A kit for detecting a largemouth bass iridovirus

By constructing a lateral flow detection kit based on DNA nucleic acid aptamers and isothermal strand displacement amplification reaction, the sensitivity and specificity issues of largemouth bass iridovirus detection in the field were solved, achieving rapid and accurate detection results suitable for aquaculture sites.

CN119220736BActive Publication Date: 2026-02-13SOUTH CHINA AGRICULTURAL UNIVERSITY +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411327091.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-23
Publication Date
2026-02-13
Estimated Expiration
2044-09-23

AI Technical Summary

Technical Problem

Current technologies lack sensitive and specific products for rapid on-site detection of iridovirus in largemouth bass. The reliance on specialized instruments and the complexity of operation limit their application in aquaculture.

Method used

By utilizing DNA aptamers that specifically recognize LMBV viral particles, combined with isothermal strand displacement amplification reaction and colloidal gold labeling technology, a lateral flow detection kit was constructed to achieve rapid and visual detection.

Benefits of technology

It enables rapid, accurate, and sensitive on-site detection of LMBV, reduces the requirements for testing equipment and personnel, and is suitable for use in grassroots units and farms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119220736B_ABST
    Figure CN119220736B_ABST
Patent Text Reader

Abstract

The application discloses a kit for detecting largemouth bass virus. The kit is constructed by using DNA aptamer which can specifically recognize largemouth bass virus (LMBV) particles, combining with isothermal strand displacement amplification reaction (SDA) and colloidal gold (AuNPs) labeling technology. The kit can realize rapid visual field detection of LMBV, and has the advantages of accurate detection result, good detection sensitivity, short time consumption, low requirement for detection equipment and detection personnel, and the like. The kit is suitable for primary detection units and breeding farms which need to regularly detect LMBV, and is beneficial to early detection and prevention of LMBV.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of virus detection. More particularly, it relates to a kit for detecting largemouth bass iridovirus. BACKGROUND

[0002] Largemouth bass virus (LMBV) infection is one of the main factors restricting the healthy development of largemouth bass aquaculture industry. The symptoms caused by LMBV infection in largemouth bass include lethargy, abnormal swimming, body surface ulcer, hemorrhage and splenomegaly, etc. However, these symptoms are not unique to LMBV infection, and due to geographical differences, different LMBV strains often show different clinical symptoms when infecting largemouth bass, making it difficult to diagnose LMBV infection by observing clinical symptoms with the naked eye. At the same time, there is no effective antiviral vaccine or treatment drug for LMBV. Therefore, accurate detection of LMBV is crucial for preventing LMBV infection.

[0003] In recent years, a variety of methods for specifically detecting LMBV have been reported, mainly including PCR-based methods such as real-time quantitative PCR (qRT-PCR), loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), etc., and detection methods based on gene editing Crispr / Cas technology. Overall, these detection methods have high sensitivity and reliability, but they require professional instruments, relatively professional operators and complicated detection procedures, which limit their application in rapid detection on the breeding site. Therefore, it is urgent to develop a convenient, rapid and on-site applicable LMBV detection method, so as to provide protection for the healthy development of largemouth bass aquaculture industry.

[0004] Point-of-Care Testing (POCT) refers to a rapid and easy-to-use detection method performed on the sampling site rather than in a traditional laboratory. Lateral flow biosensor (LFB), also known as lateral flow test strip, is a representative detection method in the field of POCT, with the advantages of short detection time, simple operation, low cost and easy result interpretation. LFB has been widely applied in many fields such as disease diagnosis, food safety and environmental monitoring, etc.

[0005] In the assembly of LFB, antibodies are the most commonly used biological recognition elements. In recent years, aptamers, known as chemical antibodies, have become new biological recognition elements and gradually been applied to LFB. Aptamers are single-stranded oligonucleotide sequences (DNA or RNA) that can interact with various types of targets, such as viruses, proteins, cells and bacteria, etc. As biological recognition elements, aptamers have the advantages of wide target range, easy synthesis, low cost, high stability, strong heat resistance and long shelf life, which make them very suitable for the development of on-site rapid detection and portable detection devices. For example, there are LFBs for detecting Singapore grouper iridovirus (SGIV), red-spotted grouper nervous necrosis virus (RGNNV) and Mycoplasma hyosynoviae, which are developed by using aptamers instead of antibodies. However, aptamers are only part of the on-site rapid detection method, and different aptamers and supporting detection systems are required for the detection of different viruses. That is, when different viruses are detected, how to construct a feasible and effective on-site rapid detection method based on aptamers still needs to be explored. SUMMARY

[0006] The present application aims to solve the problem of lack of sensitive and specific on-site rapid detection products for LMBV, and provides a kit for detecting LMBV.

[0007] The first object of the present application is to provide a kit for detecting LMBV.

[0008] The second object of the present application is to provide a method for detecting LMBV for non-disease diagnosis and treatment purposes.

[0009] The above objects of the present application are achieved by the following technical solutions:

[0010] The present application uses DNA aptamers that can specifically recognize LMBV virions, combined with isothermal strand displacement amplification reaction and colloidal gold labeling technology, to construct a kit for detecting LMBV. The kit can realize rapid on-site visual detection of LMBV, with accurate detection results, good detection sensitivity, short time consumption, and low requirements for detection equipment and personnel. Therefore, the kit is claimed in the present application.

[0011] The present application provides a kit for detecting LMBV, comprising an isothermal strand displacement amplification reaction system and a lateral flow test strip.

[0012] Specifically, the reaction system comprises a biotin-modified capture aptamer, an amplification aptamer and an SDA primer; the nucleotide sequence of the capture aptamer is shown as SEQ ID NO. 1, and the 3' end of the capture aptamer is modified with biotin; the nucleotide sequence of the amplification aptamer is shown as SEQ ID NO. 2; and the nucleotide sequence of the SDA primer is shown as SEQ ID NO. 3.

[0013] The lateral flow test strip comprises, in sequence, a sample pad, a conjugate pad, a nitrocellulose membrane and an absorption pad on the bottom plate; the conjugate pad is coated with a conjugate sequence to which a label is conjugated, and the nucleotide sequence of the conjugate sequence is shown as SEQ ID NO. 4; the nitrocellulose membrane is provided with, in sequence, a detection line and a quality control line; the detection line is coated with a detection line sequence, and the nucleotide sequence of the detection line sequence is shown as SEQ ID NO. 5; and the quality control line is coated with a quality control line sequence, and the nucleotide sequence of the quality control line sequence is shown as SEQ ID NO. 6.

[0014] Specifically, the 5' end of the conjugate sequence is modified with a thiol group, and the thiol group is conjugated with the label.

[0015] Optionally, the label is colloidal gold, latex microspheres, carbon nanoparticles or colloidal silver.

[0016] In specific embodiments of the present application, the label is colloidal gold.

[0017] Specifically, the preparation method of colloidal gold used in the present application is as follows:

[0018] The chloroauric acid (HAuCl4) solution is heated and stirred, and after the solution boils, 4 mL of a 1% (m / v) trisodium citrate solution is added and stirred quickly; after the solution turns wine red, heating and stirring are continued, heating is stopped after boiling for 5 min, and stirring is performed until the solution cools to room temperature, and the AuNPs solution is collected; the AuNPs solution is centrifuged, concentrated and resuspended in a PBS solution.

[0019] More specifically, the chloroauric acid solution is mixed with deionized water at a volume ratio of 1:10000, 200 mL of which is poured into a round-bottom flask and placed on a magnetic stirrer for heating and stirring; after the solution boils, 4 mL of a 1% (m / v) trisodium citrate solution is immediately added and stirred quickly; after the solution turns wine red, heating and stirring are continued, heating is stopped after boiling for 5 min, and stirring is performed until the solution cools to room temperature, and the AuNPs solution is collected; the AuNPs solution is centrifuged, concentrated and resuspended in a PBS solution.

[0020] Based on the kit, the present application further provides a method for detecting the rainbow trout iridovirus for non-disease diagnosis purposes, comprising the following steps:

[0021] S1. Incubating the sample to be tested with the capture aptamer and the amplification aptamer in the kit;

[0022] S2. Continue incubation with streptavidin-modified magnetic beads to obtain a complex of capture aptamer-sample-amplification aptamer-magnetic beads;

[0023] S3. Collect the complex described in S2, and use the complex as a template to perform SDA reaction with SDA primers in the kit to obtain a reaction product ssDNA;

[0024] S4. Add the ssDNA obtained in S3 to a lateral flow test strip in the kit, and observe changes in the test line and the control line; when both the test line and the control line develop color, the test result is positive; when the test line does not develop color and the control line develops color, the test result is negative; when the control line does not develop color, the test result is invalid regardless of whether the test line develops color or not.

[0025] Specifically, if the label coupled on the coupling sequence is colloidal gold, the test line and the control line develop red color.

[0026] Specifically, in S1, the use amount ratio of the capture aptamer and the amplification aptamer is 0.8-1.2:0.8-1.2.

[0027] More specifically, in S1, the use amount ratio of the capture aptamer and the amplification aptamer is 1:1.

[0028] Specifically, in S1, the buffer used for the co-incubation is PBS buffer.

[0029] More specifically, in S1, the buffer used for the co-incubation is 1x PBS buffer.

[0030] Specifically, in S1, the co-incubation time is 5-30 min.

[0031] Preferably, in S1, the co-incubation time is 5-10 min.

[0032] More preferably, in S1, the co-incubation time is 5 min.

[0033] Specifically, in S2, the continued incubation time is 20-30 min.

[0034] Preferably, in S2, the continued incubation time is 20 min.

[0035] Specifically, in S3, the complex described in S2 is collected by using a magnetic stand.

[0036] Specifically, in S3, the SDA reaction temperature is 37-50°C.

[0037] Preferably, in S3, the SDA reaction temperature is 50°C.

[0038] Specifically, in S3, the SDA reaction time is 20-40 min.

[0039] More specifically, in S3, the SDA reaction time is 30 min.

[0040] Specifically, in S4, the ssDNA is added to the sample pad of the lateral flow test strip, the flushing buffer is added, and the changes of the detection line and the quality control line are observed.

[0041] Specifically, the flushing buffer contains 0.6M NaCl and 0.06M trisodium citrate.

[0042] The present application has the following beneficial effects:

[0043] The present application utilizes the DNA aptamer capable of specifically recognizing LMBV virions, combines the isothermal strand displacement amplification reaction and the colloidal gold labeling technology, and constructs a kit for detecting LMBV. The kit can realize the rapid visual field detection of LMBV virions or LMBV infected samples, has accurate detection results, good detection sensitivity, short time consumption, does not need to depend on professional experimental instruments and laboratory conditions, and has low requirements for detection equipment and detection personnel. The kit is suitable for the grass-roots detection units and breeding farms which need to regularly detect LMBV, and is beneficial to the early detection and prevention of LMBV. BRIEF DESCRIPTION OF DRAWINGS

[0044] Figure 1 The colloidal gold solution obtained by reducing chloroauric acid with citrate and the colloidal gold probe coupling complex (the coupling complex of colloidal gold and coupling sequences).

[0045] Figure 2 It is a structure diagram of the lateral flow test strip prepared by the present application.

[0046] Figure 3 It is a process of detecting LMBV by using the kit.

[0047] Figure 4 It is the feasibility test result of detecting LMBV by using the kit.

[0048] Figure 5 The specific detection result of the kit; A in the figure is the detection result of SGIV purified virus, RGNNV enriched tissue sample supernatant and LMBV purified virus; B in the figure is the detection result of SGIV, RGNNV and LMBV infected cell lysate; C in the figure is the detection result of liver (Liver), spleen (Spleen) and trunk kidney tissue (Trunk kidney) of the infected Largemouth bass.

[0049] Figure 6 The detection condition optimization detection results; A in the figure is the SDA reaction temperature optimization detection result; B in the figure is the nucleic acid aptamer incubation time optimization detection result; C in the figure is the SA-magnetic bead incubation time optimization detection result.

[0050] Figure 7 The sensitivity detection result of the kit; FHM cells are used as a control group. DETAILED DESCRIPTION

[0051] The present application will be further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present application in any form. Unless otherwise specified, the reagents, methods and devices used in the present application are conventional reagents, methods and devices in the technical field.

[0052] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0053] The Fathead minnow (FHM), Grouper spleen (GS) and Grouper brain cells (GB) used in the experiments of the present application are cultured in Leibovitz's L15 (Gibco) culture medium containing 10% FBS and placed in a 28℃ incubator for subculture.

[0054] The largemouth bass virus (LMBV), Red-spotted grouper nervous necrosis virus (RGNNV) and Singapore grouper iridovirus (SGIV) are isolated and preserved by the Aquatic Animal Medicine Laboratory of South China Agricultural University and stored in a -80℃ refrigerator.

[0055] Example 1 A kit for detecting largemouth bass virus

[0056] The present application uses DNA aptamer that can specifically recognize LMBV, combined with isothermal strand displacement amplification reaction (SDA) and colloidal gold (AuNPs) labeling technology, to construct a kit for detecting LMBV, which mainly includes two parts, namely, an isothermal strand displacement amplification reaction system and a lateral flow test strip.

[0057] 1. Isothermal strand displacement amplification reaction system

[0058] Based on the DNA aptamer (TTTTGACGCTTTATCCTTTTCTTATGGCGGGATAGTTTCG) capable of specifically recognizing LMBV virions, the amplification aptamer and the SDA primer capable of detecting LMBV are obtained by adding specific enzyme recognition site (Nt.BbvCI: GCTGAGG) and SDA primer binding site (TGGACACGGTGGCTTAGT) at the 3' end of the DNA aptamer. In addition, the capture aptamer is obtained by modifying biotin at the 3' end of the DNA aptamer (GCCGGCCCGGGGGA TAGAGTGCTCCCGATCCCTTGGCGAAGGGAC) capable of specifically recognizing LMBV virions. The amplification aptamer, the capture aptamer and the SDA primer are all DNA sequences, and the nucleotide sequences are shown in Table 1, which are required for isothermal strand displacement amplification reaction.

[0059] In addition, based on the amplification aptamer, the coupling sequence (the 5' end of which is modified with sulfhydryl and will be coupled with colloidal gold later) for coating the coupling pad, the T-line sequence (T-line) for coating the detection line, and the C-line sequence (C-line) for coating the quality control line are designed. The coupling sequence, the T-line and the C-line are all DNA sequences, and the nucleotide sequences are shown in Table 1, which are required for constructing the lateral flow test strip.

[0060] The above DNA sequences of the present application are specifically shown in Table 1.

[0061] Table 1 DNA sequences used in the present application

[0062]

[0063] Note: Bio indicates 3' end biotin modification, and SH indicates 5' end sulfhydryl modification.

[0064] 2. Preparation of AuNPs (colloidal gold) and AuNPs-probe coupling complex

[0065] Preparation of AuNPs: The chloroauric acid (HAuCl4) solution purchased from Sigma-Aldrich is mixed with deionized water at a volume ratio of 1:10000, 200 mL of which is poured into a round-bottom flask and placed on a magnetic stirrer for heating and stirring; after the solution boils, 4 mL of 1% (m / v) trisodium citrate solution is immediately added for rapid stirring; after the solution turns into wine red, heating and stirring are continued, and boiling is stopped after 5 min of heating, and the solution is cooled to room temperature by stirring; the AuNPs solution is collected; centrifuged at 12,000 x g, 4℃ for 20 min, concentrated for 6 times, and resuspended in 900 μL PBS.

[0066] Preparation of AuNPs-probe-coupled complex: 100 μL of the coupling sequence (10 μM, SEQ ID NO.4) was added to the concentrated AuNPs solution, gently pipetted to homogenize, and then gently shaken at 4℃ for 12 h. A 10% (m / v) BSA solution was added for blocking for 3 h, followed by the addition of 1.5 M NaCl and 1% (m / v) sodium dodecyl sulfate to final concentrations of 150 mmol / L and 0.01%, respectively. The mixture was then gently shaken at 4℃ for 12 h. The mixture was centrifuged at 12,000 × g at 4℃ for 20 min, the supernatant was discarded, and 1 mL of wash buffer (containing 20 mM Na3PO4, 5% BSA, and 0.25% sodium sulfate) was added. Tween-20 (10% sucrose) is gently pipetted until homogeneous; centrifuged again at 12,000×g, 4°C for 20 min, and the supernatant is discarded; 1 mL of washing buffer is added and gently pipetted until homogeneous, centrifuged at 12,000×g, 4°C for 20 min, and the supernatant is discarded; the precipitate is resuspended in 100 μL of washing buffer and stored at 4°C in the dark for later use.

[0067] This invention relates to a colloidal gold solution obtained by reducing chloroauric acid with citrate and a colloidal gold probe coupling complex (a coupling complex of colloidal gold and a coupling sequence), as follows: Figure 1 As shown. By Figure 1 It was found that the 1×AuNPs solution was clear, free of impurities and precipitates, and had a wine-red color. The prepared colloidal gold solution was concentrated 6 times and then coupled with a thiol-modified coupling sequence (AuNPs probe). After BSA blocking and NaCl aging, the AuNPs-probe coupling complex was obtained. This complex was clear and transparent, the solution was stable, and the color was slightly darker than that of AuNPs.

[0068] 3. Preparation of Lateral Flow Test Strips (LFB)

[0069] A schematic diagram of the lateral flow test strip prepared by this invention is shown below. Figure 2 As shown. By Figure 2 It is known that the lateral flow test strip consists of a base plate, a sample pad, a coupling pad, a nitrocellulose membrane, and an absorbent pad.

[0070] The method for preparing the lateral flow test strip is as follows:

[0071] The glass fiber was fully immersed in the sample pad buffer, and then stored in a room temperature drying environment. Then the sample pad, coupling pad, nitrocellulose membrane and absorbent pad were sequentially pasted on the bottom plate, and the overlapping width between adjacent two parts was 1.5 mm. The synthesized test line sequence (T-line, 100 μM, 40 μL) and the quality control line sequence (C-line, 100 μM, 40 μL) were drawn on the nitrocellulose membrane by a three-dimensional reciprocating gold marker drawing instrument at a liquid spraying amount of 0.5-0.8 mL / cm (the distance between the two probes was 7 mm), respectively to obtain the detection area and the quality control area. Finally, the assembled test strip was placed in a test strip cutting machine and cut according to the size of 6 cm in length and 3.5 mm in width. The test strip was stored under room temperature drying conditions.

[0072] Example 2 Detection of LMBV

[0073] Based on the kit described in Example 1, the present application also provides a method for detecting LMBV, which realizes the monitoring of LMBV.

[0074] 1. Preparation of LMBV infected cell and largemouth bass body sample

[0075] FHM cells were subcultured in 25 cm 2 Cell culture bottles (Corning) were cultured in a 28℃ constant temperature incubator for 18 h, and then infected with LMBV (MOI=0.5, 4 μL); at 96 hpi, the cytopathic effect formed by viral infection was observed by optical microscope; the virus-infected cell suspension was collected and centrifuged at 900×g for 10 min, and the supernatant was discarded; 1 mL of serum-free medium was added to resuspend, centrifuged at 900×g for 2 min, the supernatant was discarded, 100 μL of IP Lysis Buffer (Thermo Fisher Scientific) was added to lyse the cells on ice for 30 min, and stored in a-80℃ refrigerator for use.

[0076] Healthy largemouth bass (8-10 cm) were collected for LMBV infection experiment, and were cultured in a 28±1℃ circulating water system, fed twice a day, and continuously fed for 10 days. Before infection, the largemouth bass were randomly selected for virus detection to ensure LMBV negative. The largemouth bass were infected by intraperitoneal injection of 100 μL LMBV (10 4.7 TCID 50 / mL); on the 4th day after viral infection, the moribund largemouth bass were dissected, and their liver, spleen and kidney tissues were taken, washed with PBS, cut into small pieces, and added with 300 μL of IP Lysis Buffer for lysis for 10 min; filtered with medical gauze, the filtrate was centrifuged briefly, and the supernatant was collected for detection.

[0077] 2. Detection of LMBV

[0078] The procedure for detecting LMBV using the kit of embodiment 1 of the present application is shown in the following. Figure 3 During detection, first incubate the capture aptamer (10 μM) and the amplification aptamer (10 μM) with the sample to be detected (if it is a tissue block, take the size of a green bean, and the same amount as that used for nucleic acid extraction; if it is a cell sample, take 200 μL of the cell sample) in 100 μL of PBS (1×PBS buffer) (at room temperature (25°C)) for 1 h; use PBS as a negative control; then add 1.5 μL of SA (streptavidin)-modified magnetic beads, and shake in a constant-temperature metal bath at 4°C for 30 min to obtain "capture aptamer-LMBV-amplification aptamer-SA-magnetic beads"; add 1 mL of PBST (1×PBST buffer) to the "capture aptamer-LMBV-amplification aptamer-SA-magnetic beads", and gently blow to mix evenly; collect the magnetic bead complex under the action of a magnetic separator, resuspend with 10 μL of ddH2O, and use it as a template for SDA reaction (see Table 2 for the SDA reaction system, and the SDA reaction is performed at 37°C for 30 min); add the reaction product ssDNA dropwise to the sample pad prepared for the LFB, add 50 μL of washing buffer (0.6 M NaCl, 0.06 M trisodium citrate), and observe the results within 5 min.

[0079] Table 2 SDA reaction system

[0080]

[0081]

[0082] In the presence of DNA polymerase, the SDA primer binds to the primer binding site on the amplification aptamer to initiate amplification, and the complementary strand formed is cut at the Nt.BbvCI enzyme cutting site, and then the extension reaction continues at the cutting site. The above process is repeated continuously to produce a large amount of amplified ssDNA.

[0083] 3. Feasibility test

[0084] Based on the above method, the feasibility of detecting LMBV using the kit is tested.

[0085] The experiment is designed as follows: experimental group, incubate LMBV purified virus (MOI = 10, 2 μL) with the amplification aptamer and the capture aptamer; control group 1, incubate LMBV purified virus (MOI = 10, 2 μL) with the capture aptamer; control group 2, incubate LMBV purified virus (MOI = 10, 2 μL) with the amplification aptamer; control group 3, incubate an equal amount of PBS with the amplification aptamer and the capture aptamer.

[0086] The feasibility test results of detecting LMBV by using the kit are shown in Table 1. Figure 4 Figure 4 It can be seen that only when LMBV exists simultaneously with the amplification aptamer and the capture aptamer, the detection line (T line) and the quality control line (C line) can be red at the same time, indicating that the sample to be detected contains LMBV, and in the three control groups, no T line is colored. The above results show that the kit can effectively detect LMBV.

[0087] The detection principle is as follows:

[0088] The capture aptamer in the application is modified with biotin, which can be non-covalently coupled with SA-modified magnetic beads, so as to enrich the captured LMBV on the magnetic beads; the amplification aptamer has an enzyme cutting site modification, which is a necessary condition for SDA reaction; only when the above three exist simultaneously, the "capture aptamer-LMBV-amplification aptamer-SA coated magnetic bead" complex can be formed, and the ssDNA product can be obtained by SDA reaction. The ssDNA is complementary to the detection line sequence, and the AuNPs-probe is also complementary to the ssDNA. Therefore, when a large amount of ssDNA is added to the sample pad of the LFB, a red band can be formed by color development in the T line area. In addition, the AuNPs-probe sequence is also complementary to the quality control line sequence. Under the action of capillary force, the excess AuNPs-probe coupling complex continues to migrate, and color development occurs in the C line area. When LMBV is absent, the "capture aptamer-LMBV-amplification aptamer-SA coated magnetic bead" complex cannot be formed; when the amplification aptamer is absent or the capture aptamer cannot perform SDA reaction or the target cannot be enriched by the magnetic beads. Therefore, only when LMBV and the two nucleic acid aptamers exist simultaneously, the detection line can be colored.

[0089] Specifically, when the detection line and the quality control line are both red, the detection result is positive; when the detection line is not colored and the quality control line is red, the detection result is negative; when the quality control line is not colored, whether the detection line is colored or not, the detection result is judged as invalid.

[0090] Specificity detection of Example 3

[0091] 1. Preparation of LMBV, RGNNV or SGIV infected cell samples

[0092] The preparation of virus infected cell samples is the same as that of Example 2, except that the viruses used include RGNNV and SGIV in addition to LMBV, and the cells are infected with the viruses respectively.

[0093] 2. Preparation of LMBV infected large-mouth bass body samples

[0094] ​Preparation of viral infected body sample of Micropterus salmoides was the same as Example 2.

[0095] The kit of the present application was used to detect the purified virus of SGIV, the supernatant of tissue sample enriched with RGNNV, the purified virus of LMBV, the cell lysate infected with SGIV, RGNNV and LMBV, and the liver, spleen and trunk kidney tissue of Micropterus salmoides infected with LMBV, so as to detect the detection specificity of the kit.

[0096] The specific detection results of the kit of the present application are shown in Figure 5 . Figure 5 A in the table is the detection result of the purified virus of SGIV, the supernatant of tissue sample enriched with RGNNV and the purified virus of LMBV; Figure 5 B in the table is the detection result of the cell lysate infected with SGIV, RGNNV and LMBV; Figure 5 C in the table is the detection result of the liver, spleen and trunk kidney tissue of Micropterus salmoides infected with LMBV. It can be seen from Figure 5 that a clear detection line appeared in the LFB for detecting the samples of LMBV group; while the LFB for detecting the samples of SGIV and RGNNV group only showed one C line coloration, and no T line coloration. Similarly, only the FHM cells infected with LMBV were detected to have positive bands, while the FHM cells infected with SGIV and RGNNV did not have positive bands. The liver, spleen and trunk kidney tissue of Micropterus salmoides artificially infected with LMBV were detected, and the LFB could detect positive bands Figure 5 (C). The above results show that the kit of the present application has specificity for detecting LMBV, and can effectively detect the virion of LMBV, the cells infected with LMBV and the tissue samples.

[0097] Example 4 Optimization of detection system

[0098] In order to further improve the detection performance of the kit, the detection system was optimized.

[0099] 8x10 7 6 / mL of FHM cells infected with LMBV were used as the sample to be detected, and uninfected FHM cells were used as the control. First, the effect of reaction temperature of different SDA on the detection results was detected, and the reaction temperature was set to 25℃, 37℃, 42℃, 50℃ and 65℃ (the remaining operations were the same as Example 2), so as to obtain the best SDA reaction temperature. The SDA reaction temperature optimization detection results are shown in Figure 6As shown in Figure A, the SDA reaction failed to proceed normally at 25℃ and 65℃, with only a control line and no detection line appearing in the LFB. The SDA reaction proceeded normally at 37℃, 42℃, and 50℃, with the LFB detection line in the 50℃ group being significantly darker than the other two groups, indicating that the SDA reaction had higher amplification efficiency under these conditions.

[0100] Subsequently, the incubation time of the test sample with the nucleic acid aptamer and the incubation time of the next step with the SA-modified magnetic beads in the detection process were optimized, and the incubation time gradients were set to 2 min, 5 min, 10 min, 20 min and 30 min.

[0101] Optimization of nucleic acid aptamer incubation time and detection results are as follows Figure 6 As shown in Figure B, when the incubation time between the test sample and the aptamer is reduced to 2 minutes, LFB can still detect a positive band, but the color is weaker. Under incubation time conditions of 5–30 minutes, the color of the positive band is almost the same. The optimal incubation time for this step is 5 minutes.

[0102] The results of the optimized incubation time test for SA-magnetic beads are as follows: Figure 6 As shown in Figure C, positive bands appeared at all time gradients. However, the color of the positive bands weakened significantly when the time was less than 20 minutes. Therefore, the optimal incubation time for this step is 20 minutes.

[0103] The above results indicate that the optimal reaction temperature for LFB detection of LMBV is 50℃, and the entire LFB detection process can be completed within 1 hour.

[0104] Example 5 Sensitivity Detection

[0105] After optimizing the detection conditions, the present invention further analyzed the detection sensitivity of the kit described herein using the optimized detection conditions. Following the method for preparing LMBV-infected cells and largemouth bass body samples as described in Example 2, LMBV-infected FHM cells were obtained. The following concentrations of LMBV-infected FHM cells were prepared using a cell counting method: 8 × 10⁻⁶ cells / year. 7 8×10 6 8×10 5 8×10 4 8×10 3 8×10 2 and 8×10 1 Cells / mL, with uninfected FHM cells used as a control group. Sensitivity test results are as follows: Figure 7 As shown, no test line was displayed in the control group, while the 8×10 1The detection line was weakly colored in the 8 x 10 1 FHM cells infected with LMBV.

[0106] The above embodiments are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above embodiments, and any changes, modifications, substitutions, combinations, simplifications, etc. made without departing from the spirit and principles of the present application should be equivalent replacement methods and should be included in the protection scope of the present application.

Claims

1. A kit for detecting a Micropterus salmoides iridovirus, characterized by, The isothermal strand displacement amplification reaction system and a lateral flow test strip are included. The reaction system includes a biotin-modified capture aptamer, an amplification aptamer and an SDA primer; the nucleotide sequence of the capture aptamer is shown as SEQ ID NO. 1, and the 3' end is modified with biotin; the nucleotide sequence of the amplification aptamer is shown as SEQ ID NO. 2; and the nucleotide sequence of the SDA primer is shown as SEQ ID NO.

3. The lateral flow test strip includes a sample pad, a conjugate pad, a nitrocellulose membrane and an absorption pad which are sequentially overlapped on a bottom plate; the conjugate pad is coated with a conjugate sequence to which colloidal gold is conjugated, and the nucleotide sequence of the conjugate sequence is shown as SEQ ID NO. 4, and the 5' end is modified with a mercapto group; the nitrocellulose membrane is sequentially provided with a detection line and a quality control line; the detection line is coated with a detection line sequence, and the nucleotide sequence of the detection line sequence is shown as SEQ ID NO. 5; and the quality control line is coated with a quality control line sequence, and the nucleotide sequence of the quality control line sequence is shown as SEQ ID NO.

6.

2. A method of detecting a rainbow trout iridovirus for a purpose other than disease diagnosis, characterized by, The steps include: S1. Incubating a sample to be tested with the capture aptamer and the amplification aptamer described in claim 1 for 5-30 min; the use amount ratio of the capture aptamer and the amplification aptamer is 0.8-1.2:0.8-1.2, and the buffer used for the incubation is PBS buffer; S2. Adding streptavidin-modified magnetic beads to continue the incubation for 20-30 min to obtain a capture aptamer-sample-amplification aptamer-magnetic bead complex; S3. Collecting the complex described in S2, using the complex as a template, and performing SDA reaction on the complex with the SDA primer described in claim 1 to obtain a reaction product ssDNA; the SDA reaction temperature is 37-50 DEG C, and the reaction time is 20-40 min; S4. Adding the ssDNA obtained in S3 to the lateral flow test strip described in claim 1, and observing the changes of the detection line and the quality control line; when both the detection line and the quality control line develop color, the detection result is positive; when the detection line does not develop color and the quality control line develops color, the detection result is negative; and when the quality control line does not develop color, whether the detection line develops color or not, the detection result is judged as invalid.

Citation Information

Patent Citations

  • Nucleic acid aptamer for specifically recognizing iridovirus of micropterus salmoides and application of nucleic acid aptamer

    CN114807149A