PegRNA of targeted TRPV4 gene, pilot editing system and application of pegRNA and pilot editing system

Abstract

The invention discloses pegRNA of a targeted TRPV4 gene, a pilot editing system and application of the pegRNA and the pilot editing system. Specifically, the invention discloses pegRNA which comprises sgRNA, an RT template and a primer binding site, and the nucleotide sequence of the RT template is 108th to 121st sites of SEQ ID No.2. And the nucleotide sequence of the pegRNA is SEQ ID No. 2. The invention further discloses a pilot editing system and an editing method for repairing the TRPV4 gene V342F mutation. The screened specific pegRNA and a pilot editing system can efficiently realize correction of the TRPV4 gene, the purpose of repairing V342F mutation of the TRPV4 gene of the Scottian folding cat is achieved, fewer by-products are obtained, the highest editing efficiency can reach 41%, and the Scottian folding cat has important clinical value and application prospects in treatment of osteochondral dysplasia of the Scottian folding cat.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a pegRNA targeting a TRPV4 gene, a lead editing system and applications thereof. Background Art

[0002] Prime Editor (PE) is a gene editor that can search and replace (bases). It can effectively achieve all 12 base conversions without relying on double-strand breaks (DSBs) and donor DNA. In addition, it can effectively achieve precise insertion (up to 44bp) and deletion (up to 80bp) of multiple bases. PE is based on the CRISPR / Cas9 system. First, sgRNA is modified to add an RNA sequence to its 3' end. The obtained RNA is called pegRNA; second, nCas9 (H840A) is fused with reverse transcriptase to obtain a new fusion protein (i.e., prime editing protein). The 3' end sequence of pegRNA has a dual role. One sequence serves as a primer binding site (PBS), which is complementary to the 3' end of the broken target DNA chain to initiate the reverse transcription process. The other sequence is a template for reverse transcription (RT template), which carries target point mutations or insertion and deletion mutations to achieve precise gene editing.

[0003] Scottish fold osteochondrodysplasia (SFOCD) is an incomplete dominant genetic disease. SFOCD affects the distal forelimbs, distal hind limbs, tail deformities, cartilage fibrosis and progressive joint damage. About three weeks after the kitten is born, the auricle begins to fold forward. Osteochondrodysplasia is prone to occur between 1 and 6 months of age, usually starting from two months of age, and there is no obvious gender difference. Heterozygous cats generally develop the disease later than homozygous cats, usually after 6 months of age, and the severity of the disease is also milder. Typical early symptoms include an abnormally thick tail with an inability to bend the tail root, short and thick limbs, deformed bone morphology, abnormal gait and a decreased ability to bear weight, which eventually leads to lameness.

[0004] A joint study by the School of Veterinary Medicine at the University of Missouri and the School of Veterinary Science at the University of Sydney, Australia, showed that mutations in the TRPV4 gene are the main cause of SFOCD. Bone development is a highly complex life activity regulated by multiple genes, and precise gene regulation plays a vital role in bone development. Through cat DNA microarray and genome wide association study (GWAS), DNA samples of 44 Scottish Fold cats and 54 ordinary upright ear cats were analyzed for gene sequencing of TRPV4. The results showed that osteochondrodysplasia in Scottish Fold cats was associated with a G to T mutation in the TRPV4 gene (c.1024G>T, corresponding to the valine mutation V342F at position 342). The expression of TRPV4 with the V342F mutation on the cell surface was less than that of normal TRPV4, thereby losing its inhibitory effect on the production of certain synthetic agonists. Therefore, it was concluded that TRPV4 is the main factor in osteochondrodysplasia in Scottish Fold cats.

[0005] Adeno-associated virus (AAV) is a non-enveloped virus of about 25 nm, composed of 60 copies of viral proteins VP 1, VP2, and VP3 assembled into a regular icosahedral capsid. AAV can package 4.7kb of single-stranded DNA and has been used to deliver many approved and clinically developed gene therapies. It is currently the most popular viral vector for delivering DNA. The conventional production method of AAV vectors is to co-transfect HEK 293T cells with a three-plasmid system. One of the plasmids (expression vector) is a vector plasmid carrying the ITR sequences and exogenous genes in the two AAV genomes, which can replace the Rep and Cap genes of the wild-type genome with exogenous genes. The second plasmid (packaging plasmid) encodes the Rep protein and Cap protein targeted by the required serotype. The third plasmid (Ad Helper, auxiliary plasmid) carries the minimum adenoviral genes (E2, E4, and Varna) required to support AAV replication.

[0006] The lead editing system (PE system) can be used to repair gene mutations. Therefore, screening pegRNA that can be used to repair TRPV4 gene mutations for efficient gene editing has important clinical value and application prospects for the treatment of osteochondrodysplasia in Scottish Fold cats. Summary of the invention

[0007] The technical problem to be solved by the present invention is how to repair the TRPV4 gene mutation to achieve the purpose of treating osteochondrodysplasia in Scottish Fold cats. The technical problem to be solved is not limited to the described technical subject matter, and those skilled in the art can clearly understand other technical subjects not mentioned in this article through the following description.

[0008] To solve the above technical problems, the present invention first provides pegRNA, which may include sgRNA, RT template and primer binding site, and the nucleotide sequence of the RT template may be positions 108-121 of SEQ ID No.2.

[0009] The sgRNA can target the TRPV4 gene (SEQ ID No. 4).

[0010] The sgRNA can target positions 1031-1050 (target sequence) of the TRPV4 gene (SEQ ID No. 4).

[0011] Furthermore, the pegRNA may also include a gRNA scaffold and a stabilizing structure tevopreQ1 that improves editing efficiency.

[0012] Furthermore, the nucleotide sequence of the pegRNA may be SEQ ID No.2.

[0013] The present invention also provides a DNA molecule, which may be any of the following:

[0014] A1) a DNA molecule encoding the pegRNA;

[0015] A2) A DNA molecule having a nucleotide sequence of SEQ ID No.3.

[0016] The DNA molecule can be transcribed into the pegRNA.

[0017] The present invention also provides a biomaterial, which may be any of the following:

[0018] B1) an expression cassette containing the DNA molecule;

[0019] B2) a recombinant vector containing the DNA molecule, or a recombinant vector containing the expression cassette described in B1);

[0020] B3) a recombinant microorganism containing the pegRNA or the DNA molecule, or a recombinant microorganism containing the expression cassette of B1), or a recombinant microorganism containing the recombinant vector of B2);

[0021] B4) a recombinant host cell containing the pegRNA or the DNA molecule, or a recombinant host cell containing the expression cassette of B1), or a recombinant host cell containing the recombinant vector of B2).

[0022] Furthermore, the expression cassette described in B1), the recombinant vector described in B2), the recombinant microorganism described in B3) and the recombinant host cell described in B4) can all express the DNA molecule.

[0023] The microorganism described herein may be a bacterium, a fungus, an actinomycete, a protozoa, an algae or a virus. Among them, the bacterium may be from Escherichia sp., Erwinia sp., Agrobacterium sp., Flavobacterium sp., etc., but not limited thereto. The fungus may be a yeast, and the yeast may be from Saccharomyces sp., Kluyveromyces sp., Pichia sp., etc., but not limited thereto. The actinomycetes may be from Streptomyces sp., Nocardia sp., Micromonospora sp., etc., but not limited thereto. The algae may be from Fucus sp., Achnanthes sp., etc., but not limited thereto. The virus may be adeno-associated virus, adenovirus, rotavirus, herpes virus, etc., but not limited thereto.

[0024] The host cell (also referred to as recipient cell) described herein can be a plant cell or an animal cell. The host cell can be understood to refer not only to a specific recipient cell, but also to the progeny of such a cell, and due to natural, accidental or intentional mutations and / or changes, the progeny may not necessarily be completely identical to the original parent cell, but is still included in the scope of the host cell. Suitable host cells are known in the art, wherein: the plant cell may be Arabidopsis thaliana, tobacco (Nicotiana tabacum), corn (Zea mays), rice (Oryza sativa), wheat (Triticum aestivum) and the like, but are not limited thereto; the animal cell may be a mammalian cell (e.g., Chinese hamster ovary cell (CHO cell), African green monkey kidney cell (Vero cell), baby hamster kidney cell (BHK cell), mouse breast cancer cell (C127 cell), human embryonic kidney cell (HEK293 cell), human HeLa cell, fibroblast, bone marrow cell line, T cell or NK cell, etc.), avian cell (e.g., chicken or duck cell), amphibian cell (e.g., African clawed frog (Xenopus laevis) cell or giant salamander (Andrias davidianus) cell), fish cell (e.g., grass carp, carp, rainbow trout or catfish cell), insect cell (e.g., Sf21 cell or Sf-9 cell), etc., but are not limited thereto. In one or more embodiments of the present invention, the host cell is a HEK293T cell.

[0025] The present invention also provides any of the following applications of the pegRNA, the DNA molecule or the biomaterial:

[0026] C1) Application in repairing the TRPV4 gene V342F mutation;

[0027] C2) Use in the preparation of a medicament or reagent for treating chondrodysplasia syndrome in Scottish Fold cats;

[0028] C3) Application in specific recognition and / or targeting of TRPV4 gene;

[0029] C4) Use in the preparation of a lead editing system for treating Scottish Fold cat chondrodysplasia syndrome;

[0030] C5) is used in the prime editing of TRPV4 gene.

[0031] The V342F mutation may be a mutation of valine (V) at position 342 in the amino acid sequence of the protein encoded by the TRPV4 gene (SEQ ID No.5) to phenylalanine (F). Specifically, the V342F mutation may be c.1024G>T, that is, the G at position 1024 of the TRPV4 gene (SEQ ID No.4) mutates to T.

[0032] The repair of the TRPV4 gene V342F mutation can be to mutate the T at position 1024 in the nucleotide sequence of the TRPV4 gene (SEQ ID No. 4) to G, which correspondingly causes the phenylalanine (F) at position 342 in the amino acid sequence of the TRPV4 protein (SEQ ID No. 5) to mutate to valine (V).

[0033] The repairing of the TRPV4 gene V342F mutation may be repairing the Fold cat TRPV4 gene V342F mutation.

[0034] The present invention also provides a lead editing system, which may include at least any one of the following:

[0035] D1) the pegRNA;

[0036] D2) the expression cassette described in B1) herein;

[0037] D3) The recombinant vector described in B2) herein.

[0038] Furthermore, the prime editing system may also include a prime editing protein (PE).

[0039] The lead editing proteins include PE1, PE2, PE2max, PE3, PE3b, PE4, PE4max, PE5 but are not limited thereto.

[0040] The recombinant vector described in B2) herein may be a pegRNA expression vector, which is a recombinant vector obtained by cloning a DNA molecule encoding the pegRNA (such as the DNA molecule shown in SEQ ID No.3) into a gRNA vector.

[0041] Furthermore, the lead editing protein may be PE2, PE2max, PE3, PE4 or PE5.

[0042] Furthermore, the lead editing system described herein may include the pegRNA and the lead editing protein (such as PE2, PE2max, PE3, PE4 or PE5).

[0043] Furthermore, the lead editing system described herein may include a pegRNA expression vector and a recombinant expression vector containing a gene encoding a lead editing protein (such as PE2, PE2max, PE3, PE4 or PE5).

[0044] Specifically, in one embodiment of the present invention, the lead editing system includes a pegRNA expression vector and a plasmid containing a PE2, PE2max, PE3, PE4 or PE5 protein encoding gene, wherein the pegRNA expression vector is a recombinant expression vector obtained by cloning the DNA encoding the pegRNA shown in SEQID No.3 into the gRNA vector; the plasmid containing the PE2, PE2max, PE3, PE4 or PE5 protein encoding gene can be a recombinant expression vector obtained by cloning the coding gene of PE2, PE2max, PE3, PE4 or PE5 protein into an expression vector, such as the PE2 lead editor plasmid (addgene product, catalog number Plasmid#132775), the PE2max lead editor plasmid (addgene product, catalog number Plasmid#172820), and the PE3 lead editor refers to the PE2 lead editor plasmid (addgene product, catalog number Plasmid#132775) plus an sg RNA, PE4 Prime Editor Plasmid (product of addgene, catalog number Plasmid#174828) and PE5 Prime Editor refer to the PE4 Prime Editor Plasmid (product of addgene, catalog number Plasmid#174828) plus an sgRNA.

[0045] The gRNA vector may be a gRNA scaffold plasmid (product of Addgene, catalog number Plasmid#172716).

[0046] In another embodiment of the present invention, the lead editing system is constructed using adeno-associated virus (AAV) as a vector. First, the coding gene of the PE2 protein is split into two parts at position 1026, which are carried by two AAV vectors respectively, and intein sequences are added at the split positions respectively so that the two AAV vectors express the complete PE2 protein, and the coding DNA molecule of pegRNA is constructed into at least one of the above-mentioned AAV vectors.

[0047] Specifically, the lead editing system includes AAV-PE2-N plasmid and AAV-PE2-C plasmid.

[0048] Among them, the construction method of AAV-PE2-N plasmid is as follows:

[0049] Using AAV-CBE N (product of Addgene, catalog number Plasmid #137175) as a template and AA VF: 5'-ataggccctcttcctgcccgacctt-3' and AAV-R: 5'-gttgctgactcgcttgttcctggtgtctcgctg ccagaggatcctccgctagatcctccagagtcacctcccagctgaga-3' as primers, PCR amplification was performed to obtain the AA VN vector linear fragment. Using the PE2 lead editor plasmid (Addgene product, item number Plasmid#132775) as a template, PE2-NF: 5'-ggaacaagcgagtcagcaacaccagagagcagtggcggcagcag cggcggcagcagcaccctaaatatagaagat3', PE2-NR: 5'-agaggttgattatcagatcttacacctt3' as primers, PCR amplification was performed to obtain the PE2-1026-N linear fragment. Using the pegRNA expression vector in Example 4 as a template, pegRNA-F: 5'-ggaaagtctaaagatctgataatcaa-3', pegRNA-R: 5'-aaggtcgggca ggaagagggcctatttcccatg-3' as primers, PCR amplification was performed to obtain the pegRNA linear fragment. The linear fragment of AAV-N vector, PE2-1026-N linear fragment and pegRNA linear fragment were added to the Gibson reaction system. After homologous recombination reaction at 50℃ for 1h, the PE2-1026-N fragment and pegRNA linear fragment were inserted into the AAV-N split vector, and the model plasmid was constructed and sequenced. The plasmid with correct sequencing verification is the AAV-PE 2-N plasmid.

[0050] The construction method of AAV-PE2-C plasmid is as follows:

[0051] Using AAV-CBE N (product of Addgene, catalog number Plasmid #137175) as a template and AA VF: 5'-ataggccctcttcctgcccgacctt-3' and AAV-R: 5'-gttgctgactcgcttgttcctggtgtctcgctg ccagaggatcctccgctagatcctccagagtcacctcccagctgaga-3' as primers, PCR amplification was performed to obtain the AA VC vector linear fragment. Using the PE2 lead editor plasmid (Addgene product, item number Plasmid#132775) as a template, PE2-CF: 5'-aacaccagagagcagtggcggcagcagcggcggcagcagcaccc taaatatagaag-3', PE2-CR: 5'-tatcagatctttagactttcctcttcttcttgggc-3' as primers, PCR amplification was performed to obtain the PE2-1026-C linear fragment. Using the pegRNA expression vector in Example 4 as a template, peg RNA-F: 5'-ggaaagtctaaagatctgataatcaa-3', pegRNA-R: 5'-aaggtcgggcaggaagagggcct atttcccatg-3' as primers, PCR amplification was performed to obtain the pegRNA linear fragment. The linear fragment of AAV-C vector, PE2-1026-C linear fragment and pegRNA linear fragment were added to the Gibson reaction system, and the PE2-1026-C fragment and pegRNA linear fragment were inserted into the AAV-C split vector after homologous recombination reaction at 50℃ for 1h, and the model plasmid was constructed and sequenced. The plasmid with correct sequencing verification is the AAV-PE2-C plasmid.

[0052] The present invention also provides any of the following applications of any of the lead editing systems described herein:

[0053] E1) Application in repairing the TRPV4 gene V342F mutation;

[0054] E2) Use in the preparation of a medicament or reagent for treating chondrodysplasia syndrome in Scottish Fold cats;

[0055] E3) in the application of prime editing targeting TRPV4 gene.

[0056] The present invention also provides a method for lead editing to repair the V342F mutation of the TRPV4 gene, characterized in that the method comprises the step of performing lead editing using the pegRNA, the DNA molecule, the expression cassette described in B1) of the present invention, the recombinant vector described in B2) of the present invention and / or any one of the lead editing systems described herein.

[0057] The prime editing described herein includes in vitro prime editing, in vivo prime editing, or a combination thereof.

[0058] After extensive and in-depth research, the present invention finally screened out a specific pegRNA capable of achieving efficient gene editing through a series of designs, constructions and screenings, and further developed a set of optimal lead editing systems, which can efficiently achieve the correction of the TRPV4 gene, achieve the purpose of repairing the V342F mutation of the TRPV4 gene of the Scottish Fold cat, and apply the method to the treatment of the chondrodysplasia syndrome of the Scottish Fold cat. The pegRNA and its lead editing system of the present invention have fewer by-products, do not introduce double-strand breaks and donor DNA templates, and when PE 2, PE2max, PE3, PE4 or PE5 are used as lead editing proteins, the editing efficiency can reach 37%, 20%, 24%, 41% and 24% respectively, which has important clinical value and application prospects for the treatment of osteochondrodysplasia of Scottish Fold cats. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 This is a diagram of the Sanger sequencing results when the pegRNA (SEQ ID No. 2) of the present invention and the lead editing protein PE2 are used to repair the V342F mutation of the TRPV4 gene in Example 4.

[0060] Figure 2 This is a diagram of the Sanger sequencing results when the pegRNA (SEQ ID No. 2) of the present invention and the lead editing protein PE2max are used to repair the V342F mutation of the TRPV4 gene in Example 4.

[0061] Figure 3 This is a diagram of the Sanger sequencing results when the pegRNA (SEQ ID No. 2) of the present invention and the lead editing protein PE3 are used to repair the V342F mutation of the TRPV4 gene in Example 4.

[0062] Figure 4 This is a diagram of the Sanger sequencing results when the pegRNA (SEQ ID No. 2) of the present invention and the lead editing protein PE4 are used to repair the V342F mutation of the TRPV4 gene in Example 4.

[0063] Figure 5This is a diagram of the Sanger sequencing results when the pegRNA (SEQ ID No. 2) of the present invention and the lead editing protein PE5 are used to repair the V342F mutation of the TRPV4 gene in Example 4.

[0064] Figure 6 This is a diagram of the San Ger sequencing results when AAV is used as a vector and the PE2 editor is split into two parts in Example 5, and the pegRNA (SEQ ID No. 2) of the present invention and the lead editing protein PE2 are used to repair the V342F mutation of the TRPV4 gene. DETAILED DESCRIPTION

[0065] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0066] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0067] The pilot editing system (PE) mainly includes: pegRNA (PE guide RNA, PE guide RNA) and pilot editing protein.

[0068] pegRNA includes sgRNA targeting the target DNA fragment, a reverse transcription template (RT template) containing the genetic information to be edited, and a primer binding site (PBS). It is modified on the basis of sgRNA, adding an additional 3' extension to the 3' end of sgRNA, which contains an RT template (carrying target point mutations or insertion and deletion mutations to achieve precise gene editing) and a primer binding site complementary to the genomic target (used to complement the 3' end of the broken target DNA chain to start the reverse transcription process).

[0069] The lead editing protein is a fusion protein of cas9 nickase (nCas9) and reverse transcriptase (RT). Specifically, the lead editing protein formed by the fusion of cas9 H840A nickase and reverse transcriptase M-MLV (wild type) is PE1 (first generation lead editor). The lead editing protein formed by the fusion of cas9 H840A nickase and optimized reverse transcriptase M-MLV (mutant: D200N+L603W+T330P+T306K+W313F) is PE2 (second generation lead editor).

[0070] The LV vector (lentiviral expression vector) in the following examples is a product of Addgene, with the product number Plas mid#52963).

[0071] The pspAx2 plasmid (lentiviral packaging vector) in the following examples is a product of Addgene, with the product number Plasmid#12260).

[0072] The VSVG plasmid (lentiviral envelope vector) in the following examples is a product of Addgene, with the product number Plasmid#8454.

[0073] The PE2, PE2max, PE3, PE4 and PE5 lead editor plasmids in the following embodiments are all products of Addgene, the PE2 lead editor plasmid has a catalog number of Plasmid#132775; the PE2max lead editor plasmid (Addgene product, catalog number Plasmid#172820), the PE3 lead editor refers to the PE2 lead editor plasmid (Addgene product, catalog number Plasmid#132775) plus an sgRNA, the PE 4 lead editor plasmid (Addgene product, catalog number Plasmid#174828) and the PE5 lead editor refers to the PE2 lead editor plasmid (Addgene product, catalog number Plasmid#174828) plus an sgRNA.

[0074] In the following examples, the nucleotide sequence of the coding sequence of the TRPV4 gene is SEQ ID No.4, the protein encoded by it is the TRPV4 protein, and the amino acid sequence of the TRPV4 protein is SEQ ID No.5.

[0075] Example 1: Construction of a V342F mutant TRPV4 gene fragment plasmid using a lentivirus vector

[0076] The full sequence of the TRPV4 gene (NC_058379.1) was downloaded from the NCBI website, and a 105 bp sequence (positions 973-1061 of SEQ ID No. 4) near the V342F mutation site was selected as the editing model. The homology arm of the LV vector was embedded at the same time, and the TRPV4 gene fragment TRPV4 (V342F) containing the V342F mutation was synthesized by Qingke Company: 5'-tgcacgcgctggtggccatcgccgacaacacccgtgagaacaccaagttcTtcaccaagatgtacgacctgc tgctgctcaagtgtgCTTGTCGCCTTGCGTATA-3' (SEQ ID No. 1), where the bold font indicates the mutation site. Using LV vector (Addgene product, item number Plasmid#52963) as template, LV-F: 5'-TCGCCTTGCGTATAttaagaatagtttttgc-3', LV-R: 5'-taggaggcttggtaggtAAGAGA TTACGCGCA-3' as primers, PCR amplification was performed to obtain the LV vector linear fragment. The TRPV4 (V342F) gene fragment (SEQ ID No. 1) and the LV vector linear fragment were added to the Gibson reaction system, and the TRPV4 gene fragment was inserted into the lentiviral vector after a homologous recombination reaction at 50°C for 1h, and the model plasmid was constructed and sequenced for verification.

[0077] The plasmid (recombinant vector) verified to be correct by sequencing was named LV-TRPV4 (V342F). The recombinant vector LV-TR PV4 (V342F) was obtained by cloning the DNA fragment with the nucleotide sequence SEQ ID No. 1 in the sequence table into the LV vector based on the homologous recombination seamless cloning method.

[0078] Example 2: Lentivirus packaging

[0079] The lentivirus was packaged by co-transfecting HEK293T cells with three plasmids. The steps were as follows: HEK293T cells were cultured at 1×10 7 Two 15 cm dishes were plated with 100 μg / dish. When the cells in each well grew to 40%-60%, 16 μg pspA x2 plasmid, 8 μg VSVG plasmid, and 8 μg LV-TRPV4 (V342F) plasmid were transfected into HEK293T cells using PEI reagent. After 48 hours of transfection, the supernatant was ultracentrifuged to recover the virus supernatant to obtain the virus solution. The virus titer was 3×10 8 / mL.

[0080] Example 3: Construction of a HEK293T cell model containing a TRPV4 gene fragment with a V342F mutation

[0081] The TRPV4 gene fragment containing the V342F mutation was stably integrated into the HEK293T cell genome by random integration of lentivirus. The steps are as follows: HEK293T cells were cultured at 2×10 6 6-well plates were plated with 100 cells / well, and when the cells in each well grew to 40%-60%, 200 μl of the virus solution obtained in Example 2 was added. After 24 hours of infection, the medium was changed and the virus was discarded. After 48 hours, 5 ug / ml puromycin (Merck, USA) was added to the culture medium, and the stable integration cell line was obtained by continuous screening for several days, that is, the HEK293T cell model containing the TRPV4 gene fragment with the V342F mutation was obtained.

[0082] Example 4: Repairing the V342F mutation of the TRPV4 gene using PE

[0083] 1. Design of pegRNA and construction of pegRNA expression vector

[0084] The target sequence of pegRNA was selected near the V342F mutation site of the TRPV4 gene, and the corresponding PBS sequence and RT template sequence were determined. The pegRNA nucleotide sequence was synthesized by Qingke Company and inserted into the pU6-sp-sgRNA-RNF2_+41nick vector (purchased from Addgene, catalog number #135958) by homologous recombination to construct a pegRNA expression vector, which was then sequenced and verified.

[0085] The designed pegRNA nucleotide sequence is: 5′-CAGCAGCAGGUCGUACAUCUGUUUAAG AGCUAAGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAA CUUGAAAAAGUGGCACCGAGUCGGUGCUGUUCGUCACCAAGAUGUACGACCUGCUCGCGGUUCUAUCUAGUUACGCGUUAAACCAACUAGAA-3′ (SEQ ID No. 2).

[0086] Among them, positions 1-20 are sgRNA targeting the TRPV4 gene (specifically targeting the fragment shown at positions 22919-22918 of SEQ ID No. 4 in the TRPV4 gene), positions 21-107 are gRNA scaffolds, positions 108-121 are reverse transcription templates (RT templates) containing mutation sites, positions 122-134 are primer binding sites (PBS), and positions 135-171 are stable structures tevopreQ1 that improve editing efficiency.

[0087] The DNA sequence encoding pegRNA is: 5'-CAGCAGCAGGTCGTACATCTGTTTAAGAGCTAAGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTGTTCGTCACCAAGATGTACGACCTGCTCGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA-3' (SEQ ID No. 3). The DNA encoding pegRNA is transcribed into pegRNA.

[0088] Among them, positions 1-20 are the coding DNA of sgRNA targeting TRPV4 gene, positions 21-107 are gRNA scaffold, positions 108-121 are reverse transcription template (RT template) containing mutation site, positions 122-134 are primer binding site (PBS), and positions 135-171 are stabilizing structure tevopreQ1 for improving editing efficiency.

[0089] 2. Transfected cell model repairs the V342F mutation of the TRPV4 gene

[0090] HEK293T cells containing the TRPV4 gene fragment with V342F mutation constructed in Example 3 (hereinafter referred to as HEK293T model cells) were cultured at 5×10 524-well plates were plated with 100 cells / well. When the cells in each well grew to 40%-60%, the commonly used PE2, PE2max, PE3, PE4, and PE5 lead editor plasmids were respectively combined with the pegRNA expression vector constructed in step 1, and 600 ng of editor plasmid and 300 ng of pegRNA expression vector were transfected into HEK293T model cells using PEI reagent. After transfection for 24 hours, 5 ug / ml puromycin (Merck, USA) was added to the culture medium. Genomic DNA was extracted using a rapid DNA extraction solution (Epicentre, USA) 120 hours after transfection, and PCR was performed using Taq DNA polymerase (Kangwei Century, China) with FE-seq-F: 5'-agagaacccgcacaagaagg-3' and FE-seq-R: 5'-ccatcattgttgagcacggc-3' as primers for the 200 bp to 300 bp region near the edited site. The PCR product was subjected to Sanger sequencing (Qingke Company, sequencing results are shown in Figure 1-Figure 5 The editing efficiency was calculated.

[0091] Experimental results: The three types of lead editors and pegRNA were combined and transfected to edit specific sites. The results showed that when the lead editing protein was PE2, the editing efficiency using pegRNA could reach 37% ( Figure 1 ); When the lead editing protein is PE2max, the editing efficiency using pegRNA can reach 20% ( Figure 2 ); When the lead editing protein is PE3, the editing efficiency using pegRNA can reach 24% ( Figure 3 ); When the lead editing protein is PE4, the editing efficiency using pegRNA can reach 41% ( Figure 4 ); When the lead editing protein is PE5, the editing efficiency using pegRNA can reach 24% ( Figure 5 ).

[0092] Example 5: Construction of a plasmid containing PE2 editor and pegRNA sequence fragments using AAV as a vector

[0093] Adeno-associated virus (AAV) is an efficient and safe transgenic vector with the advantages of good safety, low immunogenicity, and stable expression. It is currently one of the most widely used viral vectors in gene therapy. Since the maximum genome carried by the two ITR sequences of the AAV vector is 4.7kb, it cannot accommodate the PE2 editor and the pegRNA sequence fragment. The PE2 editor needs to be split into two halves and packaged into two viruses, AAV-PE2-N and AAV-PE2-C. According to laboratory research results, the Cas9 1026 split has a higher editing efficiency, and the split at position 1026 is selected. In order to make the protein expressed by the virus combine into a complete editor, it is necessary to add an intein sequence at the split position. The intein is embedded in the primer. In the process of the precursor protein being transformed into a mature protein, the intein is released from the precursor protein by self-cleavage, and the peptide chains at both ends are connected by peptide bonds to form a complete sequence. At the same time, in order to ensure sufficient pegRNA, the pegRNA sequence fragment opposite to the editor is inserted into the two plasmids AAV-PE2-N and AAV-PE2-C at the same time. The specific construction steps are as follows:

[0094] 1. Construction of AAV-PE2-N plasmid

[0095] Using AAV-CBE N (product of Addgene, catalog number Plasmid #137175) as a template and AA VF: 5'-ataggccctcttcctgcccgacctt-3' and AAV-R: 5'-gttgctgactcgcttgttcctggtgtctcgctg ccagaggatcctccgctagatcctccagagtcacctcccagctgaga-3' as primers, PCR amplification was performed to obtain the AA VN vector linear fragment. Using the PE2 lead editor plasmid (Addgene product, item number Plasmid#132775) as a template, PE2-NF: 5'-ggaacaagcgagtcagcaacaccagagagcagtggcggcagcag cggcggcagcagcaccctaaatatagaagat3', PE2-NR: 5'-agaggttgattatcagatcttacacctt3' as primers, PCR amplification was performed to obtain the PE2-1026-N linear fragment. Using the pegRNA expression vector in Example 4 as a template, pegRNA-F: 5'-ggaaagtctaaagatctgataatcaa-3', pegRNA-R: 5'-aaggtcgggca ggaagagggcctatttcccatg-3' as primers, PCR amplification was performed to obtain the pegRNA linear fragment. The linear fragment of AAV-N vector, PE2-1026-N linear fragment and pegRNA linear fragment were added to the Gibson reaction system. After homologous recombination reaction at 50℃ for 1h, the PE2-1026-N fragment and pegRNA linear fragment were inserted into the AAV-N split vector, and the model plasmid was constructed and sequenced. The plasmid with correct sequencing verification is the AAV-PE 2-N plasmid.

[0096] 2. Construction of AAV-PE2-C plasmid

[0097] AAV-CBE N (product of Addgene, catalog number Plasmid #137175) was used as a template and AAV-F: 5'-ataggccctcttcctgcccgacctt-3' and AAV-R: 5'-gttgctgactcgcttgttcctggtgtctcgctgcc agaggatcctccgctagatcctccagagtcacctcccagctgaga-3' were used as primers to perform PCR amplification to obtain the linear fragment of the AAV-C vector. Using the PE2 lead editor plasmid (Addgene product, item number Plasmid#132775) as a template, PE2-CF: 5'-aacaccagagagcagtggcggcagcagcggcggcagcagcaccctaa atatagaag-3', PE2-CR: 5'-tatcagatctttagactttcctcttcttcttgggc-3' as primers, PCR amplification was performed to obtain the PE2-1026-C linear fragment. Using the pegRNA expression vector in Example 4 as a template, pegRNA-F: 5'-ggaaagtctaaagatctgataatcaa-3', pegRNA-R: 5'-aaggtcgggcaggaagagggcctatttcc catg-3' as primers, PCR amplification was performed to obtain the pegRNA linear fragment. The linear fragment of AAV-C vector, PE2-1026-C linear fragment and pegRNA linear fragment were added to the Gibson reaction system, and the PE2-1026-C fragment and pegRNA linear fragment were inserted into the AAV-C split vector after homologous recombination reaction at 50℃ for 1h, and the model plasmid was constructed and sequenced. The plasmid with correct sequencing verification is the AAV-PE2-C plasmid.

[0098] 3. Transfected cell model repairs the V342F mutation of the TRPV4 gene

[0099] HEK293T cells containing the TRPV4 gene fragment with V342F mutation constructed in Example 3 (hereinafter referred to as HEK293T model cells) were cultured at 5×10 524-well plates were plated with 1000 cells / well. When the cells in each well grew to 40%-60%, 450 ng of AAV-PE2-N and AAV-PE2-C plasmids were used to transfect HEK293T model cells using PEI reagent. 120 hours after transfection, genomic DNA was extracted using rapid DNA extraction solution (Epicentre, USA). PCR was performed using Taq DNA polymerase (Kangwei Century, China) with FE-seq-F: 5'-agagaacccgcacaagaagg-3' and FE-seq-R: 5'-ccatcattgttgagcacggc-3' as primers for the 200 bp-300 bp region near the edited site. The PCR products were subjected to high-throughput sequencing (Qingke Company, sequencing results are shown in Figure 2). Figure 6 The editing efficiency was calculated.

[0100] Experimental results: The editor was split and the pegRNA sequence was inserted into the AAV genome and then transfected to edit the specific site. The results showed that the editing efficiency of the lead editing system of the present invention when repairing the TRPV4 gene mutation can reach 8%.

[0101] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. pegRNA, characterized in that The pegRNA includes sgRNA, RT template and primer binding site, and the nucleotide sequence of the RT template is positions 108-121 of SEQ ID No.

2.

2. The pegRNA according to claim 1, characterized in that The nucleotide sequence of the pegRNA is SEQ ID No.

2.

3. A DNA molecule, characterized in that The DNA molecule is any of the following: A1) a DNA molecule encoding the pegRNA according to claim 1 or 2; A2) A DNA molecule having a nucleotide sequence of SEQ ID No.

3.

4. Biomaterial, characterized in that The biological material is any of the following: B1) an expression cassette containing the DNA molecule according to claim 3; B2) a recombinant vector containing the DNA molecule of claim 3, or a recombinant vector containing the expression cassette of B1); B3) a recombinant microorganism containing the pegRNA according to claim 1 or 2 or the DNA molecule according to claim 3, or a recombinant microorganism containing the expression cassette according to B1), or a recombinant microorganism containing the recombinant vector according to B2); B4) a recombinant host cell containing the pegRNA of claim 1 or 2 or the DNA molecule of claim 3, or a recombinant host cell containing the expression cassette of B1), or a recombinant host cell containing the recombinant vector of B2).

5. Any of the following uses of the pegRNA according to claim 1 or 2, the DNA molecule according to claim 3, or the biomaterial according to claim 4: C1) Application in repairing the TRPV4 gene V342F mutation; C2) Use in the preparation of a medicament or reagent for treating chondrodysplasia syndrome in Scottish Fold cats; C3) Application in specific recognition and / or targeting of TRPV4 gene; C4) Use in the preparation of a lead editing system for treating Scottish Fold cat chondrodysplasia syndrome; C5) is used in the prime editing of TRPV4 gene.

6. A pilot editing system, characterized in that: The lead editing system includes at least any one of the following: D1) the pegRNA of claim 1 or 2; D2) The expression cassette of claim 4; D3) The recombinant vector according to claim 4.

7. The lead editing system according to claim 6, characterized in that: The prime editing system also includes a prime editing protein.

8. The lead editing system according to claim 7, characterized in that: The lead editing protein is PE 2, PE2max, PE3, PE4 or PE5.

9. Any of the following uses of the lead editing system according to any one of claims 6 to 8: E1) Application in repairing the TRPV4 gene V342F mutation; E2) Use in the preparation of a medicament or reagent for treating chondrodysplasia syndrome in Scottish Fold cats; E3) in the application of prime editing targeting TRPV4 gene.

10. A method for lead editing to repair the V342F mutation in the TRPV4 gene, characterized in that: The method comprises the step of performing lead editing using the pegRNA of claim 1 or 2, the DNA molecule of claim 3, the expression cassette of claim 4, the recombinant vector of claim 4 and / or the lead editing system of any one of claims 6-8.

Images