in a refrigerator at 4℃ for 1 day, then inoculated on 1 / 2MS medium plates containing 10 mM (high nitrogen) and 0.05 mM (low nitrogen) KNO3, respectively, and then placed in an artificial climate incubator for culture. The culture conditions were: temperature 22℃, humidity 60%, light / dark cycle 14h / 10h, light intensity 100 μmol / m 2 / s. The phenotype was observed and photographed after 6 days, and the cotyledon greening rate was calculated (the number of plants counted was not less than 100, with 3 biological repeats).​

[0047] The results show that the Arabidopsis ABI5 mutant abi5-8 promotes the growth of plants under low nitrogen conditions (A), and the cotyledon greening rate of the ABI5 mutant abi5-8 is significantly higher than that of the wild type Col-0 (B). Figure 2 Figure 2

[0048] Example 3: Yeast one-hybrid experiment (Y1H)

[0049] 1. Amplification of the ABI5 coding region: The cDNA of the wild type Col-0 was used as a template, and the primer ABI5-pJG4-5-F / R was used for PCR amplification to obtain the target fragment 1. The mRNA sequence of the ABI5 gene is shown in GenBank No. NM_129185.4, the CDS sequence is shown in GenBank No. NM_129185.4 from 230bp to 1558bp, and the amino acid sequence encoded by the ABI5 gene is shown in GenBank No. NP_565840.1.

[0050] The primer sequences are as follows (5'-3'): the underlined part is the enzyme digestion site sequence;

[0051] ABI5-pJG4-5-F: TGCCTCTCCC GAATTC ATGGTAACTAGAGAAACGAAG;

[0052] ABI5-pJG4-5-R: TCCAAAGCTT CTCGAG GAGTGGACAACTCGGGTTCCTC;

[0053] The PCR reaction system is shown in Table 1:

[0054] Table 1 PCR reaction system

[0055] Components Amount 2x Primer Mix 25 μL ABI5-pJG4-5-F (10 μM) 2.5 μL ABI5-pJG4-5-R (10 μM) 2.5 μL cDNA 2 μL ddH2O Up to 50 μL

[0056] PCR amplification program: 98℃ for 10s; 98℃ for 10s, 55℃ for 5s, 72℃ for 1min / kb (26 cycles); 72℃ for 5min; 4℃ for storage.

[0057] PCR product recovery: The PCR product was run on a 1% agarose gel, and the gel was recovered by cutting, and the specific method was performed according to the DNA recovery kit of Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0058] Note: 2x Primer Mix is purchased from Nanjing Novizen Biological Technology Co., Ltd.

[0059] ​​2. Linearized pJG4-5 vector by double digestion

[0060] The enzyme digestion system is shown in Table 2:

[0061] Table 2. Enzyme digestion system

[0062] Components Amount 10x Buffer 3 μL Enzyme 1 (EcoR I) 1 μL Enzyme 2 (Xho I) 1 μL pJG4-5 vector 1 μg ddH2O Up to 30 μL

[0063] The enzyme digestion condition is 37°C for 4h.

[0064] Recovery of the enzyme digestion product: After the enzyme digestion, 3μL 10×Loading Buffer was added into the enzyme digestion product and mixed. The electrophoresis was performed by using 1% agarose gel, and the gel was cut and recovered. The recovery step was performed according to the instruction of DNA purification and recovery kit of Tian Gen Biochemical Technology (Beijing) Co., Ltd.

[0065] Note: The restriction enzymes were purchased from Takara Co.

[0066] 3. Amplification of RCA, RBCS2B and RBCS3B promoter sequences: The gDNA of wild type Col-0 was used as the template, and the primer F and primer R were used to amplify RCA, RBCS2B and RBCS3B promoter, which corresponded to the target fragment 2, target fragment 3 and target fragment 4, respectively. The target fragment 2 contained the sequence shown in the 15879bp-17804bp of GenBank No. AC003000.3, the target fragment 3 contained the sequence shown in the 55111bp-57203bp of GenBank No. AB005248.1, and the target fragment 4 contained the sequence shown in the 51439bp-53438bp of GenBank No. AB005248.1.

[0067] The primer sequences are as follows (5'-3'): the underlined part is the restriction site sequence;

[0068] pRCA-pLacZi-F: TATTGGATCG GAATTC GCAATGGTAACCTCAACTC;

[0069] pRCA-pLacZi-R: GAGCACATGC CTCGAG ATCTCAAGACTGCGACGAG;

[0070] pRBCS2B-pLacZi-F: TATTGGATCG GAATTC CATTTCGCACTTGAAAGCAT;

[0071] pRBCS2B-pLacZi-R: GAGCACATGC CTCGAGTACTTCTTCTTGTTGTTTCTC;

[0072] pRBCS3B-pLacZi-F: TATTGGATCG GAATTC TTTGGCTTCAATTAAAATCC;

[0073] pRBCS3B-pLacZi-R: GAGCACATGC CTCGAG TACTACTTCTTGTTGTTTCTC;

[0074] PCR reaction system as shown in Table 3:

[0075] Table 3 PCR reaction system

[0076] Components Amount 2x Primer Mix 25 μL Primer F (10 μM) 2.5 μL Primer R (10 μM) 2.5 μL gDNA 2 μL ddH2O Up to 50 μL

[0077] PCR amplification procedure: 98℃ 10s; 98℃ 10s, 55℃ 5s, 72℃ 1 min / kb (26 cycles); 72℃ 5 min; 4℃ preservation.

[0078] PCR product recovery: PCR product runs 1% agarose gel, cut gel recovery.

[0079] 4, double enzyme linearization pLacZi vector

[0080] Enzyme reaction system as shown in Table 4:

[0081] Table 4 Enzyme reaction system

[0082] Components Amount 10x Buffer 3 μL Enzyme 1 (EcoR I) 1 μL Enzyme 2 (Xho I) 1 μL pLacZi vector 1 μg ddH2O Up to 30 μL

[0083] Enzyme cutting condition: 37℃, enzyme cutting 4h.

[0084] Enzyme product recovery: After enzyme cutting, 3μL 10×Loading Buffer was added to the enzyme cutting product, mixed. 1% agarose gel electrophoresis was carried out, and the gel was cut and recovered. The recovery step was carried out according to the instruction of DNA purification and recovery kit of Tian Gen Biochemical Technology (Beijing) Co., Ltd.

[0085] 5, homologous recombination to construct vector

[0086] The target fragment 1 was homologously recombined with the linearized pJG4-5 vector, and the target fragment 2 / 3 / 4 was homologously recombined with the linearized pLacZi vector. The homologous recombination reaction system is shown in Table 5.

[0087] Table 5 Homologous recombination reaction system

[0088]

[0089]

[0090] Note: Optimal vector usage X = [0.02 × number of cloning vector base pairs] ng;

[0091] The optimal fragment usage amount Y = [0.04 × number of base pairs inserted] ng.

[0092] Recombination reaction conditions: 37℃, 30 min, then on ice for 5 min. Store at -20℃.

[0093] Note: The recombinase Exnase∥ kit was purchased from Nanjing Novizan Biotechnology Co., Ltd.; the pJG4-5 and pLacZi vectors were purchased from Beijing Coolplay Technology Co., Ltd.

[0094] 6. Transformation: The ligation product was added to E. coli DH5α competent cells (purchased from Sangon Biotech (Shanghai) Co., Ltd.), gently mixed, and then incubated on ice for 30 min, followed by heat shock at 42℃ for 60 s, and then incubated on ice again for 5 min. 1 mL of antibiotic-free LB liquid was added, and the cells were cultured at 37℃ and 200 rpm for 1 h. 200 μL of the culture was then plated on an ampicillin (Amp) resistant (50 μg / mL) LB plate and cultured overnight at 37℃.

[0095] 7. Colony PCR Detection: Select single colonies for colony PCR detection to exclude false positive recombinants. Send correctly detected single colonies to a biotechnology company for sequencing. Correct sequencing indicates successful construction of the recombinant vector.

[0096] 8. Plasmid Extraction: The successfully constructed plasmids were extracted using the plasmid mini-prep kit from Tiangen Biotech (Beijing) Co., Ltd. They were designated as pJG4-5-ABI5 plasmid, pLacZi-pRCA plasmid, pLacZi-pRBCS2B plasmid, and pLacZi-pRBCS3B plasmid, respectively.

[0097] 9. Transformation of Saccharomyces cerevisiae strain EGY48: Transform EGY48 competent cells with 1 μL of pJG4-5-ABI5 / pJG4-5 plasmid and 1 μL of pLacZi-pRCA / pLacZi-pRBCS2B / pLacZi-pRBCS3B / pLacZi plasmid (concentration approximately 500 ng / μL) along with 5 μL of carrier DNA (salmon sperm DNA); plate the cells on SD / -Trp / -Ura solid medium and incubate at 30°C upside down for 3 days; take several single colonies and expand them on SD / -Trp / -Ura solid medium; incubate on SD / -Trp / -Ura+X-gal solid medium containing 20 mg / mL X-gal for 1–3 days, and observe and record the color development. The experimental group consisted of pJG4-5-ABI5 plasmid and pLacZi-pRCA / pLacZi-pRBCS2B / pLacZi-pRBCS3B plasmid; the control group consisted of pJG4-5-ABI5 plasmid and pZacZi plasmid, pJG4-5 plasmid and pLacZi-pRCA / pLacZi-pRBCS2B / pLacZi-pRBCS3B / pLacZi plasmid.

[0098] To investigate how ABI5 regulates plant photosynthesis and growth, a yeast one-hybrid assay was used to screen for ABI5 target genes. The experiment revealed that yeast co-transfected with pJG4-5-ABI5 and pLacZi-pRCA, pLacZi-pRBCS2B, or pLacZi-pRBCS3B showed a blue color (…). Figure 3 The A in the figure indicates that ABI5 can bind to the promoter regions of key carbon assimilation genes RCA, RBCS2B, and RBCS3B.

[0099] Example 4: EMSA Experiment

[0100] 1. Constructing the ABI5-His vector

[0101] (1) Amplification of the ABI5 coding region: Using wild-type Col-0 cDNA as a template, PCR amplification was performed using primers ABI5-His-F / R to obtain the target fragment 5.

[0102] The primer sequences are as follows (5′-3′): the underlined parts are the restriction enzyme sites;

[0103] ABI5-His-F: CCG GAATTC ATGGTAACTAGAGAAACGAAGTTGACGT;

[0104] ABI5-His-R: CCC AAGCTT GAGTGGACAACTCGGGTTCCT;

[0105] The PCR reaction system is shown in Table 6:

[0106] Table 6 PCR reaction system

[0107] Components Amount 2x Primer Mix 25 μL ABI5-His-F (10 μM) 2.5 μL ABI5-His-R (10 μM) 2.5 μL cDNA 2 μL ddH2O Up to 50 μL

[0108] PCR amplification program: 98℃ for 10s; 98℃ for 10s, 55℃ for 5s, 72℃ for 1min / kb (26 cycles); 72℃ for 5min; store at 4℃.

[0109] PCR product recovery: PCR products were run on 1% agarose gel and recovered by gel cutting.

[0110] (2) Double enzyme digestion of linearized pET-28a(+) vector

[0111] The enzyme digestion reaction system is shown in Table 7:

[0112] Table 7 Enzyme digestion reaction system

[0113] Components Amount 10x Buffer 3 μL Enzyme 1 (EcoR I) 1 μL Enzyme 2 (Hind III) 1 μL pET-28a(+) vector 1 μg ddH2O Up to 30 μL

[0114] Enzyme digestion conditions: 37℃, digestion for 4 hours.

[0115] Recovery of enzyme digestion products: After enzyme digestion, add 3 μL of 10× Loading Buffer to the digestion products and mix well. Perform electrophoresis on a 1% agarose gel, and then recover the product by gel cutting. The recovery procedure is performed according to the instructions of the DNA purification and recovery kit from Tiangen Biotech (Beijing) Co., Ltd.

[0116] (3) Homologous recombination of target fragment 5 with linearized pET-28a(+) vector was carried out. The homologous recombination reaction system is shown in Table 5. Recombination reaction conditions: 37℃, 30min, placed on ice for 5min. Stored at -20℃.

[0117] (4) Transformation of DH5α strain: The ligation product was added to Escherichia coli DH5α competent cells (purchased from Sangon Biotech (Shanghai) Co., Ltd.), mixed gently, and then placed on ice for 30 min, followed by heat shock at 42℃ for 60 s, and then placed on ice again for 5 min. 1 mL of antibiotic-free LB liquid was added, and the cells were cultured at 37℃ and 200 rpm for 1 h. 200 μL of the culture was then plated on a kanamycin (Kan) resistant (50 μg / mL) LB plate and cultured at 37℃ overnight.

[0118] (5) Colony PCR detection: Single colonies were selected for colony PCR detection to exclude false positive recombinants. The correctly detected single colonies were sent to a biotechnology company for sequencing. Correct sequencing indicates successful construction of the recombinant vector. This was designated as the pET28a-ABI5-His plasmid.

[0119] (6) Transformation of Rosetta (DE3) strain: The plasmid successfully constructed above was added to Rosetta (DE3) competent cells (purchased from Sangon Biotech (Shanghai) Co., Ltd.), mixed gently, and then placed on ice for 30 min, heat-shocked at 42℃ for 60 s, and placed on ice again for 5 min. 1 mL of antibiotic-free LB liquid was added, and the cells were cultured at 37℃ and 200 rpm for 1 h. 200 μL of the culture was then plated on a kanamycin (Kan) resistant (50 μg / mL) LB plate and cultured at 37℃ overnight.

[0120] (7) Colony PCR detection: Single colonies were selected for colony PCR detection to exclude false positive recombinants. Recombinant strain Rosetta(DE3) / pET28a-ABI5-His was obtained.

[0121] 2. Purification of ABI5-His protein

[0122] After activating a small amount of recombinant Rosetta(DE3) / pET28a-ABI5-His, it was inoculated into 100 mL of LB liquid medium at a volume ratio of 1:1000 and cultured on a shaker at 37°C until the concentration approached OD. 600 The concentration should be 0.4–0.6. After that, transfer to 4°C for 30 min to adapt, add IPTG to make the working concentration 1 mM and transfer to 16°C to shake in a shaker at 120 rpm for about 20 hours. After enriching the bacterial cells, perform protein purification.

[0123] The bacterial cells were suspended in Lysis Buffer and sonicated until clear. They were then centrifuged at 6000 rpm and 4°C for 30 min and filtered through a 0.45 μm pore size filter into a Ni column. After all the crude protein solution was filtered through the column, the column was equilibrated with Wash Buffer. The bound protein was eluted with Elution Buffer. The eluted protein was further purified by ultrafiltration through a 30 kDa pore size tube until it was concentrated to a protein concentration of not less than 1 μg / μL.

[0124] The protein purification method was based on the instructions for His-tagged protein agarose high-speed purification resin from Yisheng Biotechnology (Shanghai) Co., Ltd.

[0125] 3. Gel preparation and electrophoresis

[0126] (1) Prepare the Native adhesive according to Table 8. After adding TEMED, mix well immediately and then immediately pour it into the adhesive mold. Avoid generating air bubbles and add comb teeth.

[0127] Table 8. Native gel system (50 mL)

[0128] Reagent Amount 5x TBE 5 mL 30% AB 10 mL 50% Glycerol 50 μL 10% AP 200 μL TEMED 50 μL SDW Supplemented to 50 mL

[0129] (2) Electrophoresis at 100V for 30-40 min in pre-cooled 0.5×TBE buffer until bromophenol blue migrates to 2 / 3 or 3 / 4 of the bottom of the gel and then stop the pre-electrophoresis.

[0130] (3) Mix the sample and electrophoresis buffer, and spot the sample for electrophoresis.

[0131] (4) Place the electrophoresis tank on ice or in a 4°C environment and perform electrophoresis at a constant voltage of 100V until the buffer indicator band is 2-3 cm away from the bottom of the gel.

[0132] 4. Biotin-labeled probes

[0133] The probe primers were synthesized at the biotechnology company, and their sequences are as follows (5′-3′):

[0134] pRCAProbe-F: TCATAAACATATTCCACGTGGACCAATCAAAATAG;

[0135] pRCAProbe-R: CTATTTTGATTGGTCCACGTGGAATATGTTTATGA;

[0136] pRBCS2B Probe-F:ATGGAGTTTTTCTGCCACGTGATCTTATCCTAGTGG;

[0137] pRBCS2B Probe-R: CCACTAGGATAAGATCACGTGGCAGAAAACTCCAT;

[0138] pRBCS3B Probe-F:ATGGAGTTTTTCTGCCACGTGGCCTTATCCTAGTGG;

[0139] pRBCS3B Probe-R: CCACTAGGATAAGGCCACGTGGCAGAAAACTCCAT.

[0140] Dilute one end of the probe primer (either the sense or antisense strand) to a concentration of 1 μM. Set up the reaction system according to Table 9 and gently mix with a pipette. React at 37°C for 1 hour. Add 1.25 μL of probe-labeled stop solution and gently mix to terminate the reaction.

[0141] Table 9 Probe Labeling Reaction System

[0142] Ultrapure water 14.5 μL TdT Buffer (5x) 5 μL Probe to be labeled (1 μM) 2.5 μL Biotin-11-dUTP (5 μM) 2.5 μL TdT (10 U / μL) 0.5 μL Total volume 25 μL

[0143] Removal of TdT: After the probe labeling reaction is terminated, add 26.25 μL of chloroform:isoamyl alcohol (24:1), vortex to fully mix the organic phase and aqueous phase to extract TdT, centrifuge at 12000-14000g for 1-2 min, and the supernatant is then labeled with biotin-labeled single-stranded DNA probe. Collect the supernatant for later use.

[0144] Preparation of biotin-labeled EMSA probes: Mix the above-labeled single-stranded DNA probe with an equal volume of its sense or antisense strand; add annealing buffer and mix well; perform the annealing reaction according to the PCR program set in Table 10; after the annealing reaction is completed, dilute the probe 6 times with sterile ultrapure water.

[0145] Table 10 Probe Labeling Reaction Procedure

[0146] Temperature Time 95℃ 2 min Drop 0.1 °C every 8 s, drop to 25 °C About 90 min 4℃ ∞

[0147] 5. Formation of protein-probe complex: According to the EMSA reaction system in Table 11, add the corresponding components and mix them evenly. After reacting at room temperature for 20 min, add 1 μL of DNA loading buffer.

[0148] Table 11 EMSA Reaction System

[0149] Reagent Amount SDW 4 μL 10x binding buffer 1 μL 50% Glycerol 0.5 μL 100 mM MgCl2 0.5 μL 1 μg / μL Poly(dI-dC) 0.5 μL 1% NP-40 0.5 μL Protein 2 μL Biotin-Probe 1 μL Total system 10 μL

[0150] 6. Transfer membrane

[0151] (1) Soak the gel, membrane, filter paper and fiber pad in pre-cooled 0.5×TBE.

[0152] (2) Assemble the “sandwich” in the following order: fiber pad, filter paper, gel, membrane, filter paper, fiber pad. Note the electrodes, ensuring that the gel is at the cathode and the membrane is at the anode.

[0153] (3) Transfer the film in pre-cooled 0.5×TBE. The transfer device should be placed on ice or in a low-temperature room and transferred at a constant voltage of 100V for 35 minutes.

[0154] 7. Testing

[0155] (1) After the transfer is complete, carefully remove the nylon membrane with the sample side facing up and place it on a dry filter paper. Gently absorb the obvious liquid on the lower surface. Crosslink the membrane twice using a UV crosslinker.

[0156] (2) After adding the blocking solution, shake gently and seal at room temperature for 20 minutes.

[0157] (3) Add an appropriate amount of HRP-labeled streptavidin (HRP conjugate) and incubate at room temperature with shaking for 45 min.

[0158] (4) Remove the enzyme diluent and wash the membrane three times with washing buffer, gently shaking for 10 minutes at room temperature each time.

[0159] (5) Prepare the reaction substrate, add it evenly to the membrane, and incubate at room temperature for 5 min.

[0160] (6) Chemiluminescence imaging system exposure imaging.

[0161] Note: The EMSA / Gel-Shift kit was purchased from Shanghai Beyotime Biotechnology Co., Ltd.

[0162] EMSA results showed that the complex bound to the ABI5-His protein was electrophoretically slower than the probe without protein binding. Figure 3 (B) further illustrates the regions of ABI5 that bind to the RCA, RBCS2B and RBCS3B promoters containing the ACGTG motif.

[0163] Example 5: Dual-luciferase experiment

[0164] 1. Amplification of the ABI5 coding region: Using pJG4-5-ABI5 plasmid as a template, PCR amplification was performed using primers ABI5-62SK-F / R to obtain the target fragment 6.

[0165] The primer sequences are as follows (5′-3′): the underlined parts are the restriction enzyme sites;

[0166] ABI5-62SK-F:GGCCGCTCTAGAACTAGT GGATCC ATGGTAACTAGAGAAACGAAG;

[0167] ABI5-62SK-R:

[0168] ATCGATAAGCTTGATATC GAATTC GAGTGGACAACTCGGGTTCCTC;

[0169] The PCR reaction system is shown in Table 12:

[0170] Table 12 PCR reaction system

[0171] Components Amount 2x Primer Mix 25 μL ABI5-62SK-F (10 μM) 2.5 μL ABI5-62SK-R (10 μM) 2.5 μL pJG4-5-ABI5 2 μL ddH2O Up to 50 μL

[0172] PCR amplification program: 98℃ for 10s; 98℃ for 10s, 55℃ for 5s, 72℃ for 1min / kb (26 cycles); 72℃ for 5min; store at 4℃.

[0173] PCR product recovery: Run PCR products on a 1% agarose gel, cut the gel and recover the products. The specific method is to refer to the DNA recovery kit of Tiangen Biotech (Beijing) Co., Ltd.

[0174] 2. Double enzyme digestion of linearized pGreenII 62-SK vector

[0175] The enzyme digestion reaction system is shown in Table 13:

[0176] Table 13 Enzyme digestion reaction system

[0177] Components Amount 10x Buffer 3 μL Enzyme 1 (BamH I) 1 μL Enzyme 2 (EcoR I) 1 μL pGreenII 62-SK vector 1 μg ddH2O Up to 30 μL

[0178] Enzyme digestion conditions: 37℃, digestion for 4 hours.

[0179] Recovery of enzyme digestion products: After enzyme digestion, add 3 μL of 10× Loading Buffer to the digestion products and mix well. Perform electrophoresis on a 1% agarose gel, and then recover the product by gel cutting. The recovery procedure is performed according to the instructions of the DNA purification and recovery kit from Tiangen Biotech (Beijing) Co., Ltd.

[0180] 3. Amplify the RCA, RBCS2B and RBCS3B promoter sequences: Using pLacZi-pRCA, pLacZi-pRBCS2B or pLacZi-pRBCS3B plasmids as templates, amplify the RCA, RBCS2B and RBCS3B promoters with primers F and R, which correspond to target fragments 7, 8 and 9, respectively.

[0181] The primer sequences are as follows (5′-3′): the underlined parts are the restriction enzyme sites;

[0182] pRCA-pGreenII 0800-F:CGGTATCGAT AAGCTT GCAATGGTAACCTCAACTC;

[0183] pRCA-pGreenII 0800-R:TAGAACTAGT GGATCC ATCTCAAGACTGCGACGAG;

[0184] pRBCS2B-pGreenII 0800-F:CGGTATCGAT AAGCTT CATTTCGCACTTGAAAGCAT;

[0185] pRBCS2B-pGreenII 0800-R:TAGAACTAGT GGATCC TACTTCTTCTTGTTGTTTCTC;

[0186] pRBCS3B-pGreenII 0800-F:CGGTATCGAT AAGCTT TTTGGCTTCAATTAAAATCC;

[0187] pRBCS3B-pGreenII 0800-R:TAGAACTAGT GGATCC TACTACTTCTTGTTGTTTCTC;

[0188] The PCR reaction system is shown in Table 14:

[0189] Table 14 PCR Reaction System

[0190] Component Amount 2 x Primer Mix 25 μL Primer F (10 μM) 2.5 μL Primer R (10 μM) 2.5 μL pLacZi-pRCA / pRBCS2B / pRBCS3B 2 μL ddH2O Up to 50 μL

[0191] PCR amplification program: 98℃ for 10s; 98℃ for 10s, 55℃ for 5s, 72℃ for 1min / kb (26 cycles); 72℃ for 5min; store at 4℃.

[0192] PCR product recovery: PCR products were run on 1% agarose gel and recovered by gel cutting.

[0193] 4. Double enzyme digestion to linearize the pGreenII 0800-LUC vector

[0194] The enzyme digestion reaction system is shown in Table 15:

[0195] Table 15 Enzyme digestion reaction system

[0196] Component Amount 10 x Buffer 3 μL Enzyme 1 (Hind III) 1 μL Enzyme 2 (BamH I) 1 μL pGreenII 0800-LUC vector 1 μg ddH2O Up to 30 μL

[0197] Enzyme digestion conditions: 37℃, digestion for 4 hours.

[0198] Recovery of enzyme digestion products: After enzyme digestion, add 3 μL of 10× Loading Buffer to the digestion products and mix well. Perform electrophoresis on a 1% agarose gel, and then recover the product by gel cutting. The recovery procedure is performed according to the instructions of the DNA purification and recovery kit from Tiangen Biotech (Beijing) Co., Ltd.

[0199] 5. Homologous recombination to construct corresponding carriers

[0200] Target fragment 6 was homologously recombinated with the linearized pGreenII 62-SK vector, and target fragments 7 / 8 / 9 were homologously recombinated with the linearized pGreenII 0800-LUC vector. The homologous recombination reaction system is shown in Table 5; the schematic diagram of the construction of the recombination vector is shown in the figure. Figure 3 As shown in C.

[0201] Recombination reaction conditions: 37℃, 30 min, then on ice for 5 min. Store at -20℃.

[0202] 6. Transformation: Add the ligation product to E. coli DH5α competent cells, mix gently, incubate on ice for 30 min, heat shock at 42℃ for 60 s, incubate on ice again for 5 min, add 1 mL of antibiotic-free LB liquid, incubate at 37℃ and 200 rpm for 1 h, take 200 μL and plate it on a kanamycin (Kan) resistant (50 μg / mL) LB plate, and incubate at 37℃ overnight.

[0203] 7. Colony PCR Detection: Select single colonies for colony PCR detection to exclude false positive recombinants. Send correctly detected single colonies to a biotechnology company for sequencing. Correct sequencing indicates successful construction of the recombinant vector.

[0204] 8. Plasmid Extraction: The successfully constructed plasmids were extracted using the plasmid mini-prep kit from Tiangen Biotech (Beijing) Co., Ltd. They were designated as pGreenII 62-SK-ABI5 plasmid, pGreenII 0800-pRCA plasmid, pGreenII 0800-pRBCS2B plasmid, and pGreenII 0800-pRBCS3B plasmid, respectively.

[0205] 9. Agrobacterium transformation: Add 1 μg of recombinant plasmid to Agrobacterium EHA105 (pSoup) competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), mix gently, incubate on ice for 30 min, flash freeze in liquid nitrogen for 5 min, incubate in water at 37℃ for 2 min, add 500 μL of antibiotic-free LB medium, and incubate at 28℃ on a shaker at 100 rpm for 3 h; plate on LB agar plates containing rifampicin (50 μg / mL), gentamicin (50 μg / mL), and kanamycin resistance (50 μg / mL), and incubate at 28℃ for 2 days.

[0206] 10. Tobacco Injection: Streak the bacteria on LB agar plates containing rifampin (50 μg / mL), gentamicin (50 μg / mL), and kanamycin resistance (50 μg / mL) and incubate for 2 days; pick a single colony and gently shake overnight; centrifuge to enrich the bacterial cells, wash the cells 3 times with sterile water; resuspend the bacterial cells in infection buffer (10 mM MgCl2, 10 mM MES, 150 μM acetylsylcholine) to OD200. 600 The bacterial culture concentration was 0.8–1.0, and the culture was carried out in the dark at 28°C for 3 hours. The experimental group consisted of pGreenII 62-SK-ABI5 and pGreenII 0800-pRCA, pGreenII 0800-pRBCS2B or pGreenII 0800-pRBCS3B, and the control group consisted of pGreenII 62-SK and pGreenII 0800-pRCA, pGreenII 0800-pRBCS2B or pGreenII 0800-pRBCS3B. The bacterial culture was mixed at a ratio of 1:1 and injected into tobacco leaves. The culture was carried out for 36–48 hours.

[0207] 11. LUC / REN value detection: The injected tobacco was punched into leaf discs and transferred to a grinding tube. 100 μL of cell lysis buffer was added, and the mixture was ground into a homogenate at 4°C. The homogenate was centrifuged at 12,000 rpm for 10 min at 4°C. 20 μL of the supernatant was transferred to a white 96-well microplate. 100 μL of firefly luciferase reaction solution was added, and the LUC fluorescence value at approximately 560 nm was detected. Then, 100 μL of Renilla luciferase reaction solution was added, and the REN fluorescence value at approximately 480 nm was detected. The LUC / REN value was analyzed.

[0208] Note: The dual-luciferase kit was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.

[0209] Tests showed that the LUC / REN values ​​of the RCA, RBCS2B, and RBCS3B promoters in the experimental groups were significantly lower than those in the control group. Figure 3 The D in the figure indicates that ABI5 inhibits the transcriptional expression of RCA, RBCS2B and RBCS3B.

[0210] Example 6: RT-qPCR

[0211] Take leaves of Arabidopsis thaliana plants grown for 21 days as described in step (1) of Example 1 (plant culture conditions: temperature 22℃, humidity 60%, light / dark cycle 14h / 10h, light intensity 100μmol / m²). 2 RNA was extracted and reverse transcribed into cDNA using an RNA extraction and reverse transcription kit purchased from Nanjing Novizan Biotechnology Co., Ltd. The cDNA was used for RT-qPCR, with Actin2 as an internal control gene.

[0212] qActin2-F: 5′-GCACCACCTGAAAGGAAGTACA-3′;

[0213] qActin2-R: 5′-CGATTCCTGGACCTGCCTCATC-3′;

[0214] qABI5-F: 5′-AAAACATGCATTGGCGGAGT-3′;

[0215] qABI5-R: 5′-AATGTCCGCAATCTCCCGTT-3′;

[0216] qRCA-F: 5′-GAGGGCGAGAGTGTACGATG-3′;

[0217] qRCA-R: 5′-GCTGGGCTCCTTTTCCGTAG-3′;

[0218] qRBCS2B-F: 5′-GCATCAGTTTCATTGCCTACAAG-3′;

[0219] qRBCS2B-R: 5′-ACCACATAGAAATGGGTTCCAG-3′;

[0220] qRBCS3B-F: 5′-AGGATGGTCCACTTGAAAGGA-3′;

[0221] qRBCS3B-R: 5′-TGGACTCTTATCCGCAAGCC-3′.

[0222] PCR amplification conditions were: 95℃ for 30 seconds; 95℃ for 5 seconds, 60℃ for 30 seconds, for 40 cycles; melting curves were analyzed at 60–95℃.

[0223] The expression level of the ABI5 gene in the Arabidopsis ABI5 mutant abi5-8 was significantly lower than that in the wild-type Col-0, and the expression levels of RCA, RBCS2B, and RBCS3B in the ABI5 mutant abi5-8 were significantly higher than those in the wild-type Col-0. Figure 4 This indicates that ABI5 inhibits the expression of photosynthesis-related genes, thereby suppressing plant photosynthesis and growth. Therefore, after reducing the expression level of the ABI5 gene, the expression levels of RCA, RBCS2B, and RBCS3B were significantly increased, thereby promoting plant photosynthesis and growth.

[0224] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. Arabidopsis thaliana ABI5 The application of genes in improving plant growth and development under low nitrogen conditions is characterized by: The application involves knocking out Arabidopsis thaliana. ABI5 Genetic implementation; the plant is Arabidopsis thaliana; the low nitrogen condition is a 0.05–1 mM nitrogen source; the improvement of plant growth and development is to increase the cotyledon chlorophyll rate; the Arabidopsis thaliana... ABI5 The gene, whose encoded amino acid sequence is shown in SEQ ID NO:

11.

2. The application according to claim 1, characterized in that: The low-nitrogen condition is a 0.05 mM nitrogen source.

3. The application according to claim 2, characterized in that: The nitrogen source is nitrate.

4. The application according to claim 3, characterized in that: The nitrate is at least one of potassium nitrate and calcium nitrate.

5. The application according to any one of claims 1 to 4, characterized in that: The Arabidopsis thaliana mentioned above ABI5 The nucleotide sequence of the gene is the DNA sequence shown in SEQ ID NO:

12.

6. The application according to any one of claims 1 to 4, characterized in that: The Arabidopsis thaliana mentioned above ABI5 The nucleotide sequence of the gene is shown in the DNA sequence from 230bp to 1558bp in SEQ ID NO: 12.

Images