A detection kit for identifying duck short beak dwarf syndrome virus
Through RPA isothermal amplification and CRISPR/Cas12a detection system, combined with specific primers and crRNA, the problem that existing technology cannot distinguish between duck short-beak dwarf syndrome virus and Muscovy duck gosling plague virus was solved, and efficient and accurate virus identification was achieved.
Patent Information
- Application Number
- CN202411358426.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-27
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2044-09-27
AI Technical Summary
Existing detection methods cannot accurately distinguish between duck short-beak syndrome virus and Muscovy duck and gosling plague virus, resulting in the inability to take targeted prevention and control measures, causing economic losses to the duck industry.
A detection kit for identifying duck short-beak syndrome virus and Muscovy duck gosling plague virus was designed using the RPA isothermal amplification system and CRISPR/Cas12a detection system, combined with specific RPA primers and crRNA sequences.
It has achieved accurate identification of duck short-beak dwarf syndrome virus and Muscovy duck gosling plague virus, with a detection accuracy rate of 100%, and has fast and reliable identification capabilities.
Smart Images

Figure CN119193924B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of virus identification, and particularly relates to a detection kit for identifying Muscovy duck-origin goose parvovirus and duck short beak and dwarfism syndrome virus. BACKGROUND
[0002] Waterfowl parvovirus has caused huge economic losses to the global waterfowl industry. This virus belongs to the members of the Dependoparvovirus genus of the Parvovirinae subfamily of the Parvoviridae family. According to the host range, viral whole genome characteristics and antigen cross-neutralization test results, this virus can be divided into two categories: Muscovy duck parvovirus (MDPV) and goose parvovirus (GPV). GPV and MDPV have about 77% homology in VP1 nucleotide sequences and 85% homology at the protein level, and have antigen correlation with each other. However, the two parvoviruses have different infection hosts: MDPV only infects Muscovy ducks, especially ducklings under 3 weeks old; and GPV can infect geese and ducks and is the pathogen of gosling plague. Muscovy duck-origin GPV (MDGPV) is a natural recombinant virus of MDPV and classic GPV, has similar intestinal plugging diagnostic characteristics as classic gosling plague, and has a morbidity of 50% to 70% and a mortality of 40% to 65%. Short beak and dwarfism syndrome virus (SBDSV) is a new type of GPV, has a nucleotide homology of 90.8% to 94.6% with classic GPV, and is the pathogen of short beak and dwarfism syndrome (SBDS). SBDSV mainly infects Muscovy ducks and Cherry Valley ducks, and the clinical characteristics of infected ducks include soft feet, short beak, tongue exposure (long tongue), easy fracture, growth disorder (stiff duck), and poor feather growth. The morbidity of SBDS is 10% to 100%, the mortality is 2% to 10%, the culling rate of residual or stiff ducks is 20% to 80%, the weight of ducks that are not culled after the onset is about 1 kg lower than that of healthy ducks, and the rate of substandard products is increased due to the easy fracture of neck, wing and leg bones during the slaughtering process. MDGPV and SBDSV have caused huge economic losses to the duck industry.
[0003] At present, the methods for detecting GPV include virus isolation culture, serological diagnosis methods (such as ELISA, latex agglutination test and indirect immunofluorescence test) and PCR technology-based methods (such as conventional PCR and fluorescent quantitative PCR). However, due to the high similarity of the nucleotide sequences of MDGPV and SBDSV, and the limitations of the existing technology itself, these methods cannot accurately distinguish the two viruses. On the other hand, MDGPV and SBDSV can both infect muscovy ducks, and clinically infected ducks often do not show typical clinical symptoms, and cannot be directly diagnosed according to clinical symptoms. Therefore, it is necessary to establish a detection technology for quickly distinguishing MDGPV and SBDSV, so as to take corresponding prevention and control measures. SUMMARY
[0004] The purpose of the present application is to identify muscovy duckling gosling plague virus and duck short-beak dwarf syndrome virus.
[0005] The present application provides a kit for identifying muscovy duckling gosling plague virus and duck short-beak dwarf syndrome virus, the detection kit comprising an RPA isothermal amplification system and a CRISPR / Cas12a detection system;
[0006] The RPA isothermal amplification system comprises an RPA primer pair, the RPA primer pair comprising a forward primer and a reverse primer, the nucleotide sequence of the forward primer being as shown in SEQ ID NO. 1, and the nucleotide sequence of the reverse primer being as shown in SEQ ID NO. 2.
[0007] The CRISPR / Cas12a detection system comprises crRNA and a probe, and the nucleotide sequence of the crRNA is as shown in SEQ ID NO. 3.
[0008] Further limitation, the sequence of the probe is FAM-TTATT-BHQ.
[0009] Further limitation, the RPA isothermal amplification system further comprises an RPA reaction system of 50 μL, containing 29.5 μL of buffer, 2.4 μL of upstream primer, 2.4 μL of downstream primer, 2.5 μL of magnesium acetate, 1 μL of recombinant plasmid and 12.2 μL of nuclease-free water.
[0010] Further limitation, characterized in that the CRISPR / Cas12a detection system further comprises Cas12a.
[0011] Further limitation, the template sequence for designing the RPA primer pair and the crRNA is as shown in SEQ ID NO. 7.
[0012] Further limitation, the concentration of crRNA is 200 nM, the concentration of the probe is 300 nM, and the concentration of Cas12a is 100 nM.
[0013] The present invention provides an application of the above-mentioned kit in preparing a kit for identifying Muscovy duck gosling plague virus and duck short-beak stunted syndrome virus.
[0014] The present invention provides a method for identifying Muscovy duck gosling plague virus and duck short beak syndrome virus for non-diagnostic and non-therapeutic purposes, wherein the specific steps of the method are as follows:
[0015] S1: Add the sample DNA to the RPA system for isothermal amplification to obtain the RPA amplification product;
[0016] S2: adding the RPA amplification product obtained in S1 to the detection system of the kit containing crRNA to react and obtain a reactant;
[0017] S3: Detect the reactants obtained in S2 using a multifunctional microplate reader or a fluorescence quantitative analyzer.
[0018] The present invention provides the use of the gene shown in SEQ ID NO.7 as a marker for identifying Muscovy duck gosling plague virus and duck short-beak syndrome virus.
[0019] The present invention provides application of VP3 gene as a marker for distinguishing Muscovy duck gosling plague virus and duck short-beak syndrome virus.
[0020] Beneficial Effects: The CRISPR / Cas system, particularly Cas12a, has been developed for in vitro nucleic acid detection, single nucleotide polymorphism typing, and tumor gene mutation detection due to its targeted recognition, trans-acting "accessory cleavage" activity, and extremely high base resolution. The CRISPR / Cas12a system can be used to identify MDGPV and SBDSV with 100% accuracy. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 Figure 1 shows the optimization results of the experimental conditions of the RPA-CRISPR / Cas12a method; (A) Optimization of Cas12a concentration; (B) Optimization of crRNA concentration; (C) Optimization of probe concentration; (D) Effect of different buffers on the trans-cleavage efficiency of CRISPR / Cas12a; Note: S / B, signal-to-noise ratio, is the ratio of the fluorescence intensity of the sample to the negative control;
[0022] Figure 2 Graphs showing the detection performance evaluation results of the RPA-CRISPR / Cas12a method; (A) Sensitivity evaluation results; (B) Specificity evaluation results;
[0023] Figure 3 This is a graph showing the reproducibility assessment results of the RPA-CRISPR / Cas12a method;
[0024] Figure 4 Figure for stability evaluation results of RPA-CRISPR / Cas12a method;
[0025] Figure 5 Figure of fluorescence intensity heat map of clinical samples detected by RPA-CRISPR / Cas12a method; Note: red represents that the sample is SBDSV positive, and blue represents that the sample is SBDSV negative. DETAILED DESCRIPTION
[0026] Example 1.
[0027] 1. RPA and crRNA primer design
[0028] The nucleotide sequences of the VP3 genes of all GPVs were obtained, and 1 pair of RPA primers and 1 crRNA sequence were designed near the mutation site, respectively (Table 1). The RPA primers and crRNA sequences were synthesized by Sheng Wu Bioengineering (Shanghai) Co., Ltd.
[0029] Table 1. RPA primers and crRNA sequences for identifying SBDSV
[0030] : The spacer sequence of the crRNA used for identification and complementary to the target sequence is underlined. FAM: carboxyfluorescein; BHQ: Black Hole Design of RPA primer and crRNA sequence: (SEQ ID NO. 7)
[0031] AGTCTCTTAAATTCAAGATCTTCAATGTTCAAGTCAAGGAAGTCACAACGCAGGATCAG
[0032] ACAAAGACCATTGCAAACAATCTCACCTCAACAATCCAAGTTTTTACGGATGATGAGCA
[0033] CCAACTCCCGTATGTCCTGGGCTCGGCTACGGAAGGGACCATGCCGCCGTTCCCGTCG
[0034] GATGTCTATGCCCTGCCGCAGTACGGGTACTGCACAATGCACACCAACCAGAATGGAGCACGGTTCAATGACCGTAGCGCATTCTACTGCTTAGAGTACTTCCCTAGTC.
[0035] 2. Construction of SBDSV-M15 recombinant plasmid
[0036] DNA extraction kit to extract the DNA of SBDSV-M15 as a PCR template, amplified the target fragment VP3 gene, and identified the PCR product by 2% agarose gel electrophoresis. The target fragment was recovered from the gel and purified. The purified target fragment was cloned into the vector pUC57. Eight single colonies were randomly picked and cultured in LB medium containing ampicillin resistance for 14 h. The recombinant plasmid was extracted and identified by PCR. The positive recombinant plasmid was sent for sequencing. The positive recombinant plasmid identified by sequencing was determined for DNA concentration by NanoDrop2000 ultramicro spectrophotometer, and the copy number was calculated. The recombinant plasmid was diluted by 10 times in ratio, and stored at -20°C for use.
[0037] VP3 gene (SEQ ID NO. 4):
[0038]
[0039] Example 2.
[0040] 1. RPA test
[0041] The RPA reaction system was 50 μL, containing 29.5 μL buffer, 2.4 μL of upstream and downstream primers, 2.5 μL magnesium acetate, 1 μL recombinant plasmid and 12.2 μL nuclease-free water. All components except magnesium acetate were added to the TwistAmp basicKit reaction tube, shaken to mix, and the reaction enzyme was fully dissolved. Finally, 2.5 μL of magnesium acetate was added, shaken to mix, and the amplification reaction was started. At the same time, a negative control was set. The reaction tube was placed in a 39°C constant temperature water bath for 20 min. TM
[0042] 2. RPA-CRISPR / Cas12a diagnostic platform for detecting SBDSV
[0043] The CRISPR / Cas12a detection system (30 μL) was prepared by adding 100 nM Cas12a and 200 nM crRNA into 10x reaction buffer, and incubating at 37°C for 5 min to form a ribonucleoprotein complex. Then, 200 nM fluorescent reporter molecule and 1 μL RPA amplification product were added to the above solution, mixed, and immediately collected the fluorescence intensity using a multifunctional enzyme marker (Synergy H1, BioTek, USA). The reaction was carried out at 37°C for 30 min, and the fluorescence signal was collected every 1 min (λex 485 nm, λem 525 nm).
[0044] 3. Optimization of RPA-CRISPR / Cas12a reaction conditions
[0045] In order to construct a RPA-CRISPR / Cas12a reaction system with high sensitivity, several important experimental conditions were optimized, including Cas12a concentration (50 nM, 100 nM, 150 nM, 200 nM), crRNA concentration (50 nM, 100 nM, 200 nM, 300 nM), ssDNA probe concentration (50 nM, 100 nM, 200 nM, 300 nM, 400 nM) and reaction buffer (Magigen buffer, NEBuffer r2.1 buffer, NEBuffer r3.1 buffer and CutSmart buffer).
[0046] Results: In order to construct a highly sensitive biosensor, some key experimental parameters were optimized. The optimal experimental conditions were screened by calculating the signal-to-noise ratio (S / B). The concentration of the complex of Cas12a and crRNA is a key factor in determining the rate of Cas12a cleavage reaction, which directly affects the intensity of the fluorescence signal of the CRISPR / Cas12a system. In this study, we systematically optimized different concentrations of Cas12a (concentration range 50-200nM) and crRNA (concentration range 50-300nM). Figure 1 As shown in Figures A, B, and C, when the standard plasmid concentration is the same, the S / B value of the CRISPR / Cas12a system reaches the maximum when the concentration of Cas12a is 100nM, the concentration of crRNA is 200nM, and the concentration of ssDNA probe is 300nM. Based on these results, a combination of 100nM Cas12a, 200nM crRNA, and 300nM ssDNA probe concentration was selected for subsequent experiments. In addition, the reaction buffer is also an important factor affecting the efficiency of Cas12a protein cleavage. Figure 1 As shown in D in Figure 3, under the optimal experimental conditions, the S / B value is the largest when using Magigen buffer, which indicates that Cas12a protein has the best trans-cleavage efficiency in Magigen buffer. Therefore, we chose Magigen buffer as the reaction buffer for the experiment.
[0047] Example 3.
[0048] 1. Sensitivity test
[0049] The standard plasmid was diluted 10-fold, and 1 μL (10 3 ~10 0 The RPA assay was performed using 1 μL of the amplified product as a template. After the RPA reaction, 1 μL of the amplified product was used as a substrate for CRISPR / Cas12a cleavage. Detection was performed using optimized reaction conditions, with ddH2O as a negative control. Three replicates were performed for each group to assess the sensitivity of the established RPA-CRISPR / Cas12a assay.
[0050] 2. Specificity test
[0051] According to the reaction system established above and the optimized reaction conditions, SBDSV (duck short-beak dwarf syndrome virus), GPV (goose parvovirus), MDGPV (Muscovy duck gosling plague virus), MDPV (Muscovy duck parvovirus), MDRV (Muscovy duck reovirus), NDRV (novel duck reovirus), DHV (duck hepatitis virus), DPV (duck plague virus) and DAdV-3 (duck adenovirus type 3) were detected, and a negative control was set up to evaluate the specificity of the detection method.
[0052] Results: We used RPA-CRISPR / Cas12a method to detect the presence of different concentration gradients of standard plasmids (10 3 ~10 0 copies / μL) and ddH2O as negative controls were used to evaluate the sensitivity. Figure 2 As shown in A, the RPA-CRISPR / Cas12a method detected a minimum concentration of 10 1 The fluorescence intensity of the standard plasmid was significantly different from that of the negative control group (P<0.01). Therefore, the sensitivity of the established method was 10 1 copies / μL of standard plasmid.
[0053] The constructed RPA-CRISPR / Cas12a method was used to detect SBDSV, GPV, MDGPV, MDPV, MDRV, NDRV, DHV, DPV and DAdV-3. Figure 2 As shown in Figure B, this method produces a strong fluorescent signal only in the presence of SBDSV nucleic acid, and the endpoint fluorescence value of SBDSV is significantly higher than that of GPV, MDGPV, five other waterfowl viruses, and the negative control group. This demonstrates that the RPA-CRISPR / Cas12a method established in this study is highly specific and can accurately detect SBDSV nucleic acid without cross-reacting with GPV, MDGPV, or other viral nucleic acids. This confirms that this method can effectively distinguish between classic GPV, MDGPV, and SBDSV.
[0054] 3. Repeatability test
[0055] With 10 4 The standard plasmid with a concentration of 10 copies / μL was used as a template, and the constructed RPA-CRISPR / Cas12a method was used for five consecutive tests under the optimal reaction conditions.
[0056] Results: To determine the reproducibility of the method, 10 4 The standard plasmid with copies / μL was used as a template and the optimized reaction conditions were used. Five experiments were performed independently by different experimenters.Figure 3 As shown in the figure, the fluorescence intensity of the five experiments was almost the same. The relative standard deviation (RSD) of the fluorescence intensity was only 2.92%, which was far below 5%, indicating that the method has good reproducibility and is reliable for detecting SBDSV.
[0057] 4. Stability test
[0058] The reagents used for RPA and CRISPR / Cas12a reactions were placed in a 4°C refrigerator for 30 days. 4 The standard plasmid with a concentration of copies / μL was used as a template and measured every 5 days using the established RPA-CRISPR / Cas12a method.
[0059] Results: The stability of the established RPA-CRISPR / Cas12a detection method was evaluated within 30 days. Figure 4 As shown, after 30 days of storage, the RPA-CRISPR / Cas12a detection method was effective for the same concentration (10 4 The response of the recombinant plasmid containing 100 copies / μL of the assay was very small, and compared with the initial fluorescence intensity, it only decreased by 8.43% after 30 days, indicating that the established method has good stability and has the potential to be developed into a diagnostic kit.
[0060] 5. Clinical sample testing
[0061] Thirty-six duck tissue samples suspected of being infected with GPV were collected from multiple farms in Fujian Province.
[0062] First, take an appropriate amount of tissue sample and add sterile PBS solution in proportion for grinding. After centrifugation, take the supernatant for nucleic acid extraction.
[0063] The high-temperature heating method was used to quickly obtain viral nucleic acid in the supernatant. Next, a preliminary screening was performed using the RT-qPCR method for detecting GPV previously established by our research group. The primer sequences used were F: 5'-GAGGTAGACAGCAACAGAAA-3', SEQ ID NO.5, R: 5'-GCTCGTCCGTGACCATA-3', SEQ ID NO.6. Reaction system: Green qPCR SuperMix 10μL, 10μmol / L specific upstream and downstream primers 0.5μL each, template 1μL, supplemented with sterile deionized water to a final volume of 20μL. Reaction conditions: 95℃ 5min; 95℃ 15s, 60℃ 10s, 72℃ 15s, cycle 40 times. After preliminary screening, the samples were further verified by the indirect immunofluorescence method previously established by the research group. Finally, for the samples with positive verification results, we used the RPA-CRISPR / Cas12a method established in this patent to perform the final identification.
[0064] Results: Using the qPCR method established by the research group in the early stage, 36 duck tissue samples suspected of being infected with GPV were detected, and the results showed that 16 of them were GPV positive; then the established RPA-CRISPR / Cas12a method was used to detect these 16 samples, and the results showed that as shown in Figure 5 the heat map, 2 samples were SBDSV positive (shown as red in the heat map), and the remaining 14 samples were MDGPV positive (shown as blue in the heat map).
Claims
1. A kit for identifying duck short beak dwarf syndrome virus, characterized in that, The kit comprises an RPA isothermal amplification system and a CRISPR / Cas12a detection system; The RPA isothermal amplification system comprises an RPA primer pair, wherein the RPA primer pair comprises a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown as SEQ ID NO. 1, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.
2. The CRISPR / Cas12a detection system comprises crRNA, Cas12a protein and a probe, and the nucleotide sequence of the crRNA is shown as SEQ ID NO.
3.
2. The kit of claim 1, wherein The sequence of the probe is FAM-TTATT-BHQ.
3. The kit of claim 1, wherein The RPA isothermal amplification system comprises 29.5 μL of buffer, 2.4 μL of upstream primer, 2.4 μL of downstream primer, 2.5 μL of magnesium acetate, 1 μL of recombinant plasmid and 12.2 μL of nuclease-free water.
4. The kit of claim 1, wherein The template sequence for designing the RPA primer pair and the crRNA is shown as SEQ ID NO.
7.
5. The kit of claim 1, wherein The concentration of the crRNA is 200 nM, the concentration of the probe is 300 nM, and the concentration of the Cas12a protein is 100 nM.
6. A method for identifying duckling short beak dwarfism syndrome virus using the kit according to claim 1 for non-diagnostic and therapeutic purposes, characterized by, The specific steps of the method are as follows: S1: adding the DNA of the sample to be tested into the RPA isothermal amplification system for isothermal amplification to obtain an RPA amplification product; S2: adding the RPA amplification product obtained in S1 into the CRISPR / Cas12a detection system for reaction to obtain a reaction product; S3: detecting the reaction product obtained in S2 by using a multifunctional enzyme marker or a fluorescence quantitative instrument.