Quantitative polymerase chain reaction (q-PCR) identification primer and kit for ralstonia solanacearum and application thereof

Abstract

The invention discloses a q-PCR identification primer and kit for ralstonia solanacearum and application of the q-PCR identification primer and kit, and belongs to the technical field of molecular biology. On one hand, the invention provides the ralstonia solanacearum q-PCR identification primer and the kit, and on the other hand, the invention provides application of the identification primer and the kit. The q-PCR method is adopted for quantitative analysis of the ralstonia solanacearum pathogenic gene HrpB, and the method can be directly used for establishment of a field ralstonia solanacearum rapid detection system. The q-PCR rapid detection system established by the invention can be simply and rapidly applied to detection and monitoring of field ralstonia solanacearum.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a solanacearum q-PCR identification primer, a kit and applications thereof. Background Art

[0002] Ralstonia solanacearum Ralstonia solanacearum It is a devastating soil-borne pathogen that causes bacterial wilt in many plants worldwide. It invades the vascular system from the roots of plants, causing irreversible wilting and death of plants, and causing serious losses to many economic crops. In the absence of specific pesticides, early prevention and removal of bacterial wilt in the soil is an effective means of prevention and control. However, bacterial wilt, which has the characteristics of rapid outbreak and spread and long survival time, urgently needs efficient and accurate detection and diagnosis methods, which can provide a basis for timely and scientific use of drugs and green and effective prevention and control measures.

[0003] With the development of molecular biology and bioinformatics technology, rapid and accurate molecular diagnosis is an important part of green prevention and control of pathogenic bacteria, and real-time fluorescence quantitative polymerase chain reaction (qPCR) is widely used in pathogen identification and gene mutation detection due to its strong specificity, high sensitivity, easy operation, high efficiency and economy. The present invention establishes a rapid identification method of Ralstonia solanacearum suitable for field application based on qPCR technology. Summary of the invention

[0004] In view of the problems existing in the prior art, the purpose of the present invention is to design and provide a technical solution for q-PCR identification primers, a kit and their application for Ralstonia solanacearum.

[0005] The present invention is specifically implemented by the following technical solutions: The first aspect of the present invention provides a q-PCR identification primer for Ralstonia solanacearum, which includes hrpB-F1, hrpB-R1 and hrpB-FAM-Pb, the nucleotide sequence of the hrpB-F1 is shown in SEQ ID NO.1, the nucleotide sequence of the hrpB-R1 is shown in SEQ ID NO.2, and the nucleotide sequence of the hrpB-FAM-Pb is shown in SEQ ID NO.3.

[0006] The second aspect of the present invention provides a Ralstonia solanacearum q-PCR identification kit, which contains the above-mentioned identification primers.

[0007] The third aspect of the present invention provides the use of the above-mentioned primers or the above-mentioned kit in the identification or monitoring of Ralstonia solanacearum.

[0008] A fourth aspect of the present invention provides a method for rapid detection of Ralstonia solanacearum, comprising the following steps: 1) Take the DNA of the crop tissue to be identified as a template; 2) performing q-PCR using the above primers or the above kit; 3) According to the amplification effect, if the Ct value is <41, it indicates that Ralstonia solanacearum has been detected.

[0009] Furthermore, in the step 2), the q-PCR reaction system is: a 20 μL system: 2× 5G buffer 10 μL, 20 μM hrpB-F1 0.4 μL, 20 μM hrpB-R1 0.4 μL, 20 μM hrpB-FAM-Pb 0.2 μL, template 2 μL, ddH2O 7 μL.

[0010] Furthermore, the q-PCR reaction program in step 2) is: 95°C 60 s, 1 cycle; 97°C 1 s, 58°C 8 s, 45 cycles.

[0011] The q-PCR method used in the present invention detects the specific fragment of the pathogenic gene HrpB of Ralstonia solanacearum, and the sequence of the specific fragment is shown in SEQ ID NO.4.

[0012] The present invention adopts the q-PCR method to quantitatively analyze the pathogenic gene HrpB of Ralstonia solanacearum, which can be directly used to establish a rapid detection system for Ralstonia solanacearum in the field. The q-PCR rapid detection system established by the present invention can be simply and quickly applied to the detection and monitoring of Ralstonia solanacearum in the field. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The results of the nucleic acid gradient detection of Ralstonia solanacearum in Example 1 are as follows; Figure 2 The results of the gradient detection of the bacterial solution of Ralstonia solanacearum in Example 2; Figure 3 This is the rapid detection result of the Ralstonia solanacearum liquid in Example 3. DETAILED DESCRIPTION

[0014] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0015] Example 1: Detection sensitivity of Ralstonia solanacearum qPCR system 1. Methods The Ralstonia solanacearum was activated on NA medium and cultured in a 30°C incubator for 12 h. A single colony was picked into a liquid culture medium and cultured with shaking at 30°C and 150 r / min for 4-6 h. 1.5 mL of the culture medium was collected by centrifugation.

[0016] Using the column extraction method, the collected bacteria were resuspended in 200 μL 1×TE and then nucleic acid was extracted. 50 μL elution buffer was used for elution to obtain the nucleic acid template.

[0017] The nucleic acid template is diluted with buffer to 1×, 10×, 100×, 1000×, 10000× and 100000×, for a total of 6 serial dilution multiples.

[0018] Six templates with different dilution multiples were added to the reaction system configured with quantitative reagents (Table 1). The primers used for qPCR were synthesized by Shanghai Shenggong Biotechnology, including primer hrpB-F1, primer hrpB-R1 and primer hrpB-FAM-Pb. The nucleotide sequence of hrpB-F1 is shown in SEQ ID NO.1, the nucleotide sequence of hrpB-R1 is shown in SEQ ID NO.2, and the nucleotide sequence of hrpB-FAM-Pb is shown in SEQ ID NO.3. Applied Biosystems 7500 (Life Technologies) was used for detection, and the amplification program was optimized. After optimization, the reaction program was 95°C 60 s, 1 cycle; 97°C 1 s, 58°C 8 s, 45 cycles.

[0019] Table 1 qPCR reaction system configuration

[0020] 2. Test results and analysis From Table 2 and Figure 1 It can be seen that the qPCR detection system has a good amplification effect. The Ct values ​​under the six template dilution concentrations are between 23.78 and 40.51. A negative result was found when the dilution was 100,000 times, indicating that the sensitivity of the qPCR detection system is that the nucleic acid is diluted to 10,000 times.

[0021] Table 2 qPCR test results

[0022] Example 2: Direct amplification test of Ralstonia solanacearum qPCR system 1. Direct expansion method The Ralstonia solanacearum was activated under the same culture conditions as in Example 1, and 10 μL of the expanded Ralstonia solanacearum suspension was diluted with buffer solution in a gradient manner, with a total of 4 gradients, namely 10×, 100×, 1000× and 10000× (Table 3). After the dilution was completed, the mixture was shaken and mixed, and used as a template for later use.

[0023] Take 2 μL of the diluted template and use the same qPCR amplification system as in Example 1, amplification system: 2× 5G buffer 10 μL, 20 μM hrpB-F1 0.4 μL, 20 μM hrpB-R1 0.4 μL, 20 μM hrpB-FAM-Pb 0.2 μL, template 2 μL, ddH2O 7 μL. According to the reaction program, 95°C 60 s, 1 cycle; 97°C 1 s, 58°C 8 s, 45 cycles, detection was performed.

[0024] 2. Test results and analysis From Table 3 and Figure 2 It can be seen that the qPCR detection system has a good effect on direct amplification of bacterial liquid, and the Ct values ​​under 6 template dilution concentrations are between 34.21-40.63, indicating that the sensitivity of the qPCR detection system is that the nucleic acid is diluted to 10,000 times.

[0025] Table 3 Direct amplification qPCR detection results

[0026] Example 3: qPCR system rapid amplification detection 1. Rapid amplification detection method The same conditions as in Example 1 were used to activate the solanacearum, and the concentration of the solanacearum suspension was about 1×10^8CFU / mL; healthy tomato plants at the 6-leaf stage were taken, and the solanacearum pathogen was inoculated by the root injury and root cutting method, and the inoculation of clean water was used as a control. 48 hours after the plant became ill, the fourth functional leaf from the last was taken, the leaf surface was washed with deionized water, and the 1cm×1cm diseased leaf was cut with clean sterile scissors, placed in 100μL 1×TE solution and crushed, shaken and mixed, and 10 μL was drawn for gradient dilution, a total of 5 gradients, namely 1×, 10×, 100×, 1000× and 10000×, as a detection template for standby. The water-inoculated plant NTC was used as a control (Table 4), and the template was prepared in the same way. Take 2 μL template and configure the same qPCR amplification system as in Example 1: 10 μL 2× 5G buffer, 0.4 μL 20 μM hrpB-F1, 0.4 μL 20 μM hrpB-R1, 0.2 μL 20 μM hrpB-FAM-Pb, 2 μL template, 7 μL ddH2O. Use the optimized rapid amplification program: 95°C 60 s, 1 cycle; 97°C 1 s, 58°C 8 s, 45 cycles. Detection was performed (Table 5).

[0027] 2. Test results From Table 4 and Figure 3 It can be seen that the qPCR detection system has a good effect on direct amplification of bacterial liquid, and the Ct values ​​of the six templates are between 30.48 and 41.62. Compared with the unoptimized results (the unoptimized results used ordinary quantitative detection, program: 95℃30s for one cycle; 95℃10s, 60℃30s, 40 cycles; melting curve), the sensitivity can remain unchanged when using the optimized rapid detection program, and the total detection time is about 30min.

[0028] Table 4 Rapid detection amplification results

[0029] Table 5 Rapid test procedures

[0030] The amplification primer sequences of the present invention are: hrpB-F1: CGGTTTTCGCCGCTGATTTCG (SEQ ID NO. 1); hrpB-R1: AAGCCTTCTTCCGCTTCTTC (SEQ ID NO.2); hrpB-FAM-Pb: ATGCATCGCTGCTGCTCGAGT (SEQ ID NO.3); The amplification sequence of the qPCR method used in the present invention is: GGCCTCGCCCGTTCGCGAGCGCCTGCCCGAATACGCAAATGCGGTTTTCGCCGCTGATTTCGACCGTGCGTATCAGCTCGTCGACCACCACTCCTCCCAGCGCGGAAAGTCCGACGACTACGCGGGCGTGCTGGCGATGGCCGATGCATCGCTGCTGCTCGAGTGCGACGAAGAAGCGGAAGAAGGCTTCCGCCTGGCGCAGCGCCTGATCCGCCATTCGGATGACCAGCTGCGC (SEQ ID NO.4).

[0031] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A q-PCR identification primer for Ralstonia solanacearum, characterized in that: It includes hrpB-F1, hrpB-R1 and hrpB-FAM-Pb, the nucleotide sequence of hrpB-F1 is shown in SEQ ID NO.1, the nucleotide sequence of hrpB-R1 is shown in SEQ ID NO.2, and the nucleotide sequence of hrpB-FAM-Pb is shown in SEQ ID NO.

3.

2. A q-PCR identification kit for Ralstonia solanacearum, characterized in that: Contains the identification primer as claimed in claim 1.

3. Use of the primers according to claim 1 or the kit according to claim 2 in the identification or monitoring of Ralstonia solanacearum.

4. A method for rapid detection of Ralstonia solanacearum, characterized in that: The following steps are involved: 1) Take the DNA of the crop tissue to be identified as a template; 2) performing q-PCR using the primers described in claim 1 or the kit described in claim 2; 3) Based on the amplification effect, if the Ct value < 41, it indicates that Ralstonia solanacearum has been detected.

5. A method for rapid detection of Ralstonia solanacearum according to claim 4, characterized in that: The q-PCR reaction system in step 2) is: 20 μL system: 2× 5G buffer 10 μL, 20 μM hrpB-F1 0.4 μL, 20 μM hrpB-R1 0.4 μL, 20 μM hrpB-FAM-Pb 0.2 μL, template 2 μL, ddH2O 7 μL.

6. A method for rapid identification of taro blight in the field as claimed in claim 4, characterized in that: The q-PCR reaction program in step 2) is: 95°C 60 s, 1 cycle; 97°C 1 s, 58°C 8 s, 45 cycles.

Images