Anti-genome sequence and construction method and application of recombinant virus

Abstract

The invention belongs to the technical field of biomedicine, and particularly relates to a construction method and application of an anti-genome sequence and a recombinant virus, and the L delta M2-2 anti-genome sequence is shown as SEQ ID NO.2. The recombinant virus constructed by using the LdeltaM2-2 anti-genome sequence has attenuated effects of different degrees, and the recombinant virus can be used as a human or animal immune vaccine or used for preclinical experimental evaluation or can be used as a carrier carrying other antigens.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular relates to a construction method and application of an antigenome sequence and a recombinant virus. Background Art

[0002] Respiratory Syncytial Virus (RSV) is the most important pathogen causing lower respiratory tract infections in children under five years old, and can also cause respiratory diseases in the elderly and immunocompromised adults. Conservative estimates show that RSV infects 64 million children worldwide each year and kills more than 160,000 children. Some studies have suggested that RSV infection in infancy may also be associated with the development of asthma in later life. So far, humanized monoclonal antibodies that can be used for passive immunization of high-risk infants and subunit protein vaccines for people over 60 years old have been approved for marketing in the United States, but there is currently no RSV vaccine that can be used for active immunization of infants and young children.

[0003] The development of RSV vaccines has gone through twists and turns. The earliest inactivated RSV vaccine (FI-RSV) in clinical trials showed enhanced disease (ERD) when RSV was infected in infants and young children with negative RSV serology, resulting in the death of two children. The tragic failure of the FI-RSV vaccine has put forward higher requirements for the development of RSV vaccines, especially when using subunit vaccines to immunize seronegative children. Unlike inactivated and subunit vaccines, clinical practice of RSV live attenuated vaccines has not seen ERD so far, indicating that RSV live attenuated vaccines are an effective method for immunizing seronegative children. Live attenuated vaccines can mimic mild natural infections and induce the body to produce humoral and cellular immunity. When administered by nasal drops, they can also induce local mucosal immunity in the respiratory tract. Therefore, live attenuated vaccines have outstanding advantages in infant immunization.

[0004] RSV attenuated live vaccines have been developed since the 1970s. In the early days, physical and chemical induction of mutations and replacement of hosts for passage to screen attenuated mutants were mainly used. Attenuated strains are currently mainly prepared by genetically modifying RSV genome or antigenome cDNA through reverse genetics technology. The intensity of the protective immune response induced by attenuated live vaccines is related to the degree of viral replication. Attenuated RSV is usually accompanied by weakened replication and reduced antigen expression, which ultimately leads to decreased immunogenicity; while increased replication and enhanced immunogenicity may lead to excessive virulence and prominent safety issues. Therefore, achieving a balance between safety and immunogenicity is the difficulty in preparing RSV attenuated live vaccines and the ultimate goal of attenuated live vaccine research and development. RSV virus belongs to a single negative-strand RNA virus, and RNA viruses usually have genetic instability, which causes the attenuated point mutation to be converted to wild type again or functional compensation during passage or amplification in the host, resulting in de-attenuation. This genetic instability derived from point mutations brings another difficulty to the development of RSV attenuated strains. Therefore, it is urgent to provide a recombinant RSV virus with genetic stability, good attenuation effect and strong immunogenicity. Summary of the invention

[0005] The purpose of the present invention is to provide a method for constructing and applying an antigenome sequence and a recombinant virus. The recombinant virus constructed using the LΔM2-2 antigenome sequence has different degrees of attenuation effects.

[0006] The present invention provides a LΔM2-2 antigenome sequence, and the LΔM2-2 antigenome sequence is shown as SEQ ID NO.2.

[0007] The present invention provides a LΔM2-2wt antigenome sequence obtained by modifying the above LΔM2-2 antigenome sequence.

[0008] As a preferred embodiment, the LΔM2-2wt antigenome sequence is shown as SEQ ID NO.3.

[0009] The present invention provides the use of the LΔM2-2 antigenome sequence or the LΔM2-2wt antigenome sequence in preparing a recombinant human respiratory syncytial virus.

[0010] The present invention provides a recombinant human respiratory syncytial virus constructed using the LΔM2-2 antigenome sequence or the LΔM2-2wt antigenome sequence.

[0011] The present invention provides a method for constructing the above-mentioned recombinant human respiratory syncytial virus, and the construction method comprises the following steps:

[0012] Based on the rRSVLong antigenome sequence, a total of 207 nt sequences downstream of the M2-2 gene between nt8109-8315 were deleted, and the upstream coding region of up to 21 amino acids and the downstream termination codon of the M2-2 gene were retained to obtain the LΔM2-2 antigenome sequence; using reverse genetics methods, recombinant human respiratory syncytial virus was obtained.

[0013] As a preferred embodiment, the rRSVLong antigenome sequence is shown as SEQ ID NO.1.

[0014] As a preferred embodiment, after obtaining the LΔM2-2 antigenome sequence, modification is further included;

[0015] The modification includes the following steps: based on the LΔM2-2 antigenome sequence, the 112nt deleted downstream of the SH gene is restored and the codon mutation of the downstream part of the SH gene coding region is restored to the wild type arrangement to obtain the LΔM2-2wt antigenome sequence.

[0016] The present invention provides the use of the recombinant human respiratory syncytial virus in preparing a live attenuated RSV vaccine.

[0017] The present invention provides the use of the recombinant human respiratory syncytial virus in preparing an animal model for in vivo attenuated phenotype observation.

[0018] Beneficial effects:

[0019] 1. The recombinant cDNA plasmid constructed in the present invention uses the RSV Long strain as the parent, and adds ribozyme sequences on both sides of the antigenome of the recombinant plasmid, which can ensure that the transcribed antigenome RNA does not carry additional components, thereby increasing the rescue success rate of the recombinant virus and avoiding the introduction of unnecessary additional gene components.

[0020] 2. The recombinant RSV virus obtained by the present invention has different degrees of attenuation effect and can be used to prepare RSV attenuated live vaccines or as a carrier to prepare multivalent attenuated live vaccines.

[0021] 3. The present invention achieves attenuation through gene deletion, and the virus is difficult to be attenuated through reverse mutation or functional compensation, and has better genetic stability.

[0022] 4. The attenuated mutant strain obtained by the present invention has a high replication level in Vero cells and can obtain a replication titer close to that of the wild-type virus, making it easy to carry out large-scale production and reducing the preparation cost of the vaccine.

[0023] 5. The recombinant RSV virus obtained by the present invention can be used for preclinical experimental evaluation. The recombinant virus constructed using the LΔM2-2 antigenome sequence has different degrees of attenuation effect, that is, the attenuation difference can be reflected by observing and comparing the in vitro growth curve of the recombinant virus, the difference in virus replication titer of animal experiment lung, and the change in weight of infected animals. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 A partial schematic diagram of the deletion of part of the M2-2 gene sequence for the recombinant virus;

[0025] Figure 2 It is a partial schematic diagram of the downstream sequence of the recombinant virus SH gene;

[0026] Figure 3 Schematic diagram of the structure of the recombinant rRSVLong antigenome cDNA and its control elements. T7 : T7 promoter; HHrz: hammerhead ribozyme; Le: leader region; Tr: trailer region; HDVagrz: HDV antigenome ribozyme; T T7 : T7 terminator;

[0027] Figure 4 Schematic diagram of the structure of the pBR322C plasmid vector;

[0028] Figure 5 Schematic diagram of the pBACblunt vector structure;

[0029] Figure 6 This is the restriction enzyme electrophoresis pattern of the rRSVLong antigenome cDNA clone prRSVLong;

[0030] Figure 7 The restriction enzyme electrophoresis patterns of the recombinant RSV antigenome plasmids pLΔM2-2wt and pLΔM2-2 with partial deletion of the M2-2 gene;

[0031] Figure 8 The cytopathic effect of recombinant RSV virus of P0 generation was observed after blindly passing it into HEp-2 cells: A was transfected with only the auxiliary plasmid, B was co-transfected with pLΔM2-2wt and the auxiliary plasmid, and C was co-transfected with pLΔM2-2 and the auxiliary plasmid;

[0032] Fig. 9 Figure 1 shows the results of immunoblot analysis of HEp-2 cells and Vero cells infected with recombinant RSV virus: A is not inoculated with virus, B is inoculated with wild-type RSVLong, C is inoculated with LΔM2-2wt recombinant virus, and D is inoculated with LΔM2-2 recombinant virus;

[0033] Fig.10 This is a diagram showing the results of the cell growth kinetics test of the recombinant RSV virus;

[0034] Fig.11 The results of ultrastructural morphological characteristics detection of recombinant RSV virus are shown in Figure 1. A is the observation result of ultrathin section transmission electron microscope (JEM-1400) of cells infected with recombinant virus, and B is the observation result of colloidal gold immunolabeling sample;

[0035] Fig.12 This is a diagram showing the results of RT-PCR detection and analysis of local genes of the recombinant virus after passage;

[0036] Fig.13 DotBlot (A) and WesternBlot (B) detection results of antigen expression of recombinant RSV virus;

[0037] Fig.14 Figure 2 shows the results of physical signs (A) and body weight (B) of mice after inoculation with recombinant RSV virus.

[0038] Fig.15 This is the RT-qPCR test result of lung virus replication titer after mice were inoculated with recombinant RSV virus;

[0039] Fig.16 The results of the detection of specific serum antibodies (A) and cellular immune responses (B) after mice were inoculated with the recombinant RSV virus. DETAILED DESCRIPTION

[0040] In a specific embodiment of the present invention, based on the public sequence of human RSV Long strain (ATCC VR-26, Genbank accession number: AY911262), part of the nucleotide sequence was modified (as shown in Table 1) to obtain the antigenome of the recombinant virus rRSVLong as shown in SEQ ID NO.1, wherein the modifications such as C>G at position 4 are known to improve the efficiency of recombinant virus rescue (see Jin, et al. 1998. Virology 251: 206-214), and deletion and modification of part of the downstream region of the SH gene can improve the prokaryotic stability of cDNA clones (see Luongo, et al. 2012. J Virol 86: 10792-10804), and other mutations facilitate the process of preparing cDNA clones in the present invention.

[0041] Table 1 Sequence differences between the recombinant virus rRSVLong and RSV Long antigenome

[0042]

[0043]

[0044] *All positions are antigenome positions of RSV Long strain (Genbank accession number AY911262), and all sequences are positive sense.

[0045] In a specific embodiment of the present invention, a total of 207 nt sequences downstream of the M2-2 gene located between nt8109-8315 are deleted on the basis of the rRSVLong antigenome, and a maximum of 21 amino acid coding regions upstream of the M2-2 gene and a downstream termination codon are retained. A partial schematic diagram of deleting part of the M2-2 gene sequence is shown in FIG. Figure 1 As shown, the LΔM2-2 antigenome sequence is shown in SEQ ID NO. 2. Deleting the M2-2 gene can reduce viral replication and increase the transcription level, and attenuate the virus while increasing the antigen expression amount; different schemes can be used to delete the gene, destroying or shortening the reading frame to cause the gene transcription and the translated protein to be too short and lose function, thereby achieving the purpose of destroying the gene function.

[0046] Specifically, the deletion method of the M2-2 gene is compared: MEDIΔM2-2 (see: Karron, et al. 2015. Sci Transl Med. 7: 312ra175) and RSV276 (see: Cunningham, et al. 2018. J Infect Dis 226: 2069-2078) are both based on the recombinant A2 strain, retaining the 12 amino acid codons upstream of the M2-2 gene. The LΔM2-2 of the present invention is based on the Long strain, retaining the 21 amino acid codons upstream of the M2-2 gene, retaining 9 more amino acid codons than the previous two, a total of 27 nt, and a longer genome length, which is expected to slightly increase the gene replication burden and thus improve the attenuation effect.

[0047] In a specific embodiment of the present invention, based on the obtained LΔM2-2 antigenome sequence, the 112 nt deleted downstream of the SH gene is restored and the codon mutation of the downstream part of the SH gene coding region is restored to the wild type arrangement. The partial schematic diagram of the downstream sequence of the SH gene is as follows: Figure 2 As shown, the LΔM2-2wt antigenome sequence was obtained as shown in SEQ ID NO.3.

[0048] In a specific embodiment of the present invention, a reverse genetics method is used (Xu, et al. 2018. Biomed Res Int 2018: 8431243; Wang, et al. 2021. Virol Sin 36: 706-720; Collins, et al. 1995. Proc Natl Acad Sci USA 92: 11563-11567) to obtain recombinant RSV virus. The present invention is to produce the antigenomic RNA of the recombinant RSV virus in the host cell, and further produce the recombinant RSV virus that can infect and amplify. It is necessary to first prepare infectious cDNA (which can transcribe viral antigenomic RNA in the host cell), that is, add a T7 promoter upstream and a T7 terminator sequence downstream of the recombinant rRSVLong viral antigenomic cDNA to control the antigenomic transcription. In order to ensure the integrity of the viral antigenomic, ribozyme structural sequences are also added on both sides, that is, a hammerhead ribozyme sequence (hammerheadribozyme, HHr; see: Martin, et al. 2006. J Virol 80:5708-5715) sequence is added upstream, and a hepatitis D virus antigenomic ribozyme sequence (HDV anti-genome ribozyme, HDVagr; see: Perrotta, et al. 1991. Nature 350:434-436) is added downstream. The schematic diagram of the structure of the recombinant rRSVLong viral antigenomic cDNA is shown in FIG. Figure 3 As shown, restriction enzyme sites were added to both sides of the cDNA sequence and then cloned into an appropriate vector to obtain an infectious cDNA clone.

[0049] The vector of the present invention can be a plasmid, in one embodiment, pBR322C, which is derived from the pBR322 plasmid vector, with some sequences deleted and multiple cloning sites inserted. These multiple cloning sites are used for the segmented cloning of the above cDNA. The pBR322C plasmid map is shown in Figure 4 The complete sequence of pBR322C plasmid is shown in SEQ ID NO.4.

[0050] In a specific embodiment of the present invention, the LΔM2-2wt antigenome cDNA clone is unstable when amplified in prokaryotic cells, and a bacterial artificial chromosome (BAC) vector is required. The vector has basic elements (such as Ori, repE, SopA / B / C) and resistance genes for maintaining single copy replication in a bacterial host, such as pBACblunt, which is derived from the bacterial artificial chromosome pSMARTBAC. The multiple cloning site and part of the backbone sequence are modified for cloning convenience, and the RSV antigenome sequence and its control elements are inserted between the SwaI and NruI sites. The pBACblunt vector structure is shown in the schematic diagram as follows Figure 5 The complete sequence of the pBACblunt vector is shown in SEQ ID NO.5.

[0051] In a specific embodiment of the present invention, the recombinant RSV virus antigenome cDNA of the present invention is synthesized in segments and cloned on the above-mentioned plasmid or BAC vector using molecular biological methods well known in the art to obtain the infectious clone of the recombinant RSV virus antigenome cDNA, which is co-transfected with four auxiliary plasmids expressing RSV N, P, L, and M2-1 proteins into BHK-T7 / 9 cells (see: CN201710574632.2) that stably express T7RNP, and the recombinant virus is obtained by passage and amplification culture under appropriate temperature and culture conditions. The phenotype and genetic stability of the recombinant virus are identified by cytopathic observation, immune plaque analysis, RT-PCR detection, transmission electron microscopy observation and other methods.

[0052] The recombinant RSV virus of the present invention has different degrees of attenuation phenotype, which can be found through in vitro and in vivo experimental observations. Experiments that can be used for in vitro attenuation analysis include but are not limited to cytopathic observation, plaque size analysis, growth curves of different host cells, temperature sensitivity experiments, etc.; model animals such as mice, cotton rats, African green monkeys, etc. can be used for in vivo attenuation phenotype observation of recombinant viruses. These experimental animals are only semi-permissive for human RSV replication, and the degree of permission is increasing in sequence. The results of animal experiments cannot be fully reproduced in human experiments, and need to be analyzed and treated with caution.

[0053] In order to further illustrate the present invention, the construction method and application of an antigenome sequence and recombinant virus provided by the present invention are described in detail below in combination with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0054] Example 1 Construction of recombinant RSV infectious cDNA clone

[0055] Construction of prRSVLong plasmid

[0056] Based on the pBRB-RSV-rLong / A2cp plasmid (the plasmid carries the recombinant RSV Long strain antigenome and cp mutation, T7 promoter, terminator and ribozyme and other expression-related control elements, see patent CN201710574632.2), the pBRB-RSV-rLong / A2cp plasmid was cloned according to the restriction site (such as Figure 3 ) fragments were subcloned into the plasmid vector pBR322C (eg Figure 4, sequence as shown in SEQ ID NO.4), the cp mutation carried on the subclone was restored to the wild type by site-directed mutagenesis (Peng Xianglei et al. Single primer PCR method for introducing site-directed mutagenesis. Chinese Journal of Biotechnology, 2020, 40(8):19-23), and the subclones were then digested and connected to obtain the infectious cDNA clone plasmid prRSVLong (sequence as shown in SEQ ID NO.6) carrying the rRSVLong antigenome (sequence as shown in SEQ ID NO.1) and expression control elements. The restriction enzyme digestion identification results of the plasmid are shown as follows Figure 6 As shown, the sequence was confirmed by whole plasmid sequencing.

[0057] Construction of pLΔM2-2 plasmid

[0058] Specific primers (delM2-2-SacI-5', sequence as shown in SEQ ID NO.10: 5'-CAAGAGCTCGAGTTAATACTTGATAAAG-3' and delM2-2-3'B, sequence as shown in SEQ ID NO.11: 5'-CGCGGATCCATTTTGTCCCACAGCTTGAATTATTTGAATTAATAAT TCAACGATATGGTCAGTATTAGGATTGAGTGTTAGTCAGGTAGTATCATTAT TTTTGGCATG-3', bold fonts indicate restriction sites) were designed to perform PCR amplification using the prRSVLong plasmid as a template to obtain a PCR product lacking the M2-2 gene. The PCR product was digested with restriction endonucleases SacI and BamHI, and then cleaved with T4 DNA ligase is used to connect the large fragment of prRSVLong plasmid cut with the same enzyme, and the corresponding fragment is replaced. The ligation product is transformed into Escherichia coli DH5ɑ competent cells, coated with ampicillin LB plates and cultured overnight, and a well-dispersed single clone is picked, and the plasmid is extracted by alkaline method. The restriction endonuclease AflII is used for enzyme fingerprint identification (such as Figure 7 The positive clones identified by restriction digestion were sequenced to obtain the recombinant RSV LΔM2-2 antigenome carrying the deleted part of the M2-2 gene (the sequence is shown in SEQ ID NO.2) and the infectious cDNA clone plasmid pLΔM2-2 (the sequence is shown in SEQ ID NO.7) containing the expression control element.

[0059] Construction of pLΔM2-2wt plasmid

[0060] Different from the preparation of pLΔM2-2 plasmid, the infectious cDNA cloning vector carrying the LΔM2-2wt sequence is the bacterial artificial chromosome pBACblunt, because the latter cannot obtain positive clones using the above-mentioned pBR322C plasmid vector, which may be that the LΔM2-2wt sequence cDNA still cannot be stably amplified in the E. coli host. Bacterial artificial chromosomes can maintain single-copy replication in E. coli cells, which is conducive to the preparation of prokaryotic unstable cDNA clones. The DNA molecule seamless assembly kit (In-Fusion Snap Assembly cloning kits, Takara) was used, with the bacterial artificial chromosome pBACblunt (derived from the commercial vector pSMART BAC, Lucigen) as the vector. The vector structure diagram is shown in the figure. Figure 5 As shown, the sequence is shown in SEQ ID NO.5, the LΔM2-2 antigenome cDNA sequence was inserted, and then the SacI-AsuII fragment was replaced with the wild-type SacI-AsuIIwt fragment (synthesized by GenScript, the sequence is shown in SEQ ID NO.8) by restriction digestion and ligation, and then the enzyme digestion was identified (the result is shown in Figure 7 By sequencing the plasmid, we obtained the recombinant RSV antigenome LΔM2-2wt (sequence as shown in SEQ ID NO.3) carrying the missing part of M2-2 gene but the wild type downstream of SH and the cDNA infectious clone pLΔM2-2wt (sequence as shown in SEQ ID NO.9) of the expression control element.

[0061] Example 2 Rescue of recombinant viruses

[0062] BHK-T7 / 9 cells were inoculated one day in advance, and when the cells grew to a confluence of about 80%, pLΔM2-2 or pLΔM2-2wt antigenome cDNA clones and four auxiliary plasmids expressing RSV N, P, L, and M2-1 proteins were co-transfected into BHKT7 / 9 cells. The control group cells were only transfected with the four auxiliary plasmids and cultured in an incubator at 5% CO2 and 37°C. After 3 to 5 days of transfection, they were blindly transferred to Vero cells and continued to be cultured until cytopathic effects appeared. It can be seen that both the co-transfected pLΔM2-2wt / auxiliary plasmid group and the co-transfected pLΔM2-2 / auxiliary plasmid group showed typical cell fusion lesions ( Figure 8 B and C), while no cytopathic effect was observed in the control group transfected with only the auxiliary plasmid ( Figure 8 (A).

[0063] Example 3 Identification of in vitro activity of recombinant viruses

[0064] Immunoplaque identification of recombinant viruses

[0065] The recombinant viruses LΔM2-2wt and LΔM2-2 obtained after passage were inoculated into HEp-2 cells and Vero cells, respectively. The positive control group was inoculated with wild-type RSVLong, and the negative control group was not inoculated. The cells were cultured at 5% CO2 and 37°C for 3 to 5 days, fixed with methanol, incubated with RSV polyclonal antibody, incubated with horseradish peroxidase (HRP)-labeled secondary antibody, and the immune spots produced were observed under a microscope after color development with TMB colorimetric solution. The results are shown in FIG. Fig. 9 As shown, the recombinant virus LΔM2-2wt ( Fig. 9 C) and LΔM2-2 ( Fig. 9 D) and wild-type virus ( Fig. 9 Similar specific immunostaining was observed in the control group ( Fig. 9 Middle A) Not seen.

[0066] Growth kinetics analysis of recombinant viruses

[0067] The recombinant viruses LΔM2-2wt, LΔM2-2 and wild-type RSVLong were inoculated into HEp-2 and Vero cells at MOI=0.01, respectively. The cells and virus suspension were collected every 24 hours and stored in a -80°C refrigerator. After 6 days, the virus suspension was diluted tenfold and inoculated into the prepared 96-well plate Vero cells. The virus titer at different time points was detected by the above-mentioned immunoblot method. The dilution wells with the number of immune plaques between 10 and 100 were selected for counting, and the number of plaques was calculated according to the formula T=n*10. x *10pfu / mL (T is the virus titer, n is the average number of immune plaques in the counting wells, and x is the dilution factor corresponding to the counting wells) to calculate the virus titer and obtain the data to draw a growth curve as shown in Fig.10 shown.

[0068] Depend on Fig.10It can be seen that the replication of the recombinant virus in human HEp-2 cells was significantly restricted, and the peak time was delayed by about 24 hours. The peak titers of LΔM2-2wt and LΔM2-2 at 72 hours were 5.3log10 and 5.58log10pfu / mL, respectively, which were lower than the peak titer of 6.98log10pfu / mL of the wild-type virus at 48 hours, and the recombinant virus titers at different time points from 24 hours onwards were significantly lower than those of the wild-type virus; while in Vero cells, the replication abilities of the two recombinant viruses were slightly different, with the peak titer of LΔM2-2wt being 6.2log10 pfu / mL, slightly higher than the peak titer of LΔM2-2 of 5.6log10pfu / mL, and close to the peak titer of the wild-type virus of 6.5log10 pfu / mL (*p<0.5; **p<0.01; ***p<0.001). Vero cells are derived from African green monkey embryonic kidney cells and are often used for large-scale virus culture. The ability to replicate effectively in Vero cells is beneficial to reducing the cost of vaccine preparation.

[0069] Observation of morphological characteristics of recombinant viruses

[0070] The recombinant virus obtained by subculture was used to infect HEp-2 cells. After 20 hours, the cells were collected and fixed with 2.5% glutaraldehyde, washed with PBS, fixed with 1% osmium acid fixative, dehydrated, and embedded in resin to prepare ultrathin sections. After staining with 2% uranyl acetate and 0.2% lead citrate, observation using a transmission electron microscope (JEM-1400) showed that the virus was in budding state on the surface of the cell membrane. The cell membrane inside and outside the budding site showed high electron density. Clear spike structures were visible on the surface of the bud, and dot-like viral nucleocapsids were visible inside the cross section of the virus ( Fig.11 To further confirm the specificity of the virus morphology and ultrastructure, the virus-infected cells were collected and incubated with rabbit IgG monoclonal antibody (Sino Biological, Cat. No. 11049-R302) that recognizes human RSV F protein and colloidal gold-labeled goat anti-rabbit IgG (Solarbio, Cat. No. K1034G-G10), and then immunoelectron microscopy samples were prepared according to the above process. Transmission electron microscopy showed that colloidal gold particles specifically bound to the surface of the tubulovirus and overlapped with the spike structure of the RSV virus ( Fig.11 (middle B).

[0071] Gene deletion detection of recombinant RSV virus

[0072] After the recombinant RSV virus was passaged 10 times, total RNA was extracted and RT-PCR was used to amplify the gene fragment containing the M2-2 deletion. The primers used were M2-2-F1: 5'-TGCTAGAGAGTTATATAGGATC-3', as shown in SEQ ID NO.12; M2-2-R1: 5'-TCGGTTAGATAAACATTAGCAG-3', as shown in SEQ ID NO.13. The RT-PCR product size of the recombinant virus lacking the M2-2 gene was 498 bp, and the RT-PCR product size of the wild-type RS V Long was 704 bp. RT-PCR amplified the gene fragment containing the 112nt deletion downstream of the SH gene, the primers used were 112-F1: 5'-CTCCATCATGACTGCAATAC-3', as shown in SEQ ID NO.14; 112-R1: 5'-GGTTGTGTTCTTGATCTGGC-3', as shown in SEQ ID NO.15. The size of the RT-PCR product of the recombinant virus with 112nt deletion downstream of the SH gene was 433bp, and the size of the RT-PCR product of the wild-type RSV Long and the recombinant virus without 112nt deletion was 545bp. The RT-PCR product was detected by gel electrophoresis and the results were consistent with the expected size ( Fig.12 ), no sequence changes were found after sequencing the PCR products, and no atavism occurred, indicating that both recombinant viruses maintained good genetic stability.

[0073] Antigen expression detection of recombinant virus

[0074] The recombinant viruses LΔM2-2wt, LΔM2-2 and wild-type RSV Long were inoculated into HEp-2 cells at MOI=5, and the cells were collected after 48 hours. DotBlot and Western blot were used to detect the antigen expression of the virus:

[0075] DotBlot detection of viral antigen expression: 2uL was spotted on a nitrocellulose membrane, and each sample was spotted three times, blocked with 5% skim milk powder, and a sheep anti-human RSV polyclonal antibody (Millipore, catalog number AB1128) and 800CW donkey anti-sheep IgG secondary antibody (Gene Bio, Cat. No. 926-32214) was used for incubation and rinsing, and then fluorescence was analyzed by near-infrared dual-color laser imaging system (Odyssey CLx). It can be seen that the fluorescence of recombinant virus LΔM2-2wt and LΔM2-2 spots is significantly stronger than that of wild-type virus, indicating that the recombinant viruses express a higher level of RSV surface antigen F protein ( Fig.13 (A).

[0076] Western blot detection of viral antigen expression: The collected cells were resuspended in lysis buffer, boiled for 5 minutes, centrifuged, and the supernatant was taken. SDS-PAGE electrophoresis, transfer to nitrocellulose membrane, incubation with goat anti-human RSV polyclonal antibody and 800CW donkey anti-goat IgG secondary antibody were performed successively, or incubation with rabbit anti-human RSV F protein monoclonal antibody (Sino Biological, catalog number 11049-R302) and 800CW goat anti-rabbit IgG secondary antibody were performed successively. After rinsing, analysis was carried out by a near-infrared two-color laser imaging system (Odyssey CLx). It was found that the specific band widths and brightness of the recombinant viruses LΔM2-2wt and LΔM2-2 were significantly higher than those of the wild-type virus, indicating that the recombinant viruses expressed higher levels of surface antigens F and G glycoproteins ( Fig.13 in B).

[0077] Example 4 Mouse animal experiments of recombinant viruses

[0078] Evaluation of the attenuation effect of recombinant viruses: Detection of physical signs, body weight, and viral replication titer in the lungs

[0079] The recombinant viruses LΔM2-2wt and LΔM2-2, and wild-type RSV Long were respectively infected into BALB / c mice by the intranasal route at a dose of 10 6 pfu. The negative control group was given the same volume of PBS. The physical signs of the mice were examined daily and their body weights were measured. It was found that after infection with wild-type RSV Long, significant changes in the appearance of the mice occurred, such as fur wrinkles, loss of luster, and hunchback. The body weight decreased day by day within 7 days and did not recover; while the changes in the appearance of the mice infected with the recombinant viruses LΔM2-2wt and LΔM2-2 were milder, and the body weight gradually recovered to a level close to that of the PBS group after 3 days, indicating that the recombinant viruses had an obvious attenuation effect compared with the wild-type virus ( Fig.14 ). The lung tissues of the mice were collected 4 days after virus infection to prepare homogenates, and the viral titers in the lung tissues were detected by RT-qPCR (Xu, et al. 2018. Biomed Res Int 2018:8431243). The viral titers per unit lung tissue of the recombinant viruses LΔM2-2wt and LΔM2-2 were 6.16 log10 and 7.89 log10, respectively, while that of wild-type RSV Long was 8.75 log10. It can be seen that the viral titers in the recombinant virus group per unit lung tissue were significantly lower than those in the wild-type RSV Long group, and the replication intensities in the mouse lungs were in the order of: LΔM2-2 wt < LΔM2-2 < wild-type RSV Long, reflecting the differences in the attenuation degrees of the two recombinant viruses in mice ( Fig.15 , *P < 0.05; **P < 0.01; ***P < 0.001).

[0080] Evaluation of the immune effect of recombinant viruses: Detection of humoral and cellular immune responses

[0081] The recombinant viruses LΔM2-2wt and LΔM2-2 and wild-type RSV Long were respectively 6 BALB / c mice were infected with 50 pfu via intranasal route. Mice were killed 21 days later, blood was collected and spleen lymphocytes were isolated. The purified RSV virus was used to coat the plate, and RSV-specific serum antibodies were detected by ELISA. It can be seen that mice inoculated with recombinant viruses LΔM2-2wt and LΔM2-2 produced RSV-specific serum antibodies at a level similar to that of wild-type RSVLong, and there was no significant difference between the experimental groups. The isolated spleen lymphocytes were tested using CD8 + T cell-specific RSV F (85-93KYKNAVTEL) (249-258TYMLTNSEL) and M2-1 (82-90SYIGSINNI) (127-135VYNTVISYI) peptides were used to stimulate (Anderson, et al. 2010. Future Microbiol 5: 585-602), and the number of lymphocytes secreting IFN-γ was detected by ELISPOT method. It was found that the recombinant viruses LΔM2-2wt and LΔM2-2 had similar levels of cellular immune response to wild-type RSV Long, and there was no significant difference in the results ( Fig.16 , ns not significant; **P<0.01; ***P<0.001; ****P<0.0001).

[0082] It can be seen that the present invention is based on the RSV Long strain and modifies part of the gene sequence to obtain the LΔM2-2 antigenome sequence. The recombinant human respiratory syncytial virus (LΔM2-2 and LΔM2-2wt) constructed has different degrees of attenuation effect. It can be used as a human or animal immune vaccine or as a carrier to carry other antigens for use in preclinical experimental evaluation.

[0083] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A LΔM2-2 antigenome sequence, characterized in that: The LΔM2-2 antigenome sequence is shown in SEQ ID NO.

2.

2. The LΔM2-2wt antigenome sequence obtained by modifying the LΔM2-2 antigenome sequence according to claim 1.

3. The LΔM2-2wt antigenome sequence according to claim 2, characterized in that: The LΔM2-2wt antigenome sequence is shown in SEQ ID NO.

3.

4. Use of the LΔM2-2 antigenome sequence according to claim 1 or the LΔM2-2wt antigenome sequence according to any one of claims 2 to 3 in preparing a recombinant human respiratory syncytial virus.

5. A recombinant human respiratory syncytial virus constructed using the LΔM2-2 antigenome sequence of claim 1 or the LΔM2-2wt antigenome sequence of any one of claims 2 to 3.

6. The method for constructing the recombinant human respiratory syncytial virus according to claim 5, characterized in that: The construction method comprises the following steps: Based on the rRSVLong antigenome sequence, a total of 207 nt sequences downstream of the M2-2 gene between nt8109-8315 were deleted, and the upstream coding region of up to 21 amino acids and the downstream termination codon of the M2-2 gene were retained to obtain the LΔM2-2 antigenome sequence; using reverse genetics methods, recombinant human respiratory syncytial virus was obtained.

7. The construction method according to claim 6, characterized in that: The rRSVLong antigenome sequence is shown as SEQ ID NO.

1.

8. The construction method according to claim 6, characterized in that: After obtaining the LΔM2-2 antigenome sequence, modification is also included; The modification includes the following steps: based on the LΔM2-2 antigenome sequence, the 112nt deleted downstream of the SH gene is restored and the codon mutation of the downstream part of the SH gene coding region is restored to the wild type arrangement to obtain the LΔM2-2wt antigenome sequence.

9. Use of the recombinant human respiratory syncytial virus according to claim 5 in the preparation of a live attenuated RSV vaccine.

10. Use of the recombinant human respiratory syncytial virus according to claim 5 in preparing an animal model for observing attenuated phenotypes in vivo.

Images