Nucleic acid for coding ATP7B, adeno-associated virus vector and application of adeno-associated virus vector in preparation of medicine for preventing and treating hepatolenticular degeneration

Abstract

Particularly relates to nucleic acid for coding ATP7B, an adeno-associated virus vector and application of the adeno-associated virus vector in preparation of medicines for preventing and treating hepatolenticular degeneration. The invention provides an ATP7B GOI vector which can be packaged into an adeno-associated virus with cell viability, high yield and good integrity, and can be used for AAV gene therapy of WD. By using an engineered tissue-specific promoter and a truncated natural ATP7B gene with a unique sequence, the sequence length is suitable for being packaged into live adeno-associated virus particles, potential side effects caused by expression of the gene in tissues outside the liver are reduced to the greatest extent, and better in-vivo safety is expected.

Description

[0001] This application claims the priority of the Chinese patent application filed with the China Patent Office on June 28, 2023, with application number 202310780255.3 and invention name "Nucleic acid encoding ATP7B, adeno-associated virus vector and its use in the preparation of drugs for preventing and treating hepatolenticular degeneration", all contents of which are incorporated by reference into this application. Technical Field

[0002] The present invention relates to the field of biomedical technology, and in particular to a nucleic acid encoding ATP7B, an adeno-associated virus vector and applications thereof in preparing a drug for preventing and treating hepatolenticular degeneration. Background Art

[0003] Wilson's disease (WD) is an autosomal recessive single-gene genetic disease characterized by copper metabolism disorder. It is caused by mutations in the ATP7B gene, which leads to weakening or loss of the function of copper-transporting P-type ATPase (ATP7B). ATP7B is a membrane protein expressed in multiple organs, and its main function is to promote copper excretion with blood and bile. When the ATP7B gene mutates, the localization of ATP7B in the cell changes, and its ability to transport copper decreases, resulting in reduced serum ceruloplasmin synthesis and reduced copper excretion in bile, leading to varying degrees of excessive copper deposition in organs such as the liver, brain, kidney, and cornea, causing progressively worsening neuropsychiatric symptoms, liver biochemical abnormalities, corneal KF rings, kidney damage, hemolytic anemia, skeletal muscle damage and other clinical manifestations, which seriously affect the patient's quality of life and may even cause liver failure and death. The ATP7B gene is located on the long arm of chromosome 13 (13q14.3~q21.1), with a total length of about 85kb, including 21 exons and 20 introns, encoding a copper-transporting P-type ATPase composed of 1465 amino acids. ATP7B is a transmembrane protein, containing 6 N-terminal metal-binding domains (MBD), 8 transmembrane channels (TM-region), 1 ATP binding domain (nucleotide-bindingdomain, N-region), 1 phosphorylation domain (P-region), and 1 phosphatase domain (A-region). MBD contains a conserved amino acid motif that can bind copper ions with high affinity. Under the interaction of antioxidant protein 1 (Atox-1), MBD accepts copper transported from the cytoplasm and releases it into the transmembrane pore. ATP7B is synthesized in the endoplasmic reticulum and ultimately localized in the trans-Golgi network (TGN) of hepatocytes. Copper is an important trace element for the human body and is involved in many physiological processes such as the mitochondrial respiratory chain, neurotransmitter synthesis, and iron metabolism. ATP7B is essential for regulating the distribution and transport of copper in hepatocytes. ATP7B supplies copper ions in the TGN to synthesize new ceruloplasmin. When copper is excessive, ATP7B maintains the level of copper in the cytoplasm and transports excess copper to vesicles, which enter the bile through exocytosis. Genetic mutations in ATP7B may cause functional damage to the expression product, disrupt the excretion of copper from hepatocytes, lead to the accumulation of copper toxicity in the liver, and induce clinical symptoms of Wilson's disease.

[0004] There are several mutation hotspots and a large number of rare mutation sites in the ATP7B gene mutation associated with hepatolenticular degeneration. The mutation sites are mostly located in the exons of the transmembrane region and the functional region of the ATP7B gene. The mutation types include missense, nonsense, deletion, insertion, splicing and point mutations, among which missense or nonsense mutations caused by single nucleotides are the most common. Mutations affect copper binding, cyclic phosphorylation, transport and post-translational modification of ATP7B and its physiological interactions with other proteins to varying degrees, potentially interfering with ATP7B in excreting excess copper into bile and in the biosynthesis of plasma ceruloplasmin, which is essential for normal iron metabolism.

[0005] Currently, drugs used to treat Wilson disease include penicillamine, trientine, ammonium tetrathiomolybdate and zinc. Although existing drugs are effective for most WD patients, some patients cannot tolerate drug treatment or have serious adverse reactions. In addition, drugs such as penicillamine need to be taken orally multiple times a day and persist in taking medication for life, and patients have poor medication compliance. Therefore, the demand for new treatment methods for WD patients is becoming increasingly apparent. As a single gene genetic disease, WD is most ideal for gene therapy. Wilson disease pathogenic gene ATP7B has been cloned, laying the foundation for gene therapy research for the disease. Gene therapy is a technical means of introducing exogenous normal genes into target cells to correct or compensate for diseases caused by defective and abnormal genes, thereby achieving the purpose of treatment. So far, researchers have used adeno-associated virus (AAV) vectors to conduct clinical studies on diseases such as α1 antitrypsin deficiency, Alzheimer's disease, hemophilia, Leber congenital amaurosis, muscular dystrophy, and Parkinson's disease. As the field matures, a large number of gene therapy products have been approved for clinical trials, and gene therapy is becoming a feasible option for the clinical treatment of hereditary genetic diseases as well as tumors and infectious diseases. However, in general, the packaging capacity of AAV vectors is limited. How to maximize the transduction efficiency, improve the product purity and solidity rate while meeting the AAV packaging capacity is still an urgent problem to be solved in this field. Summary of the invention

[0006] In view of this, the technical problem to be solved by the present invention is to provide a nucleic acid encoding ATP7B, an adeno-associated virus vector and use thereof in the preparation of a drug for preventing and treating Wilson's disease.

[0007] The present invention provides a nucleic acid encoding ATP7B, comprising at least one of I) to IV):

[0008] 1), a nucleic acid having a nucleotide sequence as shown in SEQ ID NO: 1 or 2;

[0009] II), a nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in I);

[0010] III), a nucleic acid having at least 90% homology with the sequence of the nucleic acid described in I), and encoding ATP7B;

[0011] IV), a nucleic acid that is partially complementary or completely complementary to any one of I) to III).

[0012] The nucleic acid sequence encoding ATP7B provided by the present invention is suitable for the packaging capacity of adeno-associated virus vectors. Therefore, based on the nucleic acid fragment, adeno-associated virus particles with functional activity can be packaged, and the packaging product has good purity, solid rate and particle integrity. In some embodiments, the nucleic acid sequence encoding ATP7B is shown in SEQ ID NO: 1 or 2. Among them, the nucleic acid sequence shown in SEQ ID NO: 1 is obtained by codon optimization of the full-length ATP7B, and the nucleic acid sequence shown in SEQ ID NO: 2 is obtained by codon optimization of the truncated subtype ATP7B isoC. Compared with other codon optimization schemes, the nucleic acid shown in SEQ ID NO: 1 or 2 of the present invention is more suitable for expression with an adeno-associated virus vector, and the length is more suitable for packaging into AAV8 particles and maintaining complete Iso C, and the purity, solid rate and integrity of the packaging product are higher.

[0013] The present invention also provides an expression unit, which comprises a promoter and the nucleic acid as described above.

[0014] The expression unit of the present invention comprises an upstream TR segment, a promoter, the nucleic acid as described above, a SPA segment and a downstream TR segment connected in sequence. More specifically, the 5' end to the 3' end of the expression unit are an upstream TR segment, a promoter, the nucleic acid as described above, a SPA segment and a downstream TR segment in sequence. The promoter is an HLP promoter, an α1AT promoter or an AAT promoter. The SPA segment is a small Sv40 polyA tail, and the upstream TR segment and the downstream TR segment are terminal repeat sequences from AAV2.

[0015] Furthermore, the present invention also provides a recombinant vector, which includes a backbone vector and the nucleic acid as described above, or the expression unit as described above.

[0016] In the present invention, a recombinant AAV vector of ATP7B nucleic acid is constructed, which comprises TR-AAT promoter-ATP7B gene-SPA-TR sequence, etc., so as to be effectively packaged by AAV and mediate the transport of copper ions.

[0017] In the present invention, the backbone vector of the recombinant vector of the present invention is selected from at least one of a DNA virus vector, a retrovirus vector, a lentivirus vector, an adenovirus vector, and an adeno-associated virus vector. In some embodiments, the backbone vector is an adeno-associated virus vector, and the serotype of the adeno-associated virus vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV2.7M8 or AAV2-TYF mutant. In some specific embodiments, the serotype of the adeno-associated virus vector is AAV8. The backbone vector of the GOI plasmid is pUC57-GW-Kan.

[0018] Furthermore, the present invention also provides a plasmid combination, which includes the recombinant vector and the helper plasmid as described above.

[0019] Furthermore, the present invention also provides a host, which contains the recombinant vector as described above, or is obtained by transfection of the plasmid combination as described above.

[0020] In the present invention, the host is used to store and / or amplify the recombinant vector as described above, and the host is a plant cell, an animal cell, a fungus or a bacterium, for example, the host is a bacterium, specifically Escherichia coli. Alternatively, the host of the present invention is used to package and form virus particles, and the host is an animal cell, for example, the host is a mammalian cell, selected from at least one of HEK-293, HEK293T, Hep G2, HELA, CHO-K1, COS-1, COS-7, NIH3T3, A204, A549, D-407, CHO, HCS-2, HT-29, U87, Sf9, or FD-CHOS. More specifically, in the embodiment of the present invention, the adeno-associated virus of the present invention is packaged in HepG2 cells.

[0021] Furthermore, the present invention also provides a method for constructing an adeno-associated virus expressing ATP7B, which comprises: transfecting a host cell with the plasmid combination described above, and obtaining the adeno-associated virus expressing ATP7B by purification. In some embodiments, the host cell is a HepG2 cell.

[0022] Furthermore, the present invention also provides an adeno-associated virus expressing ATP7B prepared by the preparation method. The adeno-associated virus prepared by the present invention has high cell activity, high yield and good integrity.

[0023] Furthermore, the present invention also provides the use of the above-mentioned recombinant vector, or the above-mentioned plasmid combination, or the above-mentioned adeno-associated virus in the preparation of a drug for preventing and treating ATP7B mutation-related diseases. In the present invention, the ATP7B mutation-related disease is hepatolenticular degeneration.

[0024] The prevention and treatment includes increasing the transcription level of ATP7B, reducing the copper content in the liver and urine, restoring Cp activity and / or increasing the expression level of plasma Cp.

[0025] Furthermore, the present invention also provides a drug, which includes the recombinant vector as described above, or the plasmid combination as described above, or the adeno-associated virus as described above. The drug in the present invention has a good expression amount, high cell activity, and good integrity, and minimizes the potential side effects caused by gene expression in tissues other than the liver, and is expected to have better in vivo safety.

[0026] The medicine of the present invention also includes other medicines that have the function of preventing and treating diseases related to ATP7B mutation. The medicine of the present invention also includes pharmaceutically acceptable excipients, and its dosage form is an oral preparation or an injection. The injection is an injection powder and / or an injection liquid.

[0027] The present invention also provides a method for preventing and treating ATP7B mutation-related diseases, which comprises administering the drug of the present invention. More specifically, it is administering an effective dose of the drug. The administration method includes but is not limited to injection.

[0028] The present invention provides an ATP7BGOI vector that can be packaged into AAV8 with cell activity, high yield and good integrity, which can be used for AAV gene therapy of WD. By using an engineered liver tissue-specific promoter and a truncated natural ATP7B Iso C gene with a unique sequence, and increasing its expression in mammalian cells through codon optimization, the sequence length is made suitable for packaging into active AAV8 particles, which can effectively correct Cu in the liver of ATP7B KO mice. 2+ The defect of transport is eliminated and potential side effects caused by gene expression in tissues other than the liver are minimized, which is expected to have better in vivo safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Shows the schematic diagram of the composition of three ATP7B expression vectors;

[0030] Figure 2 Shown is the plasmid map of MW006;

[0031] Figure 3 Shows the mRNA expression capacity of three ATP7B expression vectors in vitro;

[0032] Figure 4 Shows the protein expression capabilities of three ATP7B expression vectors in vitro;

[0033] Figure 5 The in vitro biological activities of three ATP7B expression vectors are shown;

[0034] Figure 6 Indicates the integrity of the recombinant viral vector genome;

[0035] Figure 7 shows the EC-HPLC profile of SAAV8-MW006 virus particles;

[0036] Figure 8 Shown is the AEX-HPLC spectrum of AAV8-MW006 virus particles;

[0037] Fig. 9 Shows electron microscopic images of AAV8-MW006 virus particles (three different fields of view);

[0038] Fig.10 The transcription levels of ATP7B in mice of each group are shown, wherein A shows the detection results of primer1, and B shows the detection results of primer2;

[0039] Fig.11 The liver copper and urine copper contents of KO mice in each group are shown, where A shows the liver copper content and B shows the urine copper content;

[0040] Fig.12 The figure shows the changes in the plasma ceruloplasmin (Cp) content of KO mice in each group, wherein A shows the level changes and B shows the test results. DETAILED DESCRIPTION

[0041] The present invention provides nucleic acids encoding ATP7B, adeno-associated virus vectors and their use in the preparation of drugs for preventing and treating hepatolenticular degeneration. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0042] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0043] Herein, Wilson's disease is referred to as Wilson's disease, or WD for short. Copper-transporting P-type ATPase is referred to as copper-transporting P-type ATPase, or ATP7B for short. The nucleic acid fragment encoding the full-length ATP7B in the present invention is:

[0044]

[0045] The nucleic acid sequence encoding the truncated isoform ATP7B isoC is:

[0046]

[0047] The codon optimization described in the present invention includes but is not limited to codon usage preference, elimination of secondary structures that are not conducive to expression (such as hairpin structures), changes in GC content, CpG dinucleotide content, secondary structure of mRNA, cryptic splicing sites, early polyadenylation sites, internal ribosome entry sites and binding sites, negative CpG islands, RNA unstable regions, repeat sequences (direct repeats, inverted repeats, etc.) and restriction sites that may affect cloning.

[0048] In the present invention, the expression unit refers to a DNA sequence starting from a promoter and ending at a terminator. The promoter and the terminator may also include regulatory segments on both sides or between them. The regulatory segments may include a promoter, an enhancer, a transcription termination signal, a polyadenylation sequence, a replication origin, a nucleic acid restriction site, and a homologous recombination site operably connected to the nucleic acid sequence, such as an enhancer of the promoter, a poly (A) signal, etc. The expression unit described in the present invention is composed of an upstream TR segment, a promoter, the nucleic acid, a SPA segment, and a downstream TR segment. Among them,

[0049] The nucleic acid sequence of the upstream TR fragment is: ttggccactccctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagagagggagtggccaact ccatcactaggggttcct (SEQ ID NO: 3).

[0050] The nucleic acid sequence of the downstream TR fragment is: aggaacccctagtgatggagttggccactccctctgcgcgctcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagagagggagtggccaa (SEQ ID NO: 4).

[0051] The nucleic acid sequence of the SPA fragment is tcgcgaataaaagatcttttattttcattagatctgtgtgttggttttttgtgatgcagc (SEQ ID NO: 5).

[0052] Among them, the promoter is the HLP promoter, and its nucleic acid sequence is tgtttgctgcttgcaatgtttgcccattttagggtggacacaggacgctgtggtttctgagccagggggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattcaccagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggcaccaccactgacctgggacagtgaatc (SEQ ID NO:6).

[0053] Or the promoter is the α1AT promoter, and its nucleic acid sequence is ccaccccctccaccttggacacaggacgctgtggtttctgagccaggtacaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggcagcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattcaccagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggcaccaccactgacctgggacagt (SEQ ID NO:7).

[0054] Or the promoter is AAT promoter, and its nucleic acid sequence is ggatcttgctaccagtggaacagcca ctaaggattctgcagtgagagcagagggccagctaagtggtactctcccagagactgtctgactcacgccaccccctccaccttggacacaggacgctg tggtttctgagccaggtacaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggcagcgtaggcgggcgactcag atcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattcaccagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggcaccacccactgacctgggacagtgaatgatccccctgatctgcggcc(SEQ ID NO:8).

[0055] In the present invention, the recombinant vector refers to a nucleic acid molecule capable of amplifying another nucleic acid to which it is connected. The term includes vectors that are self-replicating nucleic acid structures and vectors that are integrated into the genome of a host cell into which the vector has been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operably connected. Herein, the recombinant vector, expression vector, plasmid vector, and plasmid are used interchangeably.

[0056] In the present invention, the host cell refers to a cell into which an exogenous nucleic acid is introduced, including the offspring of such a cell. Host cells include "transformants" and "transformed cells", which include primary transformed cells and offspring derived therefrom, without considering the number of passages. Offspring may not be completely identical to the parent cell in nucleic acid content, but may contain mutations. Mutant offspring having the same function or biological activity as screened or selected in the initially transformed cell are included herein.

[0057] In the present invention, the "adeno-associated virus vector" or "AAV" generally refers to the adenovirus itself or its derivatives. Adeno-associated virus (AAV) generally refers to a class of single-stranded DNA viruses belonging to the family Parvoviridae and the genus Dependovirus. The AAV genome may contain inverted terminal repeats (ITRs) at both ends of the DNA chain and two open reading frames (ORFs). The open reading frames may include rep and cap. rep is composed of multiple overlapping genes encoding the Rep protein required for the AAV life cycle, and cap contains overlapping nucleotide sequences encoding capsid proteins, which may include VP1, VP2 and VP3. The capsid proteins interact to form a capsid. AAV has a variety of common serotypes and more than 100 viral variants. In the present application, AAV capsid, ITR and other selected AAV components are selected from any AAV, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV8bp, AAV7M8 and AAV Anc80, any known or mentioned AAV variants or AAVs yet to be discovered or their variants or mixtures.

[0058] In the present invention, the "serotype" generally refers to the detection of epitopes on the surface of the adeno-associated virus capsid by serological methods and the typing of the adeno-associated virus. Adeno-associated virus has a variety of common serotypes and more than 100 virus variants. In this application, AAV capsid, ITR and other selected AAV components are selected from any AAV, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV8bp, AAV7M8 and AAVAnc80, any known or mentioned AAV variants or AAVs yet to be discovered or their variants or mixtures.

[0059] In the present invention, the drug comprises the virus particles of the present invention and a pharmaceutically acceptable auxiliary material or carrier. The auxiliary material or carrier is suitable for human use and must have sufficient purity and sufficiently low toxicity.

[0060] In the present invention, the "treatment" refers to surgical or therapeutic treatment, the purpose of which is to prevent, slow down (reduce) undesirable physiological changes or lesions in the treatment object, such as ATP7B mutation-related diseases. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, reduction of disease severity, stabilization of the disease state (i.e., no deterioration), delay or slowing of disease progression, improvement or alleviation of the disease state, and relief (whether partial relief or complete relief), whether detectable or undetectable. Objects in need of treatment include objects already suffering from a disease or disease, objects susceptible to a disease or disease, or objects intended to prevent a disease or disease. When referring to terms such as slowing down, mitigation, weakening, alleviation, and relief, their meanings also include situations such as elimination, disappearance, and non-occurrence. The object of treatment refers to an organism receiving treatment for a specific disease or condition as described in the present invention. Exemplarily, "subjects" include mammals such as humans, primates (e.g., monkeys) or non-primate mammals receiving treatment for a disease or condition.

[0061] The present invention will be further described below in conjunction with embodiments:

[0062] Example 1

[0063] 1. Construction and screening of functional truncated ATP7B protein expression plasmid

[0064] The expression plasmid for ATP7B expression used pUC50 as the backbone. After searching the transcription or splicing isoforms of human ATP7B (NCBI Gene ID: 540), the full-length ATP7B (denoted as WT-ATP7B-co) and the truncated isoform ATP7B isoC (denoted as ATP7B-isoC-co) were selected for AAV vector packaging. Considering the packaging capacity of AAV vector, three different ATP7B expression vectors (GOI plasmids) were designed using smaller liver-specific promoters (HLP promoter and α1AT promoter, AAT promoter) and a small Sv40 polyA tail. Figure 1 , Figure 2 ), and are recorded as:

[0065] MW004: From the 5' end to the 3' end, the upstream TR, HLP promoter, WT-ATP7B-co, SPA fragment, and downstream TR (the full length is shown in SEQ ID NO: 9) are connected in sequence.

[0066] MW005: From the 5' end to the 3' end, the upstream TR, α1AT promoter, WT-ATP7B-co, SPA fragment, and downstream TR (the full length is shown in SEQ ID NO: 10) are connected in sequence.

[0067] MW006: From the 5' end to the 3' end, the upstream TR, AAT promoter, ATP7B-isoC-co, SPA fragment, and downstream TR (the full length is shown in SEQ ID NO: 11) are connected in sequence.

[0068] 2. Preparation of AAV8-ATP7B Virus Particles

[0069] 2.1 Cell culture

[0070] The 293 cells were revived and cultured in a 37°C carbon dioxide incubator (RADOBIO, model: Herocell Cl). After about 2 weeks, the cell density was greater than 10 6 Pieces / mL.

[0071] 2.2 Virus packaging

[0072] The three constructed GOI plasmids, AAV8 RC plasmids, and auxiliary plasmids were mixed in a ratio of 1:1:2.5, and 293 cells were transfected with polyethyleneimine (PEI, Yeasen, 40816ES02). Cultured in a 37°C carbon dioxide incubator (RADOBIO, model: Herocell Cl). After 6 days, the fermentation broth with packaged viruses was taken out. Tween 20 (GENERAL-REAGENT, catalog number: G89190B) was added to the fermentation broth, and the cells were allowed to stand for 1 hour to lyse the cells and release the viruses inside the cells. Nuclease (ArcticZymes, catalog number: 70921-202) was added and allowed to stand for 1 hour to degrade long-chain DNA. Then vacuum filtration was used to remove cell debris.

[0073] 2.3 Purification of AAV8-ATP7B Virus Particles

[0074] The hollow fiber column (Repligen, catalog number: S02-E100-05-N) was connected to a tangential flow filtration system (Cytiva, model: AKTAflux 6) to concentrate the sample and remove some impurities such as DNA and proteins. The affinity column (ThermoScientific, catalog number: A36742) was connected to a chromatography instrument (Cytiva, model: AKTAavant 150) for chromatography to further remove impurities. The empty shell virus and residual impurities were then removed by an ion exchange column (BIA, catalog number: 411.5113-2). Finally, the ultrafiltration tube (BIOFIL, catalog number: FTT-200-500) was used to concentrate and exchange the liquid to obtain virus particles.

[0075] Effect verification

[0076] 1. Detection and evaluation of three AAV8 plasmid samples (AAV8-MW004, AAV8-MW005, AAV8-MW006)

[0077] 1. RT-PCR evaluation of the mRNA expression capacity of three ATP7B expression vectors in vitro

[0078] The control vector, MW004, MW005 and MW006 vectors were transfected into HepG2 cells using PEI reagent (Yeasen, 40816ES02). Total RNA was extracted from cells 24 hours after transfection (Promega, LS1040) and reverse transcribed to obtain cDNA (Vazyme, R323-01). The mRNA expression levels of different vectors in cells were detected by real-time fluorescence quantitative PCR using three primers. The results are shown in Figure 3 The results showed that all three vectors increased the mRNA expression level of ATP7B in hepatocytes, among which MW006 vector had the strongest expression ability.

[0079] 2. Western Blot method to evaluate the protein expression ability of three ATP7B expression vectors in vitro

[0080] The control vector, MW004, MW005 and MW006 vectors were transfected into HepG2 cells using PEI reagent (Yeasen, 40816ES02). Proteins were extracted using RIPA lysis buffer (Biyuntian, P0013B) 48 hours after transfection. The expression level of ATP7B protein in cells was detected by western blot using ATP7B antibody (Genetex, GTX30639). The results are shown in Figure 4 The results showed that all three vectors could increase the expression level of ATP7B protein in hepatocytes, among which MW006 vector had the strongest expression ability.

[0081] 3. Dual luciferase reporter gene assay to evaluate the in vitro biological activity of three ATP7B expression vectors

[0082] The control vector, MW004 vector, MW005 vector, MW006 vector, internal reference plasmid (Renilla), and pGL4.40[luc2P / MRE / Hygro] vector (Promega, E413A) were transfected into HepG2 cells using PEI reagent (Yeasen, 40816ES02). After 8 hours of transfection, the medium was changed and incubated for 24 hours with medium containing 200 μM copper sulfate (Sigma, 451657). According to the instructions of the Progema Dual Luciferase Reporter Gene Assay System (Progema, E1960), the fluorescence intensity value of each sample was read using a microplate reader. The results are shown in Figure 5 The results showed that the three carriers could reduce the copper content in liver cells in vitro, and their copper excretion abilities were comparable.

[0083] 4. Detection of the genome integrity of recombinant viral vectors

[0084] The integrity of the viral genome was detected by alkaline gel electrophoresis using AAV8 particles packaged from the three plasmid vectors. Figure 6 Comparing the three plasmid vectors packaged into AAV, the MW006 recombinant virus vector packaged with ATP7B isoC had the best genome integrity.

[0085] In summary, the biologically active truncated ATP7B recombinant viral vector MW006 (AAV8-MW006) has excellent potential for AAV product development.

[0086] 2. Evaluation of AAV8-MW006 Virus

[0087] 1. Size Exclusion Chromatography (SEC-HPLC) to Detect AAV Purity

[0088] The AAV8-MW006 virus particles prepared in Example 1 were commissioned to Shanghai Microspectra Technology Co., Ltd. for testing. A liquid chromatograph (Waters, model: ACQUITY UPLC H-Class Bio) was installed with a chromatographic column (Waters, catalog number: 186007643), and the column was equilibrated for 90 minutes. 100 μL was injected, and the UV wavelength was set to 280 nm for elution. After the experiment, the chromatogram was obtained as shown below: Figure 7 , as shown in Table 1.

[0089] Table 1: SEC-HPLC test results

[0090] Peak Retention time / min area high area% 1 10.884 16343 192 1.94 2 12.971 6641 176 0.79 3 15.298 817823 18765 97.27

[0091] The results of SEC-HPLC showed that the purity of AAV8-MW006 was 97.27%, which reached the industry standard: SEC-HPLC ≥ 95%, and was higher in purity than the other two virus ions obtained in Example 1.

[0092] 2. Ion exchange chromatography (AEX-HPLC) to detect AAV purity,

[0093] The AAV8-MW006 virus particles prepared in Example 1 were commissioned to Shanghai Microspectra Technology Co., Ltd. for testing. A chromatographic column (Waters, catalog number: 186004931) was connected to a liquid chromatograph (ThemoFisher, model: U3000HPLC). After balancing the chromatographic column for 90 minutes, 50 μL was injected, and the excitation wavelength was set to 280 nm and the emission wavelength to 350 nm for elution. The chromatogram obtained by detection is as follows: Figure 8 , as shown in Table 2.

[0094] The area normalization method is used to calculate the proportion of the main peak as shown in Table 2:

[0095] Table 2: AEX-HPLC test results

[0096] Peak Retention time / min area area% 1 15.9 609619.7 9.87 2 17.513 5563792 90.13

[0097] The AEX-HPLC results showed that the empty shell rate of AAV8-MW006 was 9.87%, and the non-empty shell rate was 90.13%, and most of the empty shells had been removed. The empty shell rates were lower than those of the other two virus ions prepared in Example 1.

[0098] 3. Electron microscopy to detect AAV purity

[0099] The AAV8-MW006 virus particles prepared in Example 1 were commissioned to Zhejiang Hengyu Biological Company for testing. Take 10 μL of the sample and drop it on the copper mesh, let it stand for 5 minutes, and absorb the liquid with filter paper. Drop 5 μL of 3% uranyl acetate (Rui Xin, product number: GZ02625) on the copper mesh for staining, let it stand for 3 minutes, and then absorb the liquid with filter paper. Use a transmission electron microscope (Thermo Scientific, model: Talos L120C) to take pictures under 120KV conditions ( Fig. 9 ). Select 3 regions to count the percentage of empty shell viruses as shown in Table 3:

[0100] Table 3: Electron microscopy test results

[0101]

[0102] The electron microscopy results showed that the empty shell viruses and solid viruses were clearly visible, with an average empty shell rate of 5.61%.

[0103] 4. Evaluation of the in vivo activity of AAV8-MW006 virus in mice

[0104] In the ATP7B KO mice constructed by the Southern Model Animal Center, AAV8-MW006 solution or PBS solution was injected into the tail vein to evaluate the in vivo pharmacodynamic activity of the preparation. The preparation was set up in two dose groups, 1E12 / mouse (low dose) and 5E12 / mouse (high dose). After 30 days of tail vein administration, the mouse urine, serum, and liver tissue were collected to detect the expression level of ATP7B mRNA in the mouse ( Fig.10 ) and copper metabolism index liver copper ( Fig.11 )、Urine copper( Fig.11 ), ceruloplasmin ( Fig.12 ) content, the experimental results show that:

[0105] Fig.10: Compared with wild-type mice (WT), the transcription level of ATP7B in KO mice after administration of different doses of AAV8-MW006 indicated that AAV8-MW006 significantly increased the transcription level of ATP7B in mice in a dose-dependent manner.

[0106] The primers involved are:

[0107] The sequences of the two primers of primer1 are: tccacctgagcaagagaacc; accaggttgtagatcagggc;

[0108] The sequences of the two primers of primer2 are: agcatccacctgagcaagag; aggttgtagatcagggccag.

[0109] Fig.11 : Compared with wild-type mice (WT), the liver copper and urine copper contents of KO mice after administration of different doses of AAV8-MW006 indicated that AAV-ATP7B significantly reduced the copper content in the liver and urine of mice in a dose-dependent manner.

[0110] Fig.12 :Compared with wild-type mice (WT), the changes in the plasma ceruloplasmin (Cp) content of KO mice after administration of different doses of AAV8-MW006 indicated that AAV8-MW006 could significantly restore Cp activity. WB results showed that AAV8-MW006 also significantly increased the expression of plasma Cp.

[0111] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A nucleic acid encoding ATP7B, comprising at least one of I) to IV): 1), a nucleic acid having a nucleotide sequence as shown in SEQ ID NO: 1 or 2; II), a nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in I); III), a nucleic acid having at least 90% homology with the sequence of the nucleic acid described in I), and encoding ATP7B; IV), a nucleic acid that is partially complementary or completely complementary to any one of I) to III).

2. The nucleic acid according to claim 1, characterized in that Its sequence is shown in SEQ ID NO: 1 or 2.

3. An expression unit comprising a promoter and the nucleic acid according to claim 1 or 2.

4. The expression unit according to claim 3, characterized in that It comprises an upstream TR segment, a promoter, the nucleic acid according to claim 1 or 2, a SPA segment and a downstream TR segment connected in sequence; The promoter is HLP promoter, α1AT promoter or AAT promoter.

5. A recombinant vector comprising a backbone vector and the nucleic acid according to claim 1 or 2, or the expression unit according to claim 3 or 4.

6. The recombinant vector according to claim 5, characterized in that The backbone vector is an adeno-associated virus vector, and the serotype of the adeno-associated virus vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV2.7M8 or AAV2-TYF mutant.

7. A plasmid combination, characterized in that: It comprises the recombinant vector and the auxiliary plasmid described in claim 5 or 6.

8. A host comprising the recombinant vector according to claim 5 or 6, or obtained by transfection of the plasmid combination according to claim 7.

9. A method for constructing an adeno-associated virus expressing ATP7B, comprising: The plasmid combination according to claim 7 is transfected into host cells, and the adeno-associated virus of ATP7B is obtained through purification.

10. Adeno-associated virus expressing ATP7B obtained by the preparation method of claim 9.

11. Use of the recombinant vector according to claim 5 or 6, or the plasmid combination according to claim 7, or the adeno-associated virus according to claim 10 in the preparation of a drug for preventing and treating ATP7B mutation-related diseases.

12. The use according to claim 11, characterized in that: The ATP7B mutation-related disease is Wilson's disease.

13. A drug, characterized in that It comprises the recombinant vector according to claim 5 or 6, or the plasmid combination according to claim 7, or the adeno-associated virus according to claim 10.

Images