Pig feed for relieving muscle oxidative damage of piglets and preparation method of pig feed

Abstract

The invention discloses a pig feed for relieving muscle oxidative damage of piglets and a preparation method of the pig feed, and belongs to the field of pig feeds. Comprising the following components in parts by weight: 40-50 parts of corn, 15-20 parts of soybean meal, 5-10 parts of fish meal, 1-2 parts of soybean oil, 1-2 parts of fish oil, 1.2-1.5 parts of calcium hydrogen phosphate, 0.3-0.5 part of table salt, 1-1.5 parts of mixed amino acid and 1.5-2 parts of a compound antioxidant. According to the pig feed disclosed by the invention, various vitamins, amino acids and the compound antioxidant are added into the pig feed, so that free radicals in a muscle cell environment are neutralized, oxidative damage of muscle cells is relieved, and meanwhile, the amino acids can enhance synthesis of endogenous antioxidant enzymes, improve the antioxidant capacity of the muscle cells and reduce oxidative stress generation.

Description

Technical Field

[0001] The invention belongs to the technical field of pig feed, and specifically refers to a pig feed capable of alleviating oxidative damage to piglet muscles and a preparation method thereof. Background Art

[0002] Muscle oxidative damage is a common problem in piglet breeding. The root cause of muscle oxidative damage is the excessive accumulation of reactive oxygen species (ROS). ROS is a byproduct of cell metabolism and is highly reactive. Under normal circumstances, the body's antioxidant system (including enzymes such as superoxide dismutase SOD, catalase CAT, and non-enzymatic antioxidants such as vitamin E, vitamin C, glutathione, etc.) can effectively remove these ROS and maintain the body's redox balance. When ROS are produced excessively or the antioxidant system cannot remove them in time, the body will be in a state of oxidative stress, leading to oxidative damage. This oxidative damage will damage proteins, lipids and DNA, and then affect the function and structure of muscle tissue. In the piglet stage, especially after birth and weaning, due to the increase in metabolic demand and the incomplete development of the antioxidant system, the problem of oxidative damage is particularly prominent. Piglets experience rapid growth and development after birth, and their metabolic activities are very active, especially in muscle cells. Mitochondria, as the center of energy metabolism, will generate a large amount of ATP and also produce ROS. As metabolic demands increase, the rate of ROS generation will also increase. If the antioxidant system cannot cope with this level of ROS, oxidative damage will occur. Weaning is a critical turning point in the piglet breeding process. At this time, piglets not only have to adapt to the transition from breast milk to solid feed, but also face drastic changes in the intestinal microbiome, increased pressure on the immune system, and stress responses from the external environment; all of these factors are likely to trigger the body's oxidative stress response, which in turn leads to muscle oxidative damage. Antioxidant nutrients in feed, such as vitamin E and selenium, play an important role in preventing oxidative stress. If these antioxidant substances are not supplied in the feed, the piglets lack sufficient antioxidant protection, resulting in the accumulation of ROS in the body and causing oxidative damage. In addition, insufficient or unbalanced intake of protein and amino acids will also weaken the body's antioxidant capacity and increase the risk of oxidative damage. Summary of the invention

[0003] In view of the above situation, in order to overcome the defects of the prior art, the present invention provides a pig feed for alleviating oxidative damage to piglet muscles and a preparation method thereof. The present invention neutralizes free radicals in the muscle cell environment and reduces oxidative damage to muscle cells by adding multiple vitamins, amino acids and composite antioxidants to pig feed. At the same time, amino acids can enhance the synthesis of endogenous antioxidant enzymes, improve the antioxidant capacity of muscle cells, and reduce the occurrence of oxidative stress.

[0004] In order to achieve the above-mentioned purpose, the technical scheme adopted by the present invention is as follows: The present invention proposes a pig feed for alleviating oxidative damage of piglet muscles and a preparation method thereof, wherein the pig feed comprises the following components in parts by weight: 40-50 parts of corn, 15-20 parts of soybean meal, 5-10 parts of fish meal, 1-2 parts of soybean oil, 1-2 parts of fish oil, 1.2-1.5 parts of calcium hydrogen phosphate, 0.3-0.5 parts of salt, 1-1.5 parts of mixed amino acids, and 1.5-2 parts of composite antioxidants;

[0005] Preferably, the pig feed further comprises the following components calculated by specific gravity per kilogram: vitamin A 20-25 mg / kg, vitamin D 0.05-0.1 mg / kg, vitamin B1 10-15 mg / kg, vitamin B2 3-5 mg / kg, vitamin E 5-10 mg / kg, choline 300-500 mg / kg, folic acid 200-300 mg / kg, pantothenic acid 10-15 mg / kg;

[0006] Preferably, the amino acid mixture comprises the following components in parts by weight: 0.3-0.5 parts of lysine and 0.5-0.7 parts of methionine;

[0007] Preferably, the raw materials for preparing the composite antioxidant include the following components in parts by weight: NH 2 -PLA 1-1.5 parts, glutamic acid-NCA 0.5-0.8 parts, histidine-NCA 0.3-0.5 parts, zinc chloride 0.2-0.4 parts, antioxidant active ingredients 1.5-2.5 parts;

[0008] Preferably, the antioxidant active ingredients include the following components in parts by weight: 1-2 parts of rosemary extract and 2-3 parts of grape seed extract;

[0009] Preferably, the preparation method of the composite antioxidant comprises the following steps:

[0010] S1. Place L-glutamic acid in a flask, add anhydrous tetrahydrofuran, mix well and introduce nitrogen, add triphosgene under nitrogen atmosphere, raise the reaction temperature to 50-60°C, stir the reaction at 150-180rpm, react for 2-3h, transfer the reaction system to n-hexane for sedimentation treatment, filter, recrystallize with ethyl acetate, and drain the solvent under reduced pressure to obtain glutamic acid-NCA;

[0011] Preferably, in step S1, the mass concentration of L-glutamic acid in anhydrous tetrahydrofuran is 60-80 g / L;

[0012] Preferably, in step S1, the mass ratio between L-glutamic acid and triphosgene is 1:1.2-1.5;

[0013] S2, L-histidine was placed in a flask, anhydrous tetrahydrofuran was added, nitrogen was introduced after mixing evenly, triphosgene was added under nitrogen atmosphere, the reaction temperature was increased to 50-60°C, the reaction was stirred at a speed of 150-180rpm, the reaction was continued for 1-2h, the reaction was continued until the reaction system solution was clear, the reaction system was transferred to n-hexane for sedimentation treatment, filtered, recrystallized with ethyl acetate, and the solvent was drained under reduced pressure to obtain histidine-NCA;

[0014] Preferably, in step S2, the mass concentration of L-histidine in anhydrous tetrahydrofuran is 60-80 g / L;

[0015] Preferably, in step S2, the mass ratio between L-histidine and triphosgene is 1:1.2-1.5;

[0016] S3, dissolving polylactic acid in 1,4-dioxane, adding ethylenediamine aqueous solution, mixing evenly, reacting at room temperature for 30-40 minutes, adding anhydrous ether for precipitation, standing overnight, filtering, washing the precipitate with anhydrous ethanol and deionized water, and vacuum drying to obtain NH 2 -PLA;

[0017] Preferably, in step S3, the mass concentration of the polylactic acid in 1,4-dioxane is 10-15 g / L;

[0018] Preferably, in step S3, the mass concentration of ethylenediamine in the ethylenediamine aqueous solution is 5-7 g / L;

[0019] Preferably, in step S3, the added volume of the ethylenediamine aqueous solution is 10%-12% of the volume of 1,4-dioxane;

[0020] S4, the NH prepared in step S3 2 -After the water in PLA is removed, anhydrous DMF is added to dissolve it, and after mixing to form a uniform reaction system, the glutamic acid-NCA prepared in step S1 and the histidine-NCA prepared in step S2 are added, and the mixture is evacuated until no bubbles are generated, and nitrogen is introduced, and the reaction temperature is increased to 35-40°C. After stirring at a speed of 150-180 rpm for 70-80 hours, anhydrous ether is used for precipitation treatment, and after filtering, it is dissolved in DMF, and then placed in a dialysis bag for dialysis treatment with deionized water, and freeze-dried to obtain PLA-polyamino acid;

[0021] Preferably, in step S4, the NH 2 -The mass concentration of PLA in DMF is 0.02-0.05 g / mL;

[0022] S5, dissolving the PLA-polyamino acid prepared in step S4 in anhydrous ethanol, adding zinc chloride solution, stirring at 280-320 rpm for 4-6 hours at room temperature, centrifuging at 8000-10000 rpm for 10-15 minutes, removing the supernatant, washing the precipitate with deionized water and anhydrous ethanol, and vacuum drying to obtain a PLA-polyamino acid-Zn complex;

[0023] Preferably, in step S5, the mass concentration of the PLA-polyamino acid in anhydrous ethanol is 7-12 g / L;

[0024] Preferably, in step S5, the mass fraction of zinc chloride in deionized water in the zinc chloride solution is 5-10%;

[0025] S6, dissolving the PLA-polyamino acid-Zn complex prepared in step S5 in DMSO, adding the antioxidant active ingredient solution, stirring at 400-500 rpm, stirring and mixing at room temperature for 4-6 hours, and then dropping into PBS buffer at a rate of 1 mL / min. After the dropwise addition is completed, stirring and reacting for 1-2 hours, placing in a dialysis bag, dialyzing with PBS buffer, removing DMSO, and freeze-drying to obtain a composite antioxidant;

[0026] Preferably, in step S6, the mass concentration of the PLA-polyamino acid-Zn complex in DMSO is 15-20 g / L;

[0027] Preferably, in step S6, the mass concentration of the antioxidant active ingredient in the antioxidant active ingredient solution in DMSO is 15-30 g / L.

[0028] The present invention also provides a method for preparing a pig feed for alleviating oxidative damage to piglet muscles, which specifically comprises the following steps:

[0029] ①, Place corn and soybean meal in a feed grinder, crush them, mix them with fish meal, soybean oil, and fish oil, add calcium hydrogen phosphate, salt, mixed amino acids, and compound antioxidants, mix them, and obtain prefabricated feed;

[0030] ②. Place the pre-treated feed prepared in step S1 in a pelletizer for pelleting and drying to obtain pig feed that alleviates oxidative damage to piglet muscles.

[0031] The beneficial effects achieved by the present invention are as follows:

[0032] The invention provides a pig feed for alleviating oxidative damage of piglet muscles and a preparation method thereof. The invention neutralizes free radicals in the muscle cell environment by adding multiple vitamins, amino acids and composite antioxidants to the pig feed, thereby alleviating the oxidative damage of the muscle cells. Meanwhile, the amino acids can enhance the synthesis of endogenous antioxidant enzymes, improve the antioxidant capacity of the muscle cells, and reduce the generation of oxidative stress. The invention introduces stable organic zinc and antioxidant components extracted from multiple plants into the feed by preparing the composite antioxidant. The antioxidant active components include rosemary extract and grape seed extract, which have multiple antioxidant active components. Rosemary includes multiple antioxidant components such as caffeic acid, basilic acid, and flavonoids. The grape seed extract includes a composite substance of multiple grape polyphenols, which has strong antioxidant activity. The bioavailability of organic zinc in a living body is high. Zinc is an essential component of many antioxidant enzymes. Increasing the zinc ion concentration in the body can enhance the activity of the antioxidant enzymes. Zinc can activate the PI3K / Akt signaling pathway, which plays an important role in cell survival, proliferation and metabolism, and can help cells cope with oxygen by increasing the expression of antioxidant enzymes. Chemical stress; the composite antioxidant prepared by the present invention uses glutamic acid and histidine as monomers to form a copolymer of polylactic acid and polyamino acid. In an environment with a low pH value, such as the stomach, the degradation rate is slow, while in a moderately alkaline environment, such as the intestine, the degradation rate is accelerated. The composite antioxidant of the present invention can form a sustained-release effect through the degradation of the carrier in the intestinal environment; the polyamino acid with histidine as the polymerization monomer has an imidazole group on one side, which can improve the binding performance with zinc and increase the zinc loading amount. When the imidazole-zinc combination form is placed in the body environment, the oxidative stress in the body is Under the excited state, free radicals change the oxidation state of zinc ions, affecting the binding of zinc to imidazole groups, thereby dissociating the imidazole-zinc binding state and releasing zinc ions, thereby activating the PI3K / Akt signaling pathway, which plays an important role in cell survival, proliferation and metabolism, and can help cells cope with oxidative stress by increasing the expression of antioxidant enzymes; after using glutamate as a polymerization monomer, introducing active carboxyl side chains into the polymer molecular chain can increase the intermolecular force between the hydroxyl and amino groups in the antioxidant active ingredients, thereby enhancing its loading capacity for antioxidant active ingredients. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is a microscopic morphology of the composite antioxidant prepared in Example 1;

[0034] Figure 2 This is an enlarged microscopic morphology of the composite antioxidant prepared in Example 1;

[0035] Figure 3 The in vitro drug release results of the composite antioxidants described in Examples 1-3 and Comparative Examples 1-3 of the present invention are shown;

[0036] Figure 4 This is a graph showing the results of the pig feed prepared in Examples 1-3 of the present invention and Comparative Examples 1-3 in alleviating muscle oxidation in piglets;

[0037] Figure 5 This is a graph showing the effects of the pig feed prepared in Examples 1-3 of the present invention and Comparative Examples 1-3 on MyoD and Foxo1.

[0038] The accompanying drawings are used to provide further understanding of the present invention and constitute a part of the specification. They are used to explain the present invention together with the embodiments of the present invention and do not constitute a limitation of the present invention. DETAILED DESCRIPTION

[0039] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments; based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0040] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only and are not intended to limit the content of this application.

[0041] The experimental methods in the following examples are conventional methods unless otherwise specified; the experimental materials and test strains used in the following examples are purchased from commercial channels unless otherwise specified.

[0042] Grape seed extract was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., catalog number G304766;

[0043] Rosemary extract was purchased from Shanghai Yien Chemical Technology Co., Ltd. with the product number R202135.

[0044] Example 1

[0045] The present embodiment provides a pig feed for alleviating oxidative damage in piglet muscles, the pig feed comprising the following components in parts by weight: 40 parts of corn, 20 parts of soybean meal, 10 parts of fish meal, 1 part of soybean oil, 1 part of fish oil, 1.5 parts of calcium hydrogen phosphate, 0.3 parts of salt, 1 part of mixed amino acids, and 2 parts of composite antioxidants;

[0046] The pig feed also includes the following components calculated by specific weight per kilogram: vitamin A 20mg / kg, vitamin D 0.1mg / kg, vitamin B1 15mg / kg, vitamin B2 3mg / kg, vitamin E 10mg / kg, choline 500mg / kg, folic acid 200mg / kg, pantothenic acid 10mg / kg;

[0047] The mixed amino acid comprises the following components in parts by weight: 0.5 parts of lysine and 0.5 parts of methionine;

[0048] The raw materials for preparing the composite antioxidant include the following components in parts by weight: NH 2 -PLA 1 part, glutamic acid-NCA 0.5 part, histidine-NCA 0.3 part, zinc chloride 0.2 part, antioxidant active ingredient 1.5 parts;

[0049] The antioxidant active ingredients include the following components in parts by weight: 1 part of rosemary extract and 2 parts of grape seed extract;

[0050] The present invention also provides a preparation method for alleviating piglet muscle oxidative damage, which specifically comprises the following steps:

[0051] ①, Place corn and soybean meal in a feed grinder, crush them, mix them with fish meal, soybean oil, and fish oil, add calcium hydrogen phosphate, salt, mixed amino acids, and compound antioxidants, mix them, and obtain prefabricated feed;

[0052] ②, placing the pre-treated feed prepared in step S1 in a pelletizer for pelleting, and drying to obtain pig feed that alleviates oxidative damage to piglet muscles;

[0053] The preparation method of the composite antioxidant specifically comprises the following steps:

[0054] S1. Add 250 mL of anhydrous tetrahydrofuran to a flask, evacuate until no bubbles are generated, continue to introduce nitrogen into the reaction environment, accurately weigh 15 g of L-glutamic acid and add it to the flask, stir at 150 rpm, add 9 g of triphosgene, mix well, raise the reaction temperature to 55 ° C, continue to stir and react for 1 hour, add 9 g of triphosgene, continue to stir and react for 1 hour, stop adding after the reaction solution gradually becomes clear, concentrate the reaction system to 20% of the original volume, add pre-cooled n-hexane to the reaction system for sedimentation, filter, collect the precipitate, dissolve it in 50 mL of ethyl acetate for recrystallization, place it in a nitrogen environment, dry it, remove excess solvent, and obtain glutamic acid-NCA;

[0055] S2, add 250mL of anhydrous tetrahydrofuran to a flask, evacuate until no bubbles are generated, continue to introduce nitrogen into the reaction environment, accurately weigh 15g of L-histidine and add it to the flask, place it under stirring at 150rpm, add 9g of triphosgene, mix well, increase the reaction temperature to 55°C, continue to stir the reaction for 1h, add 9g of triphosgene, continue to stir the reaction for 1h, stop adding after the reaction solution gradually becomes clear, concentrate the reaction system to 20% of the original volume, add pre-cooled n-hexane to the reaction system for sedimentation, filter, collect the precipitate, dissolve it in 50mL of ethyl acetate for recrystallization, place it in a nitrogen environment, dry it, remove excess solvent, and obtain histidine-NCA;

[0056] S3, accurately weigh 10g of polylactic acid and dissolve it in 1L of 1,4-dioxane to obtain a polylactic acid solution, accurately weigh 0.6g of ethylenediamine and dissolve it in 100mL of deionized water to obtain an ethylenediamine aqueous solution, take 100mL of the polylactic acid solution, add 10mL of the ethylenediamine aqueous solution, stir and react at 150rpm under room temperature, react for 30min, add anhydrous ether for precipitation, let it stand overnight, filter, wash the precipitate repeatedly with anhydrous ethanol and deionized water three times in sequence, and dry it in vacuum at 30°C to obtain NH 2 -PLA;

[0057] S4, accurately weigh the NH prepared in step S3 2 1 g of -PLA was placed in a beaker, 100 mL of toluene was added to fully dissolve it, the temperature was raised to 120 °C, and water in the reactant was removed by azeotropy. After the toluene was removed by vacuum concentration, 50 mL of DMF solvent was added to dissolve NH 2 -PLA is dissolved, 0.5 g of glutamic acid-NCA prepared in step S1 and 0.3 g of histidine-NCA prepared in step S2 are accurately weighed, added to the reaction system, mixed evenly, evacuated until no bubbles appear, and nitrogen is continuously introduced. Under a nitrogen atmosphere, the reaction temperature is raised to 35°C, and the reaction is stirred at 150 rpm for 80 h, and then precipitated with pre-cooled anhydrous ether. After filtering, the precipitate is dissolved with 30 mL of DMF, placed in a dialysis bag with a cutoff of 2500 Da, and dialyzed with deionized water. After dialysis for 3 days, freeze-dried to obtain PLA-polyamino acid;

[0058] S5, dissolving the PLA-polyamino acid prepared in step S4 in 200 mL of anhydrous ethanol, accurately weighing 1 g of zinc chloride and dissolving it in 10 mL of deionized water, taking 2 mL and dropping it into the reaction system, stirring the mixture at 300 rpm for 5 h at room temperature, centrifuging it at 10,000 rpm for 10 min, discarding the supernatant, washing the lower precipitate with deionized water and anhydrous ethanol, and vacuum drying it at 35° C. for 5 h to obtain a PLA-polyamino acid-Zn complex;

[0059] S6. Dissolve the PLA-amino acid-Zn complex prepared in step S5 in 100 mL of DMSO solvent, prepare to weigh 1.5 g of antioxidant active ingredient and dissolve it in 100 mL of DMSO solvent to prepare an antioxidant active ingredient solution, add it to the reaction system and mix it thoroughly, stir it at 500 rpm at room temperature for 5 hours, and then add it dropwise to PBS buffer (pH=7.3) at a rate of 1 mL / min. Stir continuously during the dropwise addition. After the dropwise addition is completed, increase the stirring speed to 1000 rpm, continue stirring for 1 hour, and then transfer the reaction system to a dialysis bag with a molecular retention capacity of 1000 Da. Dialysis is performed with PBS buffer, and the water is changed every 4 hours to remove unreacted compounds and solvents. After dialysis for 24 hours, freeze-drying is performed to obtain a composite antioxidant.

[0060] The morphology of the prepared particles was observed using a Zeiss-Supra 55 field emission scanning electron microscope. The dried microspheres were ground and coated on a sample stage, sprayed with gold, and observed under a scanning electron microscope. Figure 1 This is a microscopic morphology of the composite antioxidant prepared in Example 1. As shown in the figure, the composite antioxidant is spherical and the particle surface has a rough structure. The figure is further shown. Figure 2 This is an enlarged microscopic morphology of the composite antioxidant prepared in Example 1. As shown in the figure, the surface of the composite antioxidant is rough. The antioxidant has an imidazole group and a Zn 2+ The formed nanostructure causes the surface of the composite antioxidant to have a protruding structure.

[0061] Example 2

[0062] The present embodiment provides a pig feed for alleviating oxidative damage in piglet muscles, the pig feed comprising the following components in parts by weight: 50 parts of corn, 15 parts of soybean meal, 8 parts of fish meal, 2 parts of soybean oil, 1 part of fish oil, 1.2 parts of calcium hydrogen phosphate, 0.5 parts of salt, 1.5 parts of mixed amino acids, and 1.5 parts of composite antioxidants;

[0063] The pig feed also includes the following components calculated by specific weight per kilogram: vitamin A 25mg / kg, vitamin D 0.05mg / kg, vitamin B1 10mg / kg, vitamin B2 4mg / kg, vitamin E 5mg / kg, choline 300mg / kg, folic acid 300mg / kg, pantothenic acid 15mg / kg;

[0064] The amino acid mixture includes the following components in parts by weight: 0.3 parts of lysine and 0.7 parts of methionine;

[0065] The raw materials for preparing the composite antioxidant include the following components in parts by weight: NH 2 -PLA 1.2 parts, glutamic acid-NCA 0.7 parts, histidine-NCA 0.4 parts, zinc chloride 0.3 parts, antioxidant active ingredients 2.0 parts;

[0066] The antioxidant active ingredients include the following components in parts by weight: 2 parts of rosemary extract and 3 parts of grape seed extract;

[0067] The present invention also provides a preparation method for alleviating piglet muscle oxidative damage, which specifically comprises the following steps:

[0068] ①, Place corn and soybean meal in a feed grinder, crush them, mix them with fish meal, soybean oil, and fish oil, add calcium hydrogen phosphate, salt, mixed amino acids, and compound antioxidants, mix them, and obtain prefabricated feed;

[0069] ②, placing the pre-treated feed prepared in step S1 in a pelletizer for pelleting, and drying to obtain pig feed that alleviates oxidative damage to piglet muscles;

[0070] The preparation method of the composite antioxidant specifically comprises the following steps:

[0071] S1. Add 200 mL of anhydrous tetrahydrofuran to a flask, evacuate until no bubbles are generated, continue to introduce nitrogen into the reaction environment, accurately weigh 16 g of L-glutamic acid and add it to the flask, stir at 150 rpm, add 10 g of triphosgene, mix well, raise the reaction temperature to 50 ° C, continue to stir and react for 2 hours, add 14 g of triphosgene, continue to stir and react for 1 hour, stop adding after the reaction solution gradually becomes clear, concentrate the reaction system to 20% of the original volume, add pre-cooled n-hexane to the reaction system for sedimentation, filter, collect the precipitate, dissolve it in 50 mL of ethyl acetate for recrystallization, place it in a nitrogen environment, dry it, remove excess solvent, and obtain glutamic acid-NCA;

[0072] S2, add 200mL of anhydrous tetrahydrofuran to a flask, evacuate until no bubbles are generated, continue to introduce nitrogen into the reaction environment, accurately weigh 16g of L-histidine and add it to the flask, place it under stirring at 150rpm, add 10g of triphosgene, mix well, increase the reaction temperature to 50°C, continue stirring and reacting for 2h, add 14g of triphosgene, continue stirring and reacting for 1h, stop adding after the reaction solution gradually becomes clear, concentrate the reaction system to 20% of the original volume, add pre-cooled n-hexane to the reaction system for sedimentation, filter, collect the precipitate, dissolve it in 50mL of ethyl acetate for recrystallization, place it in a nitrogen environment, dry it, remove excess solvent, and obtain histidine-NCA;

[0073] S3, accurately weigh 12.5g of polylactic acid and dissolve it in 1L of 1,4-dioxane to obtain a polylactic acid solution, accurately weigh 0.5g of ethylenediamine and dissolve it in 100mL of deionized water to obtain an ethylenediamine aqueous solution, take 100mL of the polylactic acid solution, add 11mL of the ethylenediamine aqueous solution, stir and react at room temperature at a speed of 150rpm, react for 35min, add anhydrous ether for precipitation, let it stand overnight, filter, wash the precipitate repeatedly with anhydrous ethanol and deionized water three times in sequence, and dry it in vacuum at 30°C to obtain NH 2 -PLA;

[0074] S4, accurately weigh the NH prepared in step S3 2 -PLA 1.2g was placed in a beaker, 100mL of toluene was added to fully dissolve it, the temperature was raised to 120°C, azeotropy was performed to remove the water in the reactants, and after decompression and concentration to remove toluene, 40mL of DMF solvent was added to NH 2 -PLA is dissolved, 0.7 g of glutamic acid-NCA prepared in step S1 and 0.4 g of histidine-NCA prepared in step S2 are accurately weighed, added to the reaction system, mixed evenly, evacuated until no bubbles appear, and nitrogen is continuously introduced. Under a nitrogen atmosphere, the reaction temperature is increased to 40°C, and the reaction is stirred at 180 rpm for 70 h, and then precipitated with pre-cooled anhydrous ether. After filtering, the precipitate is dissolved with 30 mL of DMF, placed in a dialysis bag with a cutoff of 2500 Da, and dialyzed with deionized water. After dialysis for 3 days, freeze-dried to obtain PLA-polyamino acid;

[0075] S5, dissolving the PLA-polyamino acid prepared in step S4 in 200 mL of anhydrous ethanol, accurately weighing 1 g of zinc chloride and dissolving it in 10 mL of deionized water, taking 3 mL and dropping it into the reaction system, stirring the reaction at 280 rpm for 6 h at room temperature, centrifuging at 9000 rpm for 15 min, discarding the supernatant, washing the lower precipitate with deionized water and anhydrous ethanol, and vacuum drying at 35° C. for 5 h to obtain a PLA-polyamino acid-Zn complex;

[0076] S6. Dissolve the PLA-amino acid-Zn complex prepared in step S5 in 95 mL of DMSO solvent, weigh 2 g of antioxidant active ingredients and dissolve them in 100 mL of DMSO solvent to prepare an antioxidant active ingredient solution, add it to the reaction system and mix it thoroughly, stir it at 400 rpm at room temperature for 6 hours, and then add it dropwise to PBS buffer (pH=7.3) at a rate of 1 mL / min. Stir continuously during the addition process. After the addition is completed, increase the stirring speed to 1200 rpm, continue stirring for 2 hours, and then transfer the reaction system to a dialysis bag with a molecular retention capacity of 1000 Da. Dialysis is performed with PBS buffer, and the water is changed every 4 hours to remove unreacted compounds and solvents. After dialysis for 24 hours, freeze-drying is performed to obtain a composite antioxidant.

[0077] Example 3

[0078] The present embodiment provides a pig feed for alleviating oxidative damage in piglet muscles, the pig feed comprising the following components in parts by weight: 45 parts of corn, 18 parts of soybean meal, 5 parts of fish meal, 2 parts of soybean oil, 1 part of fish oil, 1.3 parts of calcium hydrogen phosphate, 0.4 parts of salt, 1 part of mixed amino acids, and 2 parts of composite antioxidants;

[0079] Pig feed also includes the following components calculated by specific weight per kilogram: vitamin A 2mg / kg, vitamin D 0.1mg / kg, vitamin B1 15mg / kg, vitamin B2 3mg / kg, vitamin E 10mg / kg, choline 500mg / kg, folic acid 200mg / kg, pantothenic acid 10mg / kg;

[0080] The mixed amino acid comprises the following components in parts by weight: 0.5 parts of lysine and 0.5 parts of methionine;

[0081] The raw materials for preparing the composite antioxidant include the following components in parts by weight: NH 2 -PLA 1.5 parts, glutamic acid-NCA 0.8 parts, histidine-NCA 0.5 parts, zinc chloride 0.4 parts, antioxidant active ingredients 2.5 parts;

[0082] The antioxidant active ingredients include the following components in parts by weight: 2 parts of rosemary extract and 2 parts of grape seed extract;

[0083] The present invention also provides a preparation method for alleviating piglet muscle oxidative damage, which specifically comprises the following steps:

[0084] ①, Place corn and soybean meal in a feed grinder, crush them, mix them with fish meal, soybean oil, and fish oil, add calcium hydrogen phosphate, salt, mixed amino acids, and compound antioxidants, mix them, and obtain prefabricated feed;

[0085] ②, placing the pre-treated feed prepared in step S1 in a pelletizer for pelleting, and drying to obtain pig feed that alleviates oxidative damage to piglet muscles;

[0086] The preparation method of the composite antioxidant specifically comprises the following steps:

[0087] S1. Add 150 mL of anhydrous tetrahydrofuran to a flask, evacuate until no bubbles are generated, continue to introduce nitrogen into the reaction environment, accurately weigh 10 g of L-glutamic acid and add it to the flask, stir at 150 rpm, add 7 g of triphosgene, mix well, raise the reaction temperature to 60 ° C, continue to stir and react for 1.5 hours, add 7 g of triphosgene, continue to stir and react for 1 hour, stop adding after the reaction solution gradually becomes clear, concentrate the reaction system to 20% of the original volume, add pre-cooled n-hexane to the reaction system for sedimentation, filter, collect the precipitate, dissolve it in 50 mL of ethyl acetate for recrystallization, place it in a nitrogen environment, dry it, remove excess solvent, and obtain glutamic acid-NCA;

[0088] S2, add 150mL of anhydrous tetrahydrofuran to a flask, evacuate until no bubbles are generated, continue to introduce nitrogen into the reaction environment, accurately weigh 10g of L-histidine and add it to the flask, place it under stirring at 150rpm, add 7g of triphosgene, mix well, increase the reaction temperature to 60°C, continue stirring and reacting for 1.5h, add 7g of triphosgene, continue stirring and reacting for 1h, stop adding after the reaction solution gradually becomes clear, concentrate the reaction system to 20% of the original volume, add pre-cooled n-hexane to the reaction system for sedimentation, filter, collect the precipitate, dissolve it in 50mL of ethyl acetate for recrystallization, place it in a nitrogen environment, dry it, remove excess solvent, and obtain histidine-NCA;

[0089] S3, accurately weigh 15g of polylactic acid and dissolve it in 1L of 1,4-dioxane to obtain a polylactic acid solution, accurately weigh 0.7g of ethylenediamine and dissolve it in 100mL of deionized water to obtain an ethylenediamine aqueous solution, take 100mL of the polylactic acid solution, add 12mL of the ethylenediamine aqueous solution, stir and react at room temperature at a speed of 150rpm, react for 40min, add anhydrous ether for precipitation treatment, let it stand overnight, filter, wash the precipitate repeatedly with anhydrous ethanol and deionized water three times in sequence, and vacuum dry it at 30°C to obtain NH 2 -PLA;

[0090] S4, accurately weigh the NH prepared in step S3 2 -PLA 1.5g was placed in a beaker, 100mL of toluene was added to fully dissolve it, the temperature was raised to 120°C, azeotropy was performed to remove the water in the reactants, and after the toluene was removed by vacuum concentration, 30mL of DMF solvent was added to NH 2 -PLA is dissolved, 0.8 g of glutamic acid-NCA prepared in step S1 and 0.5 g of histidine-NCA prepared in step S2 are accurately weighed, added to the reaction system, mixed evenly, evacuated until no bubbles appear, and nitrogen is continuously introduced. Under a nitrogen atmosphere, the reaction temperature is increased to 40°C, and the reaction is stirred at 180 rpm for 72 hours, and then precipitated with pre-cooled anhydrous ether. After filtering, the precipitate is dissolved with 30 mL of DMF, placed in a dialysis bag with a cutoff of 2500 Da, and dialyzed with deionized water. After dialysis for 3 days, freeze-dried to obtain PLA-polyamino acid;

[0091] S5, dissolving the PLA-polyamino acid prepared in step S4 in 200 mL of anhydrous ethanol, accurately weighing 1 g of zinc chloride and dissolving it in 20 mL of deionized water, taking 8 mL and dropping it into the reaction system, stirring at 320 rpm for 4 h at room temperature, centrifuging at 8000 rpm for 15 min, discarding the supernatant, washing the lower precipitate with deionized water and anhydrous ethanol, and vacuum drying at 35° C. for 5 h to obtain a PLA-polyamino acid-Zn complex;

[0092] S6. Dissolve the PLA-amino acid-Zn complex prepared in step S5 in 120 mL of DMSO solvent, prepare to weigh 2.5 g of antioxidant active ingredients and dissolve them in 80 mL of DMSO solvent to prepare an antioxidant active ingredient solution, add it to the reaction system and mix it thoroughly, stir it at 450 rpm at room temperature for 5 hours, and then add it dropwise to PBS buffer (pH=7.3) at a rate of 1 mL / min. Stir continuously during the addition process. After the addition is completed, increase the stirring speed to 1500 rpm, continue stirring for 1.5 hours, and then transfer the reaction system to a dialysis bag with a molecular retention capacity of 1000 Da. Dialysis is performed with PBS buffer, and the water is changed every 4 hours to remove unreacted compounds and solvents. After dialysis for 24 hours, freeze-drying is performed to obtain a composite antioxidant.

[0093] Comparative Example 1

[0094] This comparative example provides a pig feed and a preparation method thereof, which is different from Example 1 only in that the composite antioxidant component is replaced by polylactic acid with the same mass fraction of NH 2 -PLA, and the other components and component contents are the same as those in Example 1.

[0095] Comparative Example 2

[0096] This comparative example provides a pig feed and a preparation method thereof, which is different from Example 1 only in that the composite antioxidant comprises the following components in parts by weight: NH 2 -PLA 1.2 parts, glutamic acid-NCA 0.5 parts, histidine-NCA 0.3 parts, antioxidant active ingredients 1.5 parts, and the remaining components and component contents are the same as in Example 1.

[0097] Comparative Example 3

[0098] This comparative example provides a pig feed and a preparation method thereof, which is different from Example 1 only in that histidine-NCA is not included in the composite antioxidant, and the remaining components and component contents are the same as those in Example 1.

[0099] Experimental Example 1

[0100] In this experimental example, the composite antioxidant prepared by the embodiment 1-3 and the comparative example 1-3 is subjected to an in vitro drug release experiment. The composite antioxidant prepared by the present invention contains a variety of active substances, among which the component with a higher content and the most effective against free radicals is a polyphenolic substance. In this experimental example, the Foley-phenol method is adopted, and the polyphenolic substance is quantitatively determined by a spectrophotometer through a blue complex formed by a Folin reagent and a polyphenolic substance. The specific steps include: taking the composite antioxidant prepared by the embodiment 1-3 and the comparative example 1-3 and placing it in 10mL of deionized water, shaking it in a water bath at 35°C and 150rpm to completely dissolve the composite antioxidant in the deionized water, transferring it to a dialysis bag with a retention capacity of 5000Da, placing the dialysis bag in a PBS buffer, shaking it at 37°C and 200rpm, sampling at time points, and measuring the total polyphenol concentration in the external liquid at a wavelength of 765nm by a spectrophotometer, and calculating the cumulative drug release rate according to the following formula:

[0101] Cumulative release rate (%) = ×100%;

[0102] Wherein, Vs is the volume of the sustained-release solution in the external solution, mL; Ct is the concentration of total polyphenols in the external solution at time t, mg / L; V is the sampling volume, mL; is the sum of the concentrations of total polyphenols before time t, mg / L; Vg is the volume in the dialysis bag, mL; Cg is the concentration of total polyphenols in the dialysis bag, mg / L;

[0103] Figure 3 The in vitro drug release results of the composite antioxidants described in Examples 1-3 and Comparative Examples 1-3 of the present invention are shown in the figure. As shown in the figure, the composite antioxidants prepared in Examples 1-3 have a faster release rate within 12 hours than after 12 hours. After 12 hours, the composite antioxidants prepared by the present invention still maintain a certain release level. Compared with Comparative Example 1, the composite antioxidants prepared by the present invention use amino-modified polylactic acid. The amino group can not only be an initiator for the polymerization reaction of amino acids, but also enhance the hydrophilicity of polylactic acid, and make the polylactic acid molecular chain more hydrophilic under the condition of pH being slightly alkaline. The affinity with the environment is high, and the contact area in the environmental medium can be increased, which is beneficial to the release of active substances. In comparative example 1, the affinity of polylactic acid in the environmental medium is poor, resulting in poor drug release and sustained-release effect. Compared with comparative examples 2 and 3, the present invention adopts the form of polylactic acid composite polyamino acid, which improves the drug loading and sustained-release effect of the composite antioxidant, and can maintain the stability and sustained-release effect of the active substance for a long time. The composite antioxidants prepared in comparative examples 2 and 3 basically reach the maximum drug release in 12 hours, resulting in reduced bioavailability of the active substance.

[0104] Experimental Example 2

[0105] In this experimental example, the performance of the pig feed prepared by Examples 1-3 and Comparative Examples 1-3 in alleviating muscle oxidation in piglets was measured. In this experimental example, 21 healthy weaned pigs aged 28 days were selected, and a paraquat-induced oxidative stress model was adopted. Examples 1-3 and Comparative Examples 1-3 were divided into 6 treatment groups, with 3 pigs in each group, and a control group of 3 pigs was set up. The test period was 28 days, and the pigs were fed twice a day in the morning (8:00) and evening (18:00), and they were free to eat and drink water. After the test period of 28 days, the experimental pigs were fasted for 12 hours, and blood was collected from the vein. After centrifugation at 3000 rpm and 4°C for 15 minutes, the blood was used to measure biochemical indicators. The longissimus dorsi muscle samples were cut, quick-frozen in liquid nitrogen, and stored at -80°C.

[0106] The TAOC activity in serum samples was determined using a TAOC detection kit, and the detection method was strictly performed in accordance with the instructions of the kit;

[0107] Figure 4 The results of the pig feed prepared by Examples 1-3 of the present invention and Comparative Examples 1-3 on piglet muscle oxidation relief performance are shown in the figure. As shown in the figure, the pig feed prepared by Examples 1-3 can significantly increase the activity level of TAOC in the blood, and the pig feed prepared by Comparative Examples 1-3 is significantly different from the examples. The present invention regulates the oxidation level in the piglet through multiple pathways, thereby effectively alleviating oxidative stress.

[0108] MyoD is a myogenic regulatory factor, which can activate dormant muscle stem cells and stimulate the main regulatory gene of muscle stem cell proliferation. It can also stimulate other myogenic regulatory factors and stimulate the expression of muscle-specific proteins. After the muscle produces oxidative stress response, MyoD is significantly downregulated.

[0109] The PI3K / Akt signaling pathway can be affected by other growth factors. Activating PI3K / Akt can promote protein synthesis. Foxo1 is a downstream gene of the PI3K / Akt signaling pathway, which has an opposite effect to the mTOR signaling pathway and has a greater impact on protein degradation.

[0110] In this experimental example, the total mRNA of the longissimus dorsi muscle tissue was extracted by using a ribonucleic acid (RNA) extraction kit (TaKaRa, Japan), and the expression of related genes was analyzed by real-time fluorescence quantitative PCR. β-actin was used as the internal reference gene, and the 2-ΔΔCt method was used to calculate the relative expression of the target gene mRNA; the MyoD gene sequence primers included: upstream: AACCCCACTTCTATGACGGG; downstream: TTATCTTCCAGGGGCACTCG; the Foxo1 gene sequence primers included: upstream: GCAAATCGAGTTACGGAGGC; downstream: AATGTCATTATGGGGAGGAGAGT;

[0111] Figure 5 The results of the effects of the pig feed prepared in Examples 1-3 and Comparative Examples 1-3 on MyoD and Foxo1 are shown in the figure. As shown in the figure, the expression of the two genes MoyD and Foxo1 in the piglets fed with the pig feed prepared in Examples 1-3 is uniformly improved, while in Comparative Example 1, polylactic acid is used to replace NH 2 -PLA, resulting in low decomposition of polylactic acid in the body, resulting in decreased activity of zinc and antioxidant active ingredients, while in Comparative Example 2, no new elements were added, resulting in no significant increase in the expression of Foxo1, and at the same time, the composite antioxidant prepared in Comparative Example 3 did not introduce the imidazole group of the histidine side chain, resulting in a significant decrease in the loading amount of zinc element, making the activation effect of zinc on the PI3K / Akt signaling pathway not obvious, resulting in no significant increase in the expression of Foxo1.

[0112] While the embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that many changes, modifications, substitutions and variations can be made to the embodiments without departing from the principles and spirit of the invention.

[0113] The present invention and its implementation methods are described above, which is not restrictive. The drawings are only one of the implementation methods of the present invention, and the actual application is not limited thereto. In short, if ordinary technicians in the field are inspired by it and design methods and embodiments similar to the technical solution without creativity without departing from the purpose of the invention, they should all fall within the protection scope of the present invention.

Claims

1. A pig feed for alleviating oxidative damage in piglet muscles, characterized in that: The pig feed comprises the following components in parts by weight: 40-50 parts of corn, 15-20 parts of soybean meal, 5-10 parts of fish meal, 1-2 parts of soybean oil, 1-2 parts of fish oil, 1.2-1.5 parts of calcium hydrogen phosphate, 0.3-0.5 parts of salt, 1-1.5 parts of mixed amino acids, and 1.5-2 parts of composite antioxidants; the raw materials for preparing the composite antioxidants comprise the following components in parts by weight: 1-1.5 parts of NH2-PLA, 0.5-0.8 parts of glutamic acid-NCA, 0.3-0.5 parts of histidine-NCA, 0.2-0.4 parts of zinc chloride, and 1.5-2.5 parts of antioxidant active ingredients; the antioxidant active ingredients comprise the following components in parts by weight: 1-2 parts of rosemary extract and 2-3 parts of grape seed extract.

2. The pig feed for alleviating oxidative damage to piglet muscles according to claim 1, characterized in that: The pig feed also includes the following components calculated by specific gravity per kilogram: vitamin A 20-25 mg / kg, vitamin D 0.05-0.1 mg / kg, vitamin B1 10-15 mg / kg, vitamin B2 3-5 mg / kg, vitamin E 5-10 mg / kg, choline 300-500 mg / kg, folic acid 200-300 mg / kg, and pantothenic acid 10-15 mg / kg.

3. The pig feed for alleviating oxidative damage to piglet muscles according to claim 2, characterized in that: The mixed amino acid comprises the following components in parts by weight: 0.3-0.5 parts of lysine and 0.5-0.7 parts of methionine.

4. A method for preparing a pig feed for alleviating oxidative damage in piglet muscles according to any one of claims 1 to 3, characterized in that: The specific steps include: ①, Place corn and soybean meal in a feed grinder, crush them, mix them with fish meal, soybean oil, and fish oil, add calcium hydrogen phosphate, salt, mixed amino acids, and compound antioxidants, mix them, and obtain prefabricated feed; ②. Place the pre-treated feed prepared in step S1 in a pelletizer for pelleting and drying to obtain pig feed that alleviates oxidative damage to piglet muscles.

5. The method for preparing a pig feed for alleviating oxidative damage to piglet muscle according to claim 4, characterized in that: The preparation method of the composite antioxidant specifically comprises the following steps: S1. Place L-glutamic acid in a flask, add anhydrous tetrahydrofuran, mix well and introduce nitrogen, add triphosgene under nitrogen atmosphere, raise the reaction temperature to 50-60°C, stir the reaction at 150-180rpm, react for 2-3h, transfer the reaction system to n-hexane for sedimentation treatment, filter, recrystallize with ethyl acetate, and drain the solvent under reduced pressure to obtain glutamic acid-NCA; S2, L-histidine was placed in a flask, anhydrous tetrahydrofuran was added, nitrogen was introduced after mixing evenly, triphosgene was added under nitrogen atmosphere, the reaction temperature was increased to 50-60°C, the reaction was stirred at a speed of 150-180rpm, the reaction was continued for 1-2h, the reaction was continued until the reaction system solution was clear, the reaction system was transferred to n-hexane for sedimentation treatment, filtered, recrystallized with ethyl acetate, and the solvent was drained under reduced pressure to obtain histidine-NCA; S3, dissolving polylactic acid in 1,4-dioxane, adding ethylenediamine aqueous solution, mixing evenly, reacting at room temperature for 30-40 minutes, adding anhydrous ether for precipitation, standing overnight, filtering, washing the precipitate with anhydrous ethanol and deionized water, and vacuum drying to obtain NH2-PLA; S4, after removing the water from the NH2-PLA prepared in step S3, add anhydrous DMF to dissolve, mix to form a uniform reaction system, add the glutamic acid-NCA prepared in step S1 and the histidine-NCA prepared in step S2, evacuate until no bubbles are generated, introduce nitrogen, raise the reaction temperature to 35-40°C, stir the reaction at a speed of 150-180rpm for 70-80h, use anhydrous ether for sedimentation treatment, filter, dissolve in DMF, place in a dialysis bag with deionized water for dialysis treatment, and freeze-dry to obtain PLA-polyamino acid; S5, dissolving the PLA-polyamino acid prepared in step S4 in anhydrous ethanol, adding zinc chloride solution, stirring at 280-320 rpm for 4-6 hours at room temperature, centrifuging at 8000-10000 rpm for 10-15 minutes, removing the supernatant, washing the precipitate with deionized water and anhydrous ethanol, and vacuum drying to obtain a PLA-polyamino acid-Zn complex; S6. Dissolve the PLA-polyamino acid-Zn complex prepared in step S5 in DMSO, add the antioxidant active ingredient solution, stir at 400-500 rpm, stir and mix at room temperature for 4-6 hours, then add dropwise to the PBS buffer at a rate of 1 mL / min. After the addition is complete, continue stirring to react for 1-2 hours, place in a dialysis bag, dialyze with PBS buffer, remove DMSO, and freeze-dry to obtain a composite antioxidant.

6. The method for preparing a pig feed for alleviating oxidative damage to piglet muscle according to claim 5, characterized in that: In step S1, the mass concentration of L-glutamic acid in anhydrous tetrahydrofuran is 60-80 g / L; the mass ratio of L-glutamic acid to triphosgene is 1:1.2-1.5; in step S2, the mass concentration of L-histidine in anhydrous tetrahydrofuran is 60-80 g / L; the mass ratio of L-histidine to triphosgene is 1:1.2-1.

5.

7. The method for preparing a pig feed for alleviating oxidative damage to piglet muscles according to claim 6, characterized in that: In step S3, the mass concentration of the polylactic acid in 1,4-dioxane is 10-15 g / L; the mass concentration of ethylenediamine in the ethylenediamine aqueous solution is 5-7 g / L; and the added volume of the ethylenediamine aqueous solution is 10%-12% of the volume of 1,4-dioxane.

8. The method for preparing a pig feed for alleviating oxidative damage to piglet muscle according to claim 7, characterized in that: In step S4, the mass concentration of NH2-PLA in DMF is 0.02-0.05 g / mL; in step S5, the mass concentration of PLA-polyamino acid in anhydrous ethanol is 7-12 g / L; and the mass fraction of zinc chloride in deionized water in the zinc chloride solution is 5-10%.

9. The method for preparing a pig feed for alleviating oxidative damage to piglet muscles according to claim 8, characterized in that: In step S6, the mass concentration of the PLA-polyamino acid-Zn complex in DMSO is 15-20 g / L; the mass concentration of the antioxidant active ingredient in the antioxidant active ingredient solution in DMSO is 15-30 g / L.

Images