Anti-human CD70 nano antibody for blocking CD70-CD27 signal axis, VHH chain of anti-human CD70 nano antibody and application of anti-human CD70 nano antibody

Abstract

The invention belongs to the field of biological medicine, and relates to an anti-human CD70 nano antibody for blocking a CD70-CD27 signal axis, and a VHH chain and application thereof. The VHH chain comprises a framework region FR and an antigen complementarity determining region CDR, the framework region FR comprises FR1, FR2, FR3 and FR4, and the antigen complementarity determining region CDR comprises CDR1, CDR2 and CDR3; the CDR1, the CDR2 and the CDR3 are separated by the FR1, the FR2, the FR3 and the FR4; wherein the amino acid sequences of the FR1, the FR2, the FR3 and the FR4 are respectively as shown in one of SEQ ID NO: 1 to SEQ ID NO: 107. Compared with a conventional antibody, the anti-CD70 nano antibody disclosed by the invention is small in molecular weight (about 13kDa), high in affinity and relatively good in specificity. An immune checkpoint inhibitor can be developed, and a scheme is provided for tumor treatment.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically, discloses a single domain antibody against CD70 and its derivative protein. Specifically, the present invention discloses a coding sequence and use of an anti-human CD70 nano antibody that blocks the binding of CD70 to CD27, especially in the treatment and / or prevention, or diagnosis of CD70-related diseases (such as tumors, cancer). Background Art

[0002] Immunotherapy based on specific targets in the interdependent interaction between cancer cells and their microenvironment has become a research hotspot in the field of tumor treatment, including immune checkpoint inhibitors such as anti-CTLA-4, anti-PD-1 and anti-PD-L1, and chimeric antigen receptor (CAR) T cells, etc. Many antibody drugs targeting different targets have been approved for clinical use and have achieved good results, and drugs targeting more targets are currently under development.

[0003] Cluster of differentiation 70 (CD70) is a member of the tumor necrosis factor receptor superfamily. It is a type II transmembrane glycoprotein composed of 193 amino acids with a molecular weight of 50 kDa, including an extracellular binding region, a transmembrane region, and a cytoplasmic region. CD70 is mainly expressed in activated T cells, B cells, and mature dendritic cells. The CD70 receptor is CD27. The interaction between CD70 and CD27 can promote the activation, proliferation, and differentiation of T cells and B cells and regulate immune responses. CD27 is expressed in most peripheral T cells, medullary thymocytes, B cells, and NK cells. The interaction between CD70 / CD27 is essential for the activation, proliferation, and maintenance of immune responses of lymphocytes. CD27 inside the cell promotes the proliferation of T cells and the secretion of corresponding cytokines by linking TNF receptor-related molecules TRAF2 and TRAF5 and activating the NF-κB and C-Jun signaling pathways. In addition, CD27 can induce cell apoptosis through the SIVA protein pathway. Finally, CD70 can exert reverse signaling by inducing PI3K / Akt and MEK signaling pathways, regulating cell expansion, differentiation, and effector functions.

[0004] Under normal circumstances, CD70 is mainly expressed in activated lymphocytes. Under pathological conditions, CD70 is abnormally expressed in a variety of hematological malignancies and solid tumors, especially in lymphoma, renal cell carcinoma, glioblastoma, nasopharyngeal carcinoma, and tumors induced by Epstein-Barr virus (EBV) infection. CD70 expression is associated with poor prognosis in a variety of cancers, including glioblastoma, colorectal cancer, B-cell lymphoma, renal cell carcinoma, and breast cancer. The expression rate of CD70 is also high in metastatic tissues, including lung cancer, pancreatic cancer, and osteosarcoma, indicating that this molecule plays a key role in cancer progression. Therefore, CD70 can be used as a potential target for tumor diagnosis and treatment.

[0005] Currently, there are many targeted drugs under development for CD70, including CAR-T cells, monoclonal antibody drugs and ADC, but few antibodies have entered clinical trials. The preparation process of traditional monoclonal antibodies is complicated, the production cost is high, and the molecular weight is large, and the tissue penetration ability is poor. Nanobodies are the smallest fragments known to bind to antigens. They are only 1 / 10 the size of monoclonal antibodies and have structural stability and binding activity comparable to the original heavy chain antibodies. Compared with traditional antibodies, nanobodies have many unique advantages, such as good tissue penetration, rapid clearance, easy production and modification, high stability, low immunogenicity, etc., and are a new type of antibody molecule with great application prospects.

[0006] Nanobodies targeting CD70 targets have not been reported or clinically applied, so there is an urgent need in this field to develop new and effective specific nanobodies targeting CD70 targets. Summary of the invention

[0007] definition

[0008] Unless otherwise indicated or defined, all terms used have the usual meaning in the art, which will be understood by those skilled in the art. In addition, unless otherwise specified, all methods, steps, techniques and operations not specifically described in detail can and have been performed in a manner known per se, which will be understood by those skilled in the art.

[0009] Unless otherwise indicated, the interchangeable terms "antibody" or "immunoglobulin" herein, whether referring to heavy chain antibodies or conventional four-chain antibodies, are used as general terms to include full-length antibodies, their individual chains, and all parts, domains or fragments thereof (including but not limited to antigen binding domains or fragments, such as VHH domains or VH / VL domains, respectively). In addition, the term "sequence" used herein (e.g., in terms of "immunoglobulin sequence", "antibody sequence", "single variable domain sequence", "VHH sequence" or "protein sequence", etc.) is generally understood to include both the relevant amino acid sequence and the nucleic acid sequence or nucleotide sequence encoding the amino acid sequence, unless a more limited explanation is required herein.

[0010] As used herein, the term "immunoglobulin variable domain" refers to an immunoglobulin domain that is essentially composed of four "framework regions" referred to in the art and hereinafter as "framework region 1" or "FR1", "framework region 2" or "FR2", "framework region 3" or "FR3", and "framework region 4" or "FR4", respectively, wherein the framework regions are separated by three "complementarity determining regions" or "CDRs" referred to in the art and hereinafter as "complementarity determining region 1" or "CDR1", "complementarity determining region 2" or "CDR2", and "complementarity determining region 3" or "CDR3". Therefore, the general structure or sequence of an immunoglobulin variable domain can be represented as follows: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. Immunoglobulin variable domains confer specificity to antibodies for antigens by having antigen binding sites.

[0011] The technical problem to be solved by the present invention is to provide a VHH chain of an anti-CD70 nanoantibody that can block the binding of CD70 to its ligand CD27, and its further derivation and application.

[0012] In order to achieve the above-mentioned object, the first aspect of the present invention provides a VHH chain of an anti-human CD70 nanobody that blocks the CD70-CD27 signal axis, comprising a framework region FR and an antigen complementary determining region CDR, wherein the framework region FR comprises FR1, FR2, FR3 and FR4, and the antigen complementary determining region CDR comprises CDR1, CDR2 and CDR3; the CDR1, CDR2 and CDR3 are separated by the FR1, FR2, FR3 and FR4; wherein,

[0013] The amino acid sequence of FR1 is shown in one of SEQ ID NO: 1 to SEQ ID NO: 12;

[0014] The amino acid sequence of CDR1 is shown in one of SEQ ID NO: 13 to SEQ ID NO: 31;

[0015] The amino acid sequence of FR2 is shown in one of SEQ ID NO: 32 to SEQ ID NO: 47;

[0016] The amino acid sequence of CDR2 is shown in one of SEQ ID NO: 48 to SEQ ID NO: 66;

[0017] The amino acid sequence of FR3 is shown in one of SEQ ID NO: 67 to SEQ ID NO: 84;

[0018] The amino acid sequence of CDR3 is shown in one of SEQ ID NO: 85 to SEQ ID NO: 103;

[0019] The amino acid sequence of FR4 is shown in any one of SEQ ID NO: 104 to SEQ ID NO: 107.

[0020] Specifically and preferably, the amino acid sequence of the VHH chain of the anti-human CD70 nanobody is shown in one of SEQ ID NO: 108 to SEQ ID NO: 126.

[0021] The second aspect of the present invention provides an anti-human CD70 nanobody, which is a nanobody targeting the epitope of the human CD70 molecule and comprises the above-mentioned VHH chain having the amino acid sequence shown.

[0022] The third aspect of the present invention provides a gene sequence encoding the above-mentioned VHH chain, or encoding the above-mentioned anti-human CD70 nanobody.

[0023] The fourth aspect of the present invention provides a recombinant expression vector comprising the gene sequence of the third aspect.

[0024] The fifth aspect of the present invention provides a host cell transformed with a recombinant expression vector or having an exogenous nucleotide sequence integrated into its genome, wherein the recombinant expression vector is the recombinant expression vector of the fourth aspect, and the exogenous nucleotide sequence is the gene sequence described in the third aspect.

[0025] The host cells include, but are not limited to, bacterial cells, fungal cells, animal cells, plant cells, or progeny of these cells.

[0026] The anti-CD70 antibody of the present invention is obtained by the following method:

[0027] (1) Alpacas were immunized with human CD70 eukaryotic protein to prepare a phage display library.

[0028] (2) Affinity screening of phage display libraries using human CD70 protein;

[0029] (3) ELISA to identify positive clones;

[0030] (4) Expression and purification of anti-CD70 nanobodies;

[0031] (5) Identification of the function of anti-CD70 nanoantibodies.

[0032] The sixth aspect of the present invention provides a method for engineering the production of anti-human CD70 nanobodies, comprising the following steps:

[0033] (a) culturing the host cell as described in the fifth aspect of the present invention under conditions suitable for the production of nanobodies, thereby obtaining a culture containing the anti-human CD70 nanobody; and

[0034] (b) separating and / or recovering the anti-human CD70 nanobody from the culture; and optionally

[0035] (c) purifying and / or modifying the anti-human CD70 nanobody obtained in step (b).

[0036] The seventh aspect of the present invention provides the use of the anti-human CD70 nanobody in the preparation of a reagent for detecting human CD70.

[0037] The anti-human CD70 nanobody can be used to prepare a detection kit or a diagnostic kit for detecting CD70 in a sample.

[0038] The eighth aspect of the present invention provides the use of the anti-human CD70 nanobody in the preparation of drugs for treating CD70-related diseases.

[0039] The CD70-related diseases include but are not limited to cancer. The anti-CD70 nanoantibody can be used as an immune checkpoint inhibitor, as a cancer treatment drug alone, or in combination with other anti-cancer drugs.

[0040] The present invention uses human CD70 eukaryotic protein to immunize alpacas, separates alpaca peripheral blood lymphocytes to amplify VHH gene sequences, and constructs a nano antibody phage display library. The library is screened by liquid phase affinity panning to finally obtain anti-human CD70 specific nano antibody gene sequences. The phage display library constructed by the present invention has a large library capacity, and the diversity of the nano antibodies screened is high.

[0041] Compared with conventional antibodies, the anti-CD70 nanoantibody of the present invention has a small molecular weight (about 13 kDa), high affinity and good specificity. It can be developed as an immune checkpoint inhibitor to provide a solution for tumor treatment.

[0042] Other features and advantages of the present invention will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] The above and other objects, features and advantages of the present invention will become more apparent through a more detailed description of exemplary embodiments of the present invention with reference to the accompanying drawings.

[0044] Figure 1 The electrophoresis diagram of NB506 RNA. M: DNA marker; 1 is NB506-A four-immune RNA, 2 is NB506-B three-immune RNA, 3 is NB506-B four-immune RNA.

[0045] Figure 2 This is the electrophoresis diagram of the first round of NB506 VHH amplification. Figure A corresponds to the NB506-A project, Figure B corresponds to the NB506-B project, M: DNA marker, 1-5: VHH fragment amplified in the first round of nested PCR.

[0046] Figure 3 This is the electrophoresis diagram of the second round of amplification of NB506 VHH, where M is DNA marker and Line 1-2 is VHH.

[0047] Figure 4 Electropherogram of 48 clones picked for the NB506 library.

[0048] Figure 5 The amino acid alignment sequence of NB506 was constructed for diversity sequencing.

[0049] Figure 6 The amino acid alignment sequence of NB506 was constructed for diversity sequencing.

[0050] Figure 7 Construct an evolutionary tree for the diversity sequencing analysis results of NB506.

[0051] Figure 8 Construct an evolutionary tree for the diversity sequencing analysis results of NB506.

[0052] Fig.9A and 9B Shown is the affinity of the antibodies binding to Human CD70 his (ELISA).

[0053] Fig.10 Affinity of Nanobody binding to 293T is shown (FACS).

[0054] Fig.11 The affinity of the Nanobody binding to the 293T-cyno-CD70-cell line is shown (FACS).

[0055] Fig.12 The affinity of Nanobody binding to 293T-CD70 cell line is shown (FACS).

[0056] Fig.13 Nanobody blocking results (ELISA) are shown. DETAILED DESCRIPTION

[0057] The preferred embodiments of the present invention will be described in more detail below. Although the preferred embodiments of the present invention are described below, it should be understood that the present invention can be implemented in various forms and should not be limited to the embodiments set forth herein.

[0058] The present invention first immunized two healthy adult alpacas (Alpaca) with human CD70 protein. After four consecutive immunizations, peripheral blood was extracted from the alpacas to separate peripheral blood lymphocytes of the alpacas, and a CD70-specific single-domain heavy chain antibody immune library was constructed. Then, a liquid phase affinity panning method was used to screen the immune library using human CD70 protein to obtain single-domain heavy chain antibodies against human CD70, thereby obtaining a nano antibody strain that is efficiently expressed in Escherichia coli.

[0059] Example 1: Construction of a single domain heavy chain antibody immune library targeting human CD70

[0060] (1) Alpacas were immunized with human CD70 protein once every two weeks for a total of four times.

[0061] (2) After four immunizations, serum titers were detected using indirect ELISA.

[0062] Experimental steps: dilute the antigen to 2μg / mL with 0.05M carbonate buffer (pH9.6), coat at 100μL / well, and coat overnight at 4℃; discard the coating solution, wash 3 times with PBST, add 300μL 5% skim milk to each well, and block at 37℃ for 1h; wash 3 times with PBST, add 100μL / well of serum dilution (diluted from 1:2000), and incubate at 37℃ for 45min; wash 5 times with PBST, add Goat anti-Alpaca IgG (H+L) HRP (Cat#: S001H, diluted 1:1W with PBS), 100μL / well, and incubate at 37℃ for 45min; wash the plate 5 times with PBST. Add TMB colorimetric solution for color development, 100μL / well, 37℃, 5min, add stop solution to stop the reaction, 50μL / well, and measure the optical density at 450nm. The experimental results are shown in Table 1.

[0063] Table 1 Four immune serum titer detection

[0064]

[0065]

[0066] After four immunizations, the titer of alpaca A reached 1:64K (OD450>0.2); the titer of alpaca B reached 1:128K (OD450>0.2). The titers of both alpacas were normal, and the subsequent library construction and screening work could continue.

[0067] (3) Isolate lymphocytes from peripheral blood and extract total RNA (collect 50 mL of peripheral blood after four immunizations in the NB506-A project and three and four immunizations in the NB506-B project, and separate PBMCs according to the instructions for use of the lymphocyte separation solution). In the NB506-A project, RNA was extracted from PBMCs from four immunizations, and then reverse transcribed into cDNA to construct a phage library for screening; in the NB506-B project, RNA was extracted from PBMCs from three and four immunizations, and then reverse transcribed into cDNA, and the phage library was constructed for screening by mixing them in equal proportions.

[0068] (4) Takara's RNAiso Plus reagent was used to extract total RNA from PBMCs of the four immunizations of the NB506-A project and the three and four immunizations of the NB506-B project. 1 μg of RNA was electrophoresed to detect RNA purity. The electrophoresis results were as follows: Figure 1 As shown, the results show that the RNA purity is good. According to the instructions of the PrimeScriptTMII 1st Strand cDNA Synthesis Kit, RNA was reverse transcribed into cDNA.

[0069] (5) The VHH chain was amplified using the PCR method, which included two rounds of PCR. The system and conditions were shown in Tables 2 and 3.

[0070] Table 2 Nested PCR one-round reaction system

[0071]

[0072] Table 3 Nested PCR reaction conditions

[0073]

[0074]

[0075] After the first round of nested PCR amplification, all PCR amplification products were collected for 2% agarose electrophoresis (the results were as follows Figure 2 The VHH fragment of about 750 bp was recovered by cutting.

[0076] In the second round of nested PCR, the optimized primers were used to amplify the target gene fragment according to the first round of PCR system and procedures, and 2% agarose electrophoresis was performed. The results are as follows Figure 3 As shown, a VHH fragment of about 500 bp was purified and recovered using a DNA product purification kit. The purified VHH fragment was stored below -20°C.

[0077] Upstream primer:

[0078] 5'-CATGCCATGACTGTGGCCCAGGCGGCCCAGKTGCAGCTCGTGGAGTC-3' (SEQ ID NO: 129)

[0079] Downstream Primer-1:

[0080] 5'-CATGCCATGACTCGCGGCCGGCCTGGCCGCTGGGGTCTTCGCTGTGGTGCG-3' (SEQ ID NO: 130)

[0081] Downstream Primer-2:

[0082] 5'-CATGCCATGACTCGCGGCCGGCCTGGCCTGGTTGTGGTTTTGGTGTCTTGGG-3' (SEQ ID NO: 131)

[0083] (6) The pComb3XSS phagemid vector and the target fragment were digested with SfiI at 50°C overnight, and then the target fragment was recovered using a universal DNA purification kit. After the digestion reaction was completed, T4 ligase was used to perform a ligation reaction at a ligation molar ratio of Vector:VHH=1:3 and incubated at 4°C for 16 h.

[0084] (7) Purify and concentrate the ligation product, and electroporate the ligation product into competent TG1 Escherichia coli to construct a CD70 nanobody phage display library. The library capacity of the NB506-A project is 2.28×10 9 (228×1000×10 4 ×1×1); the storage capacity of NB506-B project is 1.10×10 9 (110×1000×10 4 ×1×1). The library capacity and diversity are good and can be used for the next screening. The library is collected and stored in aliquots at -80℃.

[0085] (8) Colony PCR verification of insertion rate and library diversity analysis. 48 clones were randomly selected from the library transformant number titer plate for identification. The results showed that the insertion rate was 100% ( Figure 4 ).

[0086] (9) 48 positive clones were sequenced, and the sequencing primer was pComb3XSS-F (TCACTCATTAGGCACCCCAG, SEQ ID NO:). 48 clones were successfully sequenced in NB506-A, of which 2 were non-single clones, with clone numbers 11 and 17, respectively; 48 clones were successfully sequenced in NB506-B, of which 3 were non-single clones, with clone numbers 15, 28, and 39, respectively.

[0087] The amino acid alignment sequence of the library diversity was obtained by analysis with Sequencher Scanner v1.0 and DNASTAR software ( Figure 5 and Figure 6 ) and evolutionary trees ( Figure 7 and Figure 8 ).

[0088] Example 2: Screening of anti-CD70 nanobodies, identification and sequencing of positive clones

[0089] (1) Phage library packaging

[0090] Experimental steps: The bacterial library was inoculated into 300 mL 2YT+A+G (Amp: 100 μg / mL, Glu: 1%) medium until its initial OD 600 =0.1-0.2, 37°C, 230 rpm, culture until OD 600 =0.8 or more. According to OD 600 Add helper phage M13KO7 (helper phage: bacteria = 20:1). After adding M13KO7, mix well and let stand at 37℃ for 30min. Then shake slowly at 37℃ and 180rpm for 30min. Centrifuge the culture at 5000rpm for 10min, discard the supernatant, resuspend the precipitate with an equal volume of 2YT+A+K (Amp: 100μg / mL, Kan: 50μg / mL) medium, and incubate at 30℃ and 220rpm overnight. Centrifuge the overnight culture at 4℃ and 10000rpm for 20min, collect the supernatant, and discard the precipitate. Replace the centrifuge tube, centrifuge at 4℃ and 10000rpm for 20min, and collect the supernatant. Add PEG8000 / NaCl according to 1 / 5 of the supernatant volume, mix well, and precipitate on ice for more than 2 hours. Centrifuge at 4℃ and 10000rpm for 20min, discard the supernatant, and empty once to remove the supernatant. Suspend the precipitate with 1mL 1×PBS, add 1 / 5 volume of PEG8000 / NaCl for secondary precipitation for 1h. Centrifuge at 4℃, 12000rpm for 10min, discard the supernatant, and remove the supernatant once. According to the amount of precipitation, add 1×PBS to resuspend the precipitate. The anti-CD70 single domain heavy chain antibody immune library is obtained, add 100% glycerol to a final concentration of 50%, mix well, and dispense into 1.5mL EP tubes and store at -80℃. Take 10μL to measure the titer of the amplified library.

[0091] Experimental Results: NB506-A Project 10 -9 There were 360 ​​clones on the titer plate, and the titer of the phage library was 3.60×10 13 cfu / mL(360×10 9 ×100); NB506-B Project 10 -9 There were 480 clones on the titer plate, and the phage library titer was 4.80×10 13 cfu / mL(480×10 9 ×100).

[0092] (2) Bio-CD70 liquid phase screening

[0093] Experimental steps: Remove the magnetic beads and wash them twice with PBS for later use; dilute the Biotin-CD70 antigen with PBS to a final concentration of 5 μg / mL, add 2×10 11 Phage library, incubate at 37℃ for 1h; add the incubated mixture to the magnetic bead tube and shake at 4℃ for 45min; aspirate the supernatant under the action of the magnetic stand, wash with PBST 3 times and PBS 2 times; add 800μL Gly-HCl eluent, incubate at 37℃ for 8min to elute the specifically bound phage; transfer the eluate to a 1.5mL sterile centrifuge tube and quickly neutralize with 160μL Tris-HCl neutralization buffer; take 10μL for gradient dilution, determine the titer, calculate the panning recovery rate, and mix the remaining eluates for amplification and purification for the next round of affinity panning, changing the panning conditions. The panning conditions for each round are shown in Table 4.

[0094] Table 4 Affinity panning conditions

[0095]

[0096] The enrichment during the screening process is shown in Table 5.

[0097] Table 5 Recovery of NB506-A library after two rounds of screening with Bio-CD70 acid elution

[0098]

[0099] Table 6 Recovery of NB506-B library after two rounds of screening with Bio-CD70 acid elution

[0100]

[0101] Recovery rate = recovery amount / library input amount; enrichment = next round recovery rate / previous round recovery rate

[0102] (3) Identification of positive phage clones by monoclonal ELISA

[0103] Experimental steps: The target molecule Biotin-CD70 antigen was diluted with carbonate buffer with a pH value of 9.6 to a final concentration of 2 μg / mL, and 100 μL / well was added to the enzyme-labeled wells, and coated overnight at 4°C; the coating solution was discarded, washed 3 times with 0.1% PBST, 300 μL of 5% skim milk was added to each well, and blocked at 37°C for 1h; washed once with 0.1% PBST, 50 μL of phage culture supernatant and 50 μL of 5% skim milk were added to each well, and incubated at 37°C for 1h; washed 5 times with 0.1% PBST, and horseradish peroxidase-labeled anti-M13 antibody (diluted 1:10000 with PBS) was added, 100 μL / well, and acted at 37°C for 1h; washed 6 times with 0.1% PBST. TMB color developing solution was added for color development, 100 μL / well, at 37°C for 7 min. Stop solution was added to terminate the reaction, 50 μL / well, and the optical density was measured at 450 nm.

[0104] Experimental results: Using Bio-CD70 as the target molecule, the Gly-HCl acid elution method was used to elute the specific phage. A total of 96 clones (numbered NB506-A-ANTI-BIO-CD70-1-96) were randomly selected from the Bio-CD70 second round titer determination plate using a sterilized toothpick. Positive clones were screened using indirect ELISA, and the optical density values ​​were measured at 450nm.

[0105] (4) Monoclonal sequence analysis

[0106] The positive clones were sent to Chengdu Qingke Zixi Biotechnology Co., Ltd. for sequencing, and the sequencing primer was pComb3xss-F.

[0107] Experimental results: After two rounds of screening, NB506-A library identified 96 clones on the second round of titer plates, and 91 positive clones were obtained. The results showed that clone 73 was not a single clone. After sequencing the above positive clones, data analysis showed that 51 unique sequences were obtained based on different CDR3 sequences. After two rounds of screening, NB506-B library identified 96 clones on the second round of titer plates, and 81 positive clones were obtained. After sequencing the above positive clones, data analysis showed that 9 unique sequences were obtained based on different amino acid sequences.

[0108] (5) Unique sequence monoclonal phage supernatant FACS identification results

[0109] After sequencing analysis, the unique sequence monoclonal clones obtained according to CDR3 classification were subjected to competitive ELISA experiments, and the clone numbers with a median value < 0.5 in the competition experiment were selected and expressed for binding affinity experiments with CD70 antigen.

[0110] Example 3: Expression and purification of CD70 nanobody

[0111] After the positive clones are expressed, PCR fragments are amplified using PTT5-Fmix / Rmix as primers. Connect with PTT5-human FC (IgG1) vector by incubation at 50°C for 15 minutes. Heat shock in a water bath for 90 seconds to transform the connection product into competent cells TOP10. After the transformation is completed, 1 ml of 2YT is quickly added and cultured at 220rpm and 37°C for 45 minutes. Plate and culture overnight. Using PG-F / PTT5-hFC-Rmix as primers, identify the colony PCR results, select positive clones, and send the bacterial solution for sequencing. Extract the plasmid according to the instructions of Tiangen Bio's high-purity plasmid mini-preparation kit, and transiently transfect 293-F / 293-EBNA cells with PEI. After the transformation is completed, place it at 37°C and 5% CO 2 , cultured in a constant temperature shaking incubator at 120 rpm.

[0112] Sequence information of PTT5-Fmix / Rmix

[0113] F1: ccgccacaggcgtccactccGAGGTGCAGGTGGTGGAGTC (SEQ ID NO: 132)

[0114] F2: ccgccacaggcgtccactccGAGGTGCAGCTGGTGGAGTC (SEQ ID NO: 133)

[0115] F3: ccgccacaggcgtccactccCAGTTGCAGCTCGTGGAGTC (SEQ ID NO: 134)

[0116] F4: ccgccacaggcgtccactccCAAGTTCAATTGCAAGAATCTGGTGGTGG (SEQ ID NO: 135)

[0117] F5: ccgccacaggcgtccactccCAGGTGCAGCTCGTGGAGTC (SEQ ID NO: 136)

[0118] R1: ttgtcacaagattttggttcGTCTTGTGGTTTTGGTGTCT (SEQ ID NO: 137)

[0119] R2: ttgtcacaagattttggttcATGGGGGTCTTCGCTGTGGT (SEQ ID NO: 138)

[0120] Target protein expression: Resuscitate and culture cells in advance, maintaining the cell density at 3×10 5 / mL to 1-3×10 6 / mL; on the day of transfection, the cell density was adjusted to 3×10 6 / mL; calculate and prepare PEImax and DNA; take the culture medium to dilute PEImax and DNA respectively to form a DNA / PEImax complex; take out the cells to be transfected, drop the DNA / PEImax complex into the cells, and after the addition is completed, place the cells in a CO 2 Culture in an incubator; 24 hours after transfection, add OPM-293ProFeed protein-free feed and anti-agglomeration agent, add OPM-293ProFeed protein-free feed every other day, and monitor cell viability. Collect the culture medium on the 5th day after transfection or when the cell viability is less than 70%, and transfer it for purification.

[0121] Purification of target protein: After collecting the material, 20mM PBS was used to balance the chromatography filler (ProteinA Suzhou Nawei Technology Co., Ltd.). The upstream collection sample was loaded at a constant flow rate of 4mL / min. After loading, 20mM PBS was used to balance the chromatography filler again. When UV dropped to the baseline, 20mM sodium acetate was used to elute the sample. Before elution, 1mL 1M Tris (pH8.8) was pre-added to the sample collection tube. After collecting the sample, the chromatography filler was rinsed with purified water for 4CV, and then with 0.1M NaOH for 3CV, and then with purified water for 4CV. If the next sample is to be purified, the chromatography filler is equilibrated with 20mM PBS. If no sample needs to be purified, the chromatography filler is preserved with 20% ethanol.

[0122] The purified protein was detected by SDS-PAGE and SEC.

[0123] Example 4: Binding and affinity of CD70 nanobody to CD70 antigen

[0124] Experimental steps: The binding characteristics of CD70 nanoantibodies were determined by non-competitive ELISA method. The ELISA plate was coated with Human CD70 His tag as the antigen protein at a concentration of 2 μg / mL. (50 mM NaHCO 3PH=9.6) 100μL / well, 4℃ overnight. Wash 3 times with PBST, block with 300μL / well, 5% milk. 37℃1h; wash once with PBST, dilute each protein to be detected from 200nM in a 1:5 gradient (5% milk dilution); incubate 100μL of each diluted protein dilution with the ELISA plate coated with Human CD70 His tag as the antigen. Incubate at 37℃ for 1h. Wash 5 times with PBST, and add the secondary antibody (Anti-human IgG-HRP 1:10K) diluted in the blocking solution. Wash the ELISA plate incubated with the secondary antibody 5 times with PBST, add 100μL of TMB single-component colorimetric solution to each well and incubate at 37℃ for 7min, add 1M HCL to 50μL / well to terminate the reaction, OD 450 Reading. The absorbance value reflects the binding ability of anti-CD70 nanobody to antigen CD70.

[0125] Through the above steps, 19 nanobodies were finally screened. The binding ability of nanobodies to antigen CD70 is shown in Table 7. Fig.9A and Fig. 9B The sequence information of 19 nanobodies is shown in Table 8. The results of protein SEC experiments are shown in Table 9. Protein SDS-PAGE and other related information are shown in Table 10.

[0126] Table 7 EC50-ELISA

[0127] EC50(nM) ARGX-110(Anti CD70) 0.2399 VHH-FC(Isotype) 284.7 NB506-A-2 0.1881 NB506-A-4 0.3430 NB506-A-5 0.4075 NB506-A-8 0.7173 NB506-A-10 0.2964 NB506-A-14 0.3658 NB506-A-15 0.2630 NB506-A-16 0.6025 NB506-A-17 0.2764 NB506-A-18 0.2055 NB506-A-21 0.5661 NB506-A-27 0.2816 NB506-A-32 0.2100 NB506-A-37 0.1670 NB506-A-40 0.3410 NB506-A-41 0.2839 NB506-A-46 0.2629 NB506-A-84 0.3205 NB506-B-2 1.184

[0128] It can be seen from the above results that the antibodies of NB506 have good binding ability with Human CD70 his antigen, and the binding ability is basically equivalent to that of ARGX-110 (positive control), an antibody known to target CD70, and some are even better than ARGX-110.

[0129]

[0130]

[0131]

[0132] Table 9 Protein SEC experimental results

[0133]

[0134]

[0135] Experimental Example 5: FACS detection of binding of CD70 nanoantibodies to tumor cells and cross-species analysis

[0136] Experimental steps: harvest cells and wash once with FACS buffer. 2×10 5 live cells (50 μL). Dilute the nanobody to 400 nM, and then dilute it at a ratio of 1 / 5 to make a curve. Add 50 μL of the diluted sample solution to the test tube containing the cell pellet. Stir well and incubate at 4°C for 60 minutes. Wash the cells once with FACS buffer. Dilute anti-human FC-647 according to the manufacturer's instructions, add 100 μL of the dilution to the sample tube, and incubate at 4°C for 60 minutes. Wash the cells three times with FACS buffer and resuspend the cell pellet in 200 μL PBS. Transfer the cell suspension to a flow tube and detect the cells using a flow cytometer. The results are shown in Tables 11, 12, Fig.10 , Fig.11 and Fig.12 shown.

[0137] Table 11 EC50-293T-cyno-CD70-cell line FACS

[0138]

[0139] Table 12 EC50-293T-CD70 cell line FACS

[0140]

[0141]

[0142] From the above results, it can be seen that the NB506 antibody has good binding ability with the 293T-cyno-CD70 cell line. The NB506 antibody also has good binding ability with the 293T-CD70 cell line. It is basically equivalent to the positive control ARGX-110, or even better than ARGX-110.

[0143] Experimental Example 6: Blocking effect of anti-CD70 nanoantibodies on CD27-CD70

[0144] Experimental steps: Coat the ELISA plate with Human CD70 Protein his flag tag (50mM NaHCO 3pH=9.6) 100μL / well, 4℃ overnight. Wash 3 times with PBST, block with 300μL / well, 5% milk, 37℃ 1h. Wash once with PBST, dilute the antibody to a concentration of 400nM (diluted with 5% milk); dilute Bio-human-CD27 / TNFRSF7 protein FC to 1μg / mL. Control group: 50μL diluted Bio-human-CD27 / TNFRSF7 protein FC and 50μL 5% milk; Experimental group: 50μL diluted Bio-human-CD27 / TNFRSF7 protein FC and 50μL diluted antibody. Incubate at 37℃ for 1h. Wash 5 times with PBST, and add the secondary antibody (SA-HRP 1:10K) diluted in blocking solution accordingly. The ELISA plate incubated with secondary antibody was washed 5 times with PBST, 100 μL of TMB single-component colorimetric solution was added to each well and incubated at 37°C for 7 min, and 50 μL / well of 1 M HCL was added to terminate the reaction. 450 The results are shown in Table 13 and Fig.13 shown.

[0145] Table 13. IC50-Human CD70 his ELISA

[0146]

[0147]

[0148] It can be seen from the above results that the antibodies in the NB506 project can all block the binding of CD27 and CD70.

[0149] The embodiments of the present invention have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and changes will be apparent to those skilled in the art without departing from the scope and spirit of the described embodiments.

Claims

1. A VHH chain of an anti-human CD70 nanobody that blocks the CD70-CD27 signal axis, comprising a framework region FR and an antigen complementary determining region CDR, wherein the framework region FR comprises FR1, FR2, FR3 and FR4, and the antigen complementary determining region CDR comprises CDR1, CDR2 and CDR3; the CDR1, CDR2 and CDR3 are separated by the FR1, FR2, FR3 and FR4; wherein, The amino acid sequence of FR1 is shown in one of SEQ ID NO: 1 to SEQ ID NO: 12; The amino acid sequence of CDR1 is shown in one of SEQ ID NO: 13 to SEQ ID NO: 31; The amino acid sequence of FR2 is shown in one of SEQ ID NO: 32 to SEQ ID NO: 47; The amino acid sequence of CDR2 is shown in one of SEQ ID NO: 48 to SEQ ID NO: 66; The amino acid sequence of FR3 is shown in one of SEQ ID NO: 67 to SEQ ID NO: 84; The amino acid sequence of CDR3 is shown in one of SEQ ID NO: 85 to SEQ ID NO: 103; The amino acid sequence of FR4 is shown in any one of SEQ ID NO: 104 to SEQ ID NO:

107.

2. The VHH chain according to claim 1, wherein The amino acid sequence of the VHH chain of the anti-human CD70 nanobody is shown in one of SEQ ID NO: 108 to SEQ ID NO:

126.

3. An anti-human CD70 nanobody, characterized in that: The antibody is a nanobody targeting a human CD70 molecule epitope, and comprises the VHH chain of claim 1 or 2.

4. A gene sequence, characterized in that It encodes the VHH chain as described in claim 1 or 2, or encodes the anti-human CD70 nanobody as described in claim 3.

5. A recombinant expression vector, characterized in that: It comprises the gene sequence according to claim 4.

6. A host cell transformed with a recombinant expression vector or having an exogenous nucleotide sequence integrated into its genome, wherein the recombinant expression vector is the recombinant expression vector according to claim 5, and the exogenous nucleotide sequence is the gene sequence according to claim 4.

7. The host cell according to claim 6, which is a bacterial cell, a fungal cell, an animal cell, a plant cell or a progeny cell of these cells.

8. A method for producing anti-human CD70 nanobody, characterized in that: The following steps are involved: (a) culturing the host cell according to claim 7 under conditions suitable for producing nanobodies, thereby obtaining a culture containing the anti-human CD70 nanobody; as well as (b) separating and / or recovering the anti-human CD70 nanobody from the culture; and optionally (c) purifying and / or modifying the anti-human CD70 nanobody obtained in step (b).

9. Use of the VHH chain according to claim 1 or 2 or the anti-human CD70 nanobody according to claim 3 in the preparation of a reagent for detecting human CD70; the reagent is preferably a detection kit or diagnostic kit for detecting CD70 in a sample.

10. Use of the VHH chain according to claim 1 or 2 or the anti-human CD70 nanoantibody according to claim 3 in the preparation of a drug for treating CD70-related diseases; the CD70-related disease is preferably cancer; the active ingredients of the drug include the anti-human CD70 nanoantibody and optionally other anti-cancer drugs.

Images