Application of molecular genetic marker YZU-LAYER-MGM-2 in identifying high-yielding laying hens

Abstract

The present invention discloses the use of the molecular genetic marker YZU-LAYER-MGM-2 for identifying high-yielding laying hens. This molecular genetic marker and its detection method allow for early identification of high-yielding laying hens, accelerating the breeding process. This molecular genetic marker and its detection method require only a small amount of blood sampling, enabling early identification of high-yielding laying hens. This method offers the advantages of convenience, high throughput, and labor savings, thus reducing breeding costs.

Description

Technical Field

[0001] The invention relates to application of molecular genetic marker YZU-LAYER-MGM-2 in identifying high-yield laying hens, and belongs to the field of poultry breeding technology and gene detection. Background Art

[0002] In laying hen production, egg production is one of the key indicators directly linked to breeding efficiency. At the same time, egg production is also an important indicator for measuring breeding results. Genetic factors are the key factors that determine the egg-laying potential of chickens. It is currently believed that egg-laying traits are controlled by the coordinated efforts of multiple genes, and gene mutation is one of the genetic principles that cause differences in egg production within a population. Within the scope of gene mutation, there is a type of situation involving only a single base mutation called single nucleotide polymorphism (SNP). Using SNP theory, the single-site information of mutations within the genome can be associated with egg production information through correlation analysis and calculation, and SNP sites associated with certain specific phenotypes can be screened to form molecular genetic markers for egg production traits, thereby guiding their application.

[0003] By detecting molecular genetic markers, individual egg production can be predicted early, avoiding the long-term manual recording and selection issues in traditional breeding. This can accelerate the breeding process and reduce breeding and labor costs. However, current detection methods, which mostly rely on high-throughput sequencing or gene chip technology, have greater errors and higher costs than detection methods based on PCR combined with first-generation sequencing. Summary of the Invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide an application of a molecular genetic marker YZU-LAYER-MGM-2 in identifying high-yielding laying hens, which helps to accelerate the breeding process and reduce breeding costs.

[0005] Technical solution: In order to solve the above technical problems, the present invention provides the use of the molecular genetic marker YZU-LAYER-MGM-2 or a detection kit containing the molecular genetic marker YZU-LAYER-MGM-2 in the determination of egg production traits. The molecular genetic marker YZU-LAYER-MGM-2 is located at position 23357295 of chromosome Z.

[0006] Wherein, the molecular genetic marker YZU-LAYER-MGM-2 is Z T / - Type or Z C / - type.

[0007] Among them, when the genotype is Z C / - When the genotype is Z, the egg production trait is a high egg production trait; when the genotype is Z T / - When the type is established, the egg production trait is a low egg production trait.

[0008] The invention also provides the use of a molecular genetic marker YZU-LAYER-MGM-2 or a detection kit containing the molecular genetic marker YZU-LAYER-MGM-2 in identifying high-yield laying hens. The molecular genetic marker YZU-LAYER-MGM-2 is located at position 23357295 of the Z chromosome.

[0009] Wherein, the molecular genetic marker YZU-LAYER-MGM-2 is Z T / - Type or Z C / - type.

[0010] Among them, when the genotype is Z C / - When the type is tested, the chickens to be tested are high-yielding laying hens.

[0011] The present invention also provides the use of a specific primer pair of the molecular genetic marker YZU-LAYER-MGM-2 or a kit containing the specific primer pair in determining egg production traits. The nucleotide sequences of the specific primer pair are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0012] The method includes the following steps: using the DNA of the chicken to be tested as a template, and performing PCR amplification using the specific primer pair; when the base at the 95bp position of the amplified product sequence is C, the chicken to be tested has a high egg production trait; when the base at the 95bp position of the amplified product sequence is T, the chicken to be tested has a low egg production trait.

[0013] The present invention also provides the use of a specific primer pair of the molecular genetic marker YZU-LAYER-MGM-2 or a kit containing the specific primer pair in identifying high-yielding laying hens. The nucleotide sequences of the specific primer pair are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0014] The technical solution of the present invention mainly includes three parts: screening of genetic markers, detection method of the genetic markers, and accuracy verification of the detection method.

[0015] 1. Screening of Molecular Genetic Markers

[0016] 1) Phenotypic determination: The egg production data of 2145 Rock Island Red chickens were recorded at different stages, including egg production from the first laying day to 300 days of age, egg production from 301 days to 560 days of age, egg production from 561 days to 651 days of age, and total egg production.

[0017] 2) Whole-genome association analysis: Each individual was genotyped using a 55k gene chip. After the typing data passed quality control and the whole-genome significance threshold was calculated, the 55k variation information was combined with the corresponding phenotypic data for whole-genome association analysis, and multiple loci significantly associated with egg production at each stage were obtained ( Figure 1and Figure 2 ).

[0018] 3) Screening of candidate sites: Overlap analysis was performed on sites that were significantly correlated at different stages, and it was found that 4 significant sites were all associated with egg production at 301-560 days of age, egg production at 561-651 days of age, and total egg production. Bioinformatics annotation of these 4 sites revealed that these 4 sites were all located on chromosome Z, with a range of 23.354Mb-23.493Mb, and these 4 sites were highly linked to each other. Among them, the Top2 site chrZ:23357295 (located at 23357295bp on chromosome Z, rs315990363, and the reference genome was GRCg6a) can be used as the Tag SNP of these 4 sites, which belongs to the splicing polypyrimidine pathway mutation ( Figure 3-5 ). Therefore, chrZ:23357295 was determined as a candidate site.

[0019] 4) Determination of the relationship between the genotype of the genetic marker and egg production

[0020] In this population, there are two genotypes at this locus: Z C / - , Z T / - , the frequency of C is 0.668, and the frequency of T is 0.332. C / - The average total egg production of individuals was 433, the average total egg production of G / A individuals was 423, and the average total egg production of Z T / - The average total egg production of each individual was 381 eggs, and there was a statistically significant difference between the groups ( Figure 4 ). Therefore, it is determined that the site Z C / - The genotype has high egg production traits and should be selected; determine the site Z T / - Genotypes with low egg production traits can be eliminated.

[0021] 2. Detection Methods of Genetic Markers

[0022] 1) Blood collection: 0.1 mL of blood was collected from the venous vein of the chicken to be tested.

[0023] 2) Blood DNA extraction: DNA was extracted from blood samples using a blood DNA extraction kit.

[0024] 3) PCR and product quality inspection: PCR amplification is performed using the designed specific primers and the extracted DNA. The amplified product should have a single band and be 261 bp in size. It should pass the quality inspection by agarose gel electrophoresis before subsequent sequencing.

[0025] 4) Product sequencing: Sanger sequencing is used to read the base information at the 95th bp of the amplified product.

[0026] 5) Result judgment: If it shows Z C / -If the type is Z, it is a high egg-producing individual; T / - type, it is a low egg-laying individual ( Figure 6 ).

[0027] 3. Verification of the Accuracy of the Genetic Marker Detection Method

[0028] The detection method was validated in another 96 individuals, showing that the Z C / - Individuals with the same genotype have higher egg production, indicating that the genetic markers and the detection method thereof in the present invention can effectively identify high-yielding laying hens at an early stage.

[0029] The present invention recorded the egg production information of more than 2,000 White Leghorn chickens at different stages and performed genotyping using a 55k gene chip. A genome-wide association study (GWAS) of egg production at different stages, combined with an overlap screening strategy for different stages, identified a single nucleotide polymorphism (SNP) genetic marker (chrZ:23357295, rs315990363, GRCg6a) that was highly correlated with egg production in this group. In this group, there were two genotypes at this SNP site: Z C / - , Z T / - . Z C / - The average total egg production of individuals is 433 eggs. T / - The average total egg production of individuals was 423, and there was a statistical difference between the groups. C / - The genotype has a high egg production trait. Based on this, the present invention has developed a blood DNA group detection method for this site and verified it to realize the Z site. C / - Therefore, the genetic marker and its detection method can be used for the early selection of individuals with high egg production traits, avoiding the problems of conventional breeding, such as long working cycle, high cost, large manpower and wide error.

[0030] Beneficial effects: Compared with the existing technology, the present invention has the following significant advantages: 1. The molecular genetic marker and its detection method can be used to identify high-yielding laying hens at an early stage, which can accelerate the breeding process; 2. The molecular genetic marker and its detection method only require a small amount of blood sampling to identify high-yielding laying hens at an early stage, which has the advantages of being convenient, high-throughput, and labor-saving, and can save breeding costs; based on the breeding cost of a laying hen from brooding to culling of 190 yuan / hen, according to the population gene frequency, Z C / - Individuals with high egg production account for about 67% of the total group, so 32% of individuals with medium and low egg production can be eliminated early; if 10,000 chickens are raised, excluding the detection cost of this method, about 568,000 yuan can be saved (10,000 × 190 yuan / bird × 32% - 40,000 yuan). BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1The screening process of the molecular genetic marker (chrZ:23357295, GRCg6a): ac are the GWAS results of egg production from the first day of laying to 300 days, egg production from 301 days to 560 days, and egg production from 561 days to 651 days, respectively;

[0032] Figure 2 is the GWAS result of total egg production;

[0033] Figure 3 Overlap analysis of significant correlation sites in the four stages;

[0034] Figure 4 LD analysis revealed that chrZ:23357295 could be used as the Tag SNP for these four loci;

[0035] Figure 5 It is a statistical analysis of the total egg production corresponding to the genotype of the site in the population, that is, the determination of the relationship between the genotype of the genetic marker and egg production, Z C / - The genotype has high egg production trait, Z T / - The genotype has a low egg production trait;

[0036] Figure 6 This is the result interpretation of the molecular genetic marker (chrZ:23357295, GRCg6a) detection method: If the test result shows a single peak of T at the 95bp position, the genotype of the site is determined to be Z T / - , as shown in a; if a single peak is C, the genotype of the site is determined to be Z C / - , as shown in b. DETAILED DESCRIPTION

[0037] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0038] Example 1. Screening of molecular genetic markers

[0039] 1) Phenotypic determination: Egg production data of 2145 Luodao Red chickens of the same generation (the group was raised in Baoding City, coordinates 115.53, 39.46) were recorded at different stages, including egg production from the first laying day to 300 days of age, egg production from 301 days to 560 days of age, egg production from 561 days to 651 days of age, and total egg production.

[0040] 2) Genome-wide association analysis: Each individual was genotyped using a 55k gene chip (the trade name of this gene chip is "Jingxin No. 1" and the test was provided by Beijing Compson Biotechnology Co., Ltd.). The typing data passed quality control (quality control parameters were: filtering individuals with sample detection rate <90%, filtering loci with genotype missing rate >10% and minimum allele frequency <5%), and the genome-wide significance threshold was calculated (1 / number of independent SNPs, the number of independent SNPs was calculated using the parameter --indep-pairwise 25 5 0.2, that is, 25 SNPs were used as a sliding window and 5 SNPs were added each time, and the R value with any other SNP was 0.05). 2 The number of SNPs with a value greater than 0.2) was analyzed using a general linear model. The variant sites that passed the quality control were analyzed with the egg production data for whole genome association analysis, and several sites that were significantly associated with egg production at each stage were obtained ( Figure 1 and Figure 2 ).

[0041] 3) Screening of candidate sites: Overlap analysis of sites significantly associated with different stages ( Figure 3 ) found four significant loci associated with egg production from 301 to 560 days of age, egg production from 561 to 651 days of age, and total egg production. Bioinformatics annotation of these four loci revealed that all four were located on chromosome Z, within a range of 23.354 Mb to 23.493 Mb, and were highly linked to each other (Table 1).

[0042] Table 1 Four loci and their annotation information

[0043]

[0044] Among them, the Top2 site chrZ:23357295 (located at 23357295bp on chromosome Z, rs315990363, reference genome is GRCg6a) can be used as the Tag SNP of these four sites ( Figure 4 ), which belongs to the splicing polypyrimidine pathway mutation. Therefore, chrZ:23357295 was identified as a candidate site.

[0045] 4) Determination of the relationship between the genotype of the genetic marker and egg production

[0046] In this population, there are two genotypes at this locus: Z C / - , Z T / - , the frequency of C is 0.668, and the frequency of T is 0.332. C / - The average total egg production of individuals is 433 eggs. T / - The average total egg production of each individual was 423 eggs, and there was a statistically significant difference between the groups ( Figure 5 ). Therefore, it is determined that the site ZC / - The genotype has high egg production traits and should be selected; determine the site Z T / - Genotypes with low egg production traits can be eliminated. Among them, high and low egg production are defined relative to the median egg production level of the group. High production is defined as statistically significantly higher than the median level, and low production is defined as statistically significantly lower than the median level.

[0047] Example 2 Detection method of the genetic marker

[0048] The genetic marker and its detection method of the present invention can be used to identify chickens with high egg production traits at an early stage, thereby guiding subsequent selection work. Taking the detection of this molecular genetic marker in 96 hens as an example, the specific implementation method is as follows:

[0049] 1) Blood collection: Use a blood collection needle and an anticoagulant EDTA vacuum blood collection tube to collect 0.1-0.3 mL of blood from each chicken under the wing vein for subsequent testing.

[0050] 2) Blood DNA extraction: A blood DNA extraction kit (Tiangen Biotechnology, DP348) was used to extract DNA from blood samples according to the operating procedures. The DNA concentration was measured and controlled at approximately 100 ng / μL for subsequent PCR.

[0051] 3) PCR: PCR amplification was performed on the extracted DNA using primers designed specifically for the molecular genetic marker (chrZ:23357295) (see Table 2 for reagents). A 20 μL reaction system was used. The reaction system composition and reaction procedure are shown in Tables 3 and 4. The amplified product was used for subsequent analysis.

[0052] Table 2

[0053]

[0054] Table 3

[0055]

[0056] Table 4

[0057]

[0058] 4) Quality Assurance and Sequencing of Amplified Products: 1 μL of amplified product was mixed with 1 μL of nucleic acid dye and subjected to 1.5% agarose gel electrophoresis using a DNA marker. After electrophoresis, if a single 261 bp band is present, the product has passed quality control and can be used for subsequent sequencing. The sequence of the amplified product is: 5'-ACATGCCATTTGTCAGCAG AGTCATTCTCCTTATGGAATCTGCAGCTTGCAGCGTCAAGCACTTTGTTTCTCCAGT TGTCCTGGGAAAACCACA(T / C)AAGCAGATGATGAGAGGGACATTGAATCTTTTTT TCCTAGATACTAATACCAAAGAAAATAAAATGGATGTCTAAGATACAGCACAAACTCTGTGACTTGCAAAGGGAATCCCTTTCCTTTAATATATCCTAATTGTCACCATCTGCCTCATAGGTTGTCGCCTGG-3'.

[0059] For the amplified products that passed the quality inspection, Sanger sequencing was used to obtain sequencing data and read the base information at the 95th bp.

[0060] 5) Result judgment: If Z is displayed here C / - If the type is Z, it is a high egg-producing individual; T / - The results showed that among the 96 chickens, the Z C / - There are 61 types, Z T / - There are 35 of them. According to the result judgment criteria, Z C / - Type individuals, eliminate Z T / - The 61 Z C / - The egg production of 54 individuals was higher than the group average, and they were high-producing individuals with an accuracy rate of over 88%.

Claims

1. The application of the molecular genetic marker YZU-LAYER-MGM-2 in determining the egg production trait of Luodao Red Chicken is characterized by: The molecular genetic marker YZU-LAYER-MGM-2 has a nucleotide sequence as shown in SEQ ID NO.3, and there is a T / C base mutation at position 95 of SEQ ID NO.

3.

2. The application according to claim 1, characterized in that The genotype of the molecular genetic marker YZU-LAYER-MGM-2 is Z C / - Type or Z T / - type.

3. The application according to claim 2, characterized in that: When the genotype is Z C / - When the genotype is Z, the egg production trait is a high egg production trait; when the genotype is Z T / - When the type is established, the egg production trait is a low egg production trait.

4. Use of the specific primer pair of the molecular genetic marker YZU-LAYER-MGM-2 according to claim 1 or a kit containing the specific primer pair in determining the egg production trait of Luodao Red chicken, characterized in that: The nucleotide sequences of the specific primer pair are shown in SEQ ID NO.1 and SEQ ID NO.

2.

5. The application according to claim 4, characterized in that: The following steps are involved: The specific primer pair is used to perform PCR amplification using the DNA of the chicken to be tested as a template; when the base at the 95th bp of the amplified product sequence is C, the chicken to be tested has a high egg production trait; when the base at the 95th bp of the amplified product sequence is T, the chicken to be tested has a low egg production trait.

Images