Recombinant adeno-associated virus vector, method and application

Abstract

The invention relates to a recombinant adeno-associated virus vector as well as a method and application thereof, compared with a natural AAV5 capsid protein, the adeno-associated virus variant capsid protein of the recombinant adeno-associated virus vector has a sequence with at least 80% of identity, and a VP3 capsid region has at least one of the following mutations: T376, E377, N378, S518, A581, N694, D695, Q697 and T706; compared with an AAV2.5 T capsid protein, the adeno-associated virus variant capsid protein has a sequence with at least 80% of identity, and the VP3 capsid region has at least one of the following mutations: T377, E378, N379, S519, N695, D696, Q698 and T707. When the constructed recombinant adeno-associated virus vector is used for preparing the medicine for treating the retinopathy, the RPE transduction rate is improved.

Description

Technical Field

[0001] The present application relates to the technical field of recombinant adeno-associated virus vectors, and in particular to a recombinant adeno-associated virus vector, method and application. Background Art

[0002] Adeno-associated virus (AAV) belongs to the genus Dependoviridae of the family Parvoviridae. It has no envelope and consists of an icosahedral protein capsid with a diameter of about 22 nm and a linear single-stranded DNA genome of about 4.7 kb. Its life cycle depends on a helper virus. AAV can replicate itself in host cells only in the presence of a helper virus such as adenovirus or herpes virus. "AAV" is the abbreviation of adeno-associated virus and can be used to refer to the virus itself or its derivatives, including AAV type 1 (AAV1), AAV type 2 (AAV2), AAV type 3 (AAV3), AAV type 4 (AAV4), AAV type 5 (AAV5), AAV type 6 (AAV6), AAV type 7 (AAV7), AAV type 8 (AAV8), AAV type 9 (AAV9), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV and ovine AAV. "Primate AAV" refers to AAV that infects primates, "non-primate AAV" refers to AAV that infects non-primate mammals, "bovine AAV" refers to AAV that infects bovine mammals, and so on.

[0003] After wild-type AAV infects human host cells, it can integrate into the AAVS1 site (19q13.4) of human chromosome 19, but AAV does not cause human disease. The genome of AAV is approximately 4.7kb of linear single-stranded DNA, including two upstream and downstream open reading frames, Rep and Cap, and two inverted terminal repeats (ITRs) consisting of 145 nucleotides. Both the positive and negative strands have the same probability of being packaged into AAV virus particles. It has been confirmed that AAV can infect a variety of retinal cells, including photoreceptor cells, retinal pigment epithelial cells (RPE), Müller cells, retinal ganglion cells, and corneal endothelial cells.

[0004] Gene therapy has significant advantages in treating eye diseases, which are determined by the genetic basis of eye diseases and the uniqueness of the ocular compartment. The eye has a clear anatomical structure and limited physical space closure, which provides unique advantages for local administration. The blood-ocular barrier contributes to the immune privilege of the eye, and the immune response to gene therapy products is limited. In addition, the retinal cells of the eye no longer divide, allowing continuous gene expression without integration into the genome. Most importantly, the potential genetic factors for a series of eye diseases (including hereditary blindness) have been identified. In addition, the recent development of relevant animal models has also made significant progress in ophthalmic research, which is conducive to the conduct of ocular gene therapy trials. Recombinant adeno-associated virus vector (rAAV) is the main vector for ocular gene therapy. In therapeutic gene delivery, the DNA sequences encoding regulatory proteins (Rep) and structural proteins (Cap) in the AAV single-stranded deoxyribonucleic acid (ssDNA) genome are replaced by the required GOI expression cassette, which is called recombinant adeno-associated virus vector (rAAV).

[0005] In the past decade, only three in vivo gene therapies have been approved: Glybera in Europe in 2012, Luxturna and Zolgensma in the United States in 2017 and 2019, and they all use AAV as a vector, that is, wild-type capsids (AAV1, AAV2 and AAV9). Luxturna requires subretinal injection, which is a surgical procedure that requires general anesthesia and hospitalization. If injected intravitreally, ordinary nurses can complete the operation within a few minutes, which is convenient and safe. The retinal pigment epithelium (RPE) is the main tissue target of macular degeneration. Most AAV capsid variants cannot effectively transduce retinal pigment epithelial cells (RPE). For example, several recombinant adeno-associated virus vectors have been developed recently, such as AAV2-quadYF+TV or AAV2-7m8, which mainly transduce other types of cells such as photoreceptors (RGC) instead of retinal pigment epithelium (RPE). Another example is the adeno-associated virus virion with a variant capsid recorded in patents CN110724673B, CN109476707B, and WO2020219933A1, which can successfully transduce RPE after intravitreal injection, but the transduction rate is not high enough. Unless by subretinal injection, this is an expensive and high-risk surgical procedure. Subretinal injection can cause a series of complications, aggravate mechanical damage, cause visual impairment, and the operation is difficult and has low safety. Vitreous injection is relatively safer and easier, but the transduction rate to retinal pigment epithelial cells (RPE) is low, so it is limited in the treatment of diseases such as macular degeneration that target retinal pigment epithelial cells (RPE). Summary of the invention

[0006] Based on this, it is necessary to provide a recombinant adeno-associated virus vector that can improve the transduction rate of retinal pigment epithelial cells (RPE) for preparing drugs for treating retinal diseases.

[0007] In a first aspect of the present application, there is provided an adeno-associated virus variant capsid protein comprising VP1, VP2 and VP3 capsids;

[0008] Wherein, compared with the native AAV5 capsid protein, the adeno-associated virus variant capsid protein has a sequence with at least 80% identity, and the VP3 capsid region has at least one of the following mutations:

[0009] T376, E377, N378, S518, A581, N694, D695, Q697 and T706; or / and,

[0010] The adeno-associated virus variant capsid protein has a sequence with at least 80% identity to the AAV2.5T capsid protein, and the VP3 capsid region has at least one of the following mutations:

[0011] T377, E378, N379, S519, N695, D696, Q698 and T707.

[0012] In one embodiment, the VP3 capsid region has at least one of the following mutations compared to the native AAV5 capsid protein:

[0013] T376E, E377K, N378H, S518K, A581T, N694S, D695E, Q697E, and T706A.

[0014] In one embodiment, the VP3 capsid region has the following mutations compared to the native AAV5 capsid protein:

[0015] T376E, E377K, N378H, S518K, A581T, N694S, D695E, Q697E, and T706A.

[0016] In one embodiment, the VP3 capsid region has at least one of the following mutations compared to AAV2.5T:

[0017] T377E, E378K, N379H, S519K, N695S, D696E, Q698T, and T707A.

[0018] In one embodiment, the VP3 capsid region has the following mutations compared to the AAV2.5T capsid protein:

[0019] T377E, E378K, N379H, S519K, N695S, D696E, Q698T, and T707A.

[0020] In a second aspect of the present application, there is provided an adeno-associated virus variant capsid protein comprising VP1, VP2 and VP3 capsids;

[0021] Wherein, compared with the native AAV5 capsid protein, the adeno-associated virus variant capsid protein has a sequence with at least 80% identity, and at least one of the following fragments in the VP3 capsid region has a mutation:

[0022] NTENP, QGSNT, APATG, YNDPQ and DSTGE; or / and,

[0023] The adeno-associated virus variant capsid protein has a sequence with at least 80% identity to the AAV2.5T capsid protein, and at least one of the following fragments in the VP3 capsid region has a mutation:

[0024] NTENP, QGSNT, YNDPQ and DSTGE.

[0025] In one embodiment, compared to the native AAV5 capsid protein, at least one amino acid in each of the following fragments in the VP3 capsid region is mutated:

[0026] NTENP, QGSNT, APATG, YNDPQ, and DSTGE.

[0027] In one embodiment, compared to the AAV2.5T capsid protein, at least one amino acid in each of the following fragments in the VP3 capsid region is mutated:

[0028] NTENP, QGSNT, YNDPQ and DSTGE.

[0029] In one embodiment, the unique region of the VP1 capsid and / or VP2 capsid is derived from one of the following AAVs: AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, bovine AAV, AAV2.5T and AAV-LK03.

[0030] The third aspect of the present application provides a nucleic acid comprising a nucleotide fragment encoding the adeno-associated virus variant capsid protein.

[0031] In one embodiment, the sequence of the nucleic acid fragment is shown in SEQ ID NO:3.

[0032] The fourth aspect of the present application provides a recombinant plasmid vector comprising the nucleic acid encoding the adeno-associated virus variant capsid protein;

[0033] Optionally, genes involved in viral replication are also included.

[0034] The fifth aspect of the present application provides a virus packaging system, comprising the recombinant plasmid vector and the pHelper plasmid.

[0035] The sixth aspect of the present application provides a recombinant adeno-associated virus vector, which has the adeno-associated virus variant capsid protein, or the recombinant adeno-associated virus vector is packaged by the viral packaging system in a host cell.

[0036] The seventh aspect of the present application provides a method for preparing a recombinant adeno-associated virus vector, comprising the following steps:

[0037] The virus packaging system is used to transfect host cells to prepare a recombinant adeno-associated virus vector.

[0038] In one embodiment, the host cell is selected from one of 293 cells, Hela cells and SF9 cells.

[0039] The eighth aspect of the present application provides a pharmaceutical composition comprising the recombinant adeno-associated virus vector.

[0040] The ninth aspect of the present application provides the use of the recombinant adeno-associated virus vector in the preparation of a drug for treating a retinal disease; optionally, the retinal disease is maculopathy.

[0041] Compared with the traditional technology, this application also has the following beneficial effects:

[0042] This application prepares an adeno-associated virus variant capsid protein by performing site-directed amino acid mutation on the encoded AAV virus capsid, and obtains an adeno-associated virus mutant vector that can efficiently transduce retinal pigment epithelial cells (RPE) through the adeno-associated virus variant capsid protein. The recombinant adeno-associated virus vector is directly injected into the vitreous cavity of mice, which improves the RPE transduction rate and is of great significance for the gene therapy of retinal pigment epithelial cell lesions. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] In order to more clearly illustrate the specific implementation methods of the present application or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0044] Figure 1 They are respectively the genome biodistribution diagrams of AAV2, AAV2-7m8 virions and the recombinant adeno-associated virus vector (CL5-RE2) in Example 1 of the present application;

[0045] Figure 2 The diagrams are respectively the expression biodistribution diagrams of AAV2, AAV2-7m8 virions and the recombinant adeno-associated virus vector (CL5-RE2) in Example 1 of the present application. DETAILED DESCRIPTION

[0046] In order to facilitate the understanding of the present application, the present application will be described more fully below with reference to the relevant drawings. The preferred embodiments of the present application are given in the drawings. However, the present application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present application more thorough and comprehensive.

[0047] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the present application belongs. The terms used herein in the specification of the present application are only for the purpose of describing specific embodiments and are not intended to limit the present application. The term "and / or" used herein includes any and all combinations of one or more of the related listed items.

[0048] the term

[0049] Unless otherwise specified or incompatible herewith, the terms and phrases used herein shall have the following meanings:

[0050] In the present application, the selection range involving "and / or", "or / and", and "and / or" includes any one of two or more related listed items, and also includes any and all combinations of related listed items, and the said any and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that the technical solution undoubtedly includes technical solutions that are all connected by "logical and", and undoubtedly includes technical solutions that are all connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution that is all connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the combination of four of A, B, C, and D (that is, the technical solution that is all connected by "logical AND").

[0051] In this application, "optionally", "optional" and "optional" refer to optional, that is, to any one of the two parallel schemes of "yes" or "no". If multiple "options" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" is independent.

[0052] In the present application, the terms “preferred”, “better”, “more preferred” and “suitable” are only used to describe implementation methods or examples with better effects, and it should be understood that they do not constitute limitations on the scope of protection of the present application.

[0053] In the present application, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0054] "AAV virus" or "AAV virus particle" or "rAAV vector particle" refers to a virus particle composed of at least one AAV capsid protein (usually all capsid proteins of wild-type AAV) and an encapsidated polynucleotide rAAV vector. If the particle contains a heterologous polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome, such as a transgene delivered to a mammalian cell), it is usually referred to as a "rAAV vector particle" or simply "rAAV vector". Therefore, the generation of rAAV particles must include the generation of rAAV vectors because such vectors are contained in rAAV particles.

[0055] "Packaging" refers to the series of intracellular events that lead to the assembly and encapsidation of AAV particles.

[0056] The "helper virus" of AAV refers to a virus that allows mammalian cells to replicate and package AAV (e.g., wild-type AAV). A variety of such helper viruses of AAV are known in the art, including adenovirus, herpes virus, and pox virus (e.g., vaccinia). Although adenovirus type 5 of subclass C is most commonly used, adenovirus encompasses many different subclasses. Many adenoviruses of human, non-human mammalian, and avian origin are known and can be obtained from repositories such as ATCC. Viruses of the herpes family include, for example, herpes simplex virus (HSV) and Epstein-Barr viruses (EBV) as well as cytomegalovirus (CMV) and pseudorabies virus (PRV); they can also be obtained from repositories such as ATCC.

[0057] The genomic sequences of various serotypes of AAV, as well as the natural terminal repeat sequences (ITRs), Rep proteins, and capsid subunit sequences are known in the art. Such sequences can be found in the literature or in public databases such as GenBank. See, for example, GenBank Accession Nos. NC_002077.1 (AAV1), AF063497.1 (AAV1), NC_001401.2 (AAV2), AF043303.1 (AAV2), J01901.1 (AAV2), U48704.1 (AAV3A), NC_001729.1 (AAV3A), AF028705.1 (AAV3B), NC_001829.1 (AAV4), U89790.1(AAV4), NC_006152.1(AAV5), AF028704.1(AAV6), NC_006260.1(AAV7), AF513851.1(AAV7), A F513852.1(AAV8), NC_006261.1(AAV-8), AY530579.1(AAV9), AAT46337(AAV10) and AAO88208(AAVrh10). See also, e.g., Srivistava et al. (1983) J. Virology 45:555; Chiorini et al. (1998) J. Virology 71:6823; Chiorini et al. (1999) J. Virology 73:1309; Bantel-Schaal et al. (1999) J. Virology 73:939; Xiao et al. (1999) J. Virology 73:3994; Muramatsu et al. (1996) Virology 221:208; Shade et al., (1986) J. Virol. 58:921; Gao et al. (2002) Proc. Nat. Acad. Sci. USA 99:11854; Moris et al. (2004) Virology 33:375-383; International patent publications WO0028061, WO9961601, WO9811244; U.S. Patent No. 6156303.

[0058] "Variant AAV capsid protein" or "AAV variant" refers to an AAV capsid protein comprising an amino acid sequence comprising at least one modification or substitution (including deletions, insertions, point mutations, etc.) relative to a naturally occurring or "wild-type" AAV capsid protein sequence. The variant AAV capsid protein may have about 80% identity or more to the amino acid sequence of the wild-type capsid protein, such as 85% identity or more, 90% identity or more, or 95% identity or more to the amino acid sequence of the wild-type capsid protein, such as 98% or 99% identity to the wild-type capsid protein.

[0059] The adeno-associated virus capsid protein contains three types of subunits VP1, VP2 and VP3, and the ratio of VP1:VP2:VP3 is 1:1:10. Among them, the VP3 region of the adeno-associated virus AAV2.5T capsid protein refers to the amino acid region ranging from 194 to 726 positions of the adeno-associated virus AAV2.5T capsid protein. The VP3 region of the adeno-associated virus AAV2 capsid protein refers to the amino acid region ranging from 203 to 735 positions of the adeno-associated virus AAV2 capsid protein. The VP3 region of the adeno-associated virus AAV5 capsid protein refers to the amino acid region ranging from 193 to 725 positions of the adeno-associated virus AAV5 capsid protein. The VP3 region of the adeno-associated virus AAV9 capsid protein refers to the amino acid region ranging from 203 to 737 positions of the adeno-associated virus AAV9 capsid protein.Among them, the AAV5 capsid protein sequence (SEQ ID NO: 4) is specifically as follows:.

[0060] In a first aspect of the present application, there is provided an adeno-associated virus variant capsid protein comprising VP1, VP2 and VP3 capsids;

[0061] Wherein, compared with the native AAV5 capsid protein, the adeno-associated virus variant capsid protein has a sequence with at least 80% identity, and the VP3 capsid region has at least one of the following mutations:

[0062] T376, E377, N378, S518, A581, N694, D695, Q697 and T706; or / and,

[0063] The adeno-associated virus variant capsid protein has a sequence with at least 80% identity to the AAV2.5T capsid protein, and the VP3 capsid region has at least one of the following mutations:

[0064] T377, E378, N379, S519, N695, D696, Q698 and T707.

[0065] Optionally, compared to native AAV5 capsid protein, the VP3 capsid region has at least one of the following mutations:

[0066] T376E, E377K, N378H, S518K, A581T, N694S, D695E, Q697E and T706A. Optionally, compared to the native AAV5 capsid protein, the VP3 capsid region has the following mutations:

[0067] T376E, E377K, N378H, S518K, A581T, N694S, D695E, Q697E and T706A. Optionally, compared to AAV2.5T, the VP3 capsid region has at least one of the following mutations:

[0068] T377E, E378K, N379H, S519K, N695S, D696E, Q698T, and T707A.

[0069] Optionally, compared to the AAV2.5T capsid protein, the VP3 capsid region has the following mutations:

[0070] T377E, E378K, N379H, S519K, N695S, D696E, Q698T, and T707A.

[0071] In a second aspect of the present application, there is provided an adeno-associated virus variant capsid protein comprising VP1, VP2 and VP3 capsids;

[0072] Wherein, compared with the native AAV5 capsid protein, the adeno-associated virus variant capsid protein has a sequence with at least 80% identity, and at least one of the following fragments in the VP3 capsid region has a mutation:

[0073] NTENP, QGSNT, APATG, YNDPQ and DSTGE; or / and,

[0074] The adeno-associated virus variant capsid protein has a sequence with at least 80% identity to the AAV2.5T capsid protein, and at least one of the following fragments in the VP3 capsid region has a mutation:

[0075] NTENP, QGSNT, YNDPQ and DSTGE.

[0076] Optionally, compared to the native AAV5 capsid protein, at least one amino acid in each of the following fragments in the VP3 capsid region is mutated:

[0077] NTENP, QGSNT, APATG, YNDPQ, and DSTGE.

[0078] Optionally, compared to the AAV2.5T capsid protein, at least one amino acid in each of the following fragments in the VP3 capsid region is mutated:

[0079] NTENP, QGSNT, YNDPQ and DSTGE.

[0080] Optionally, the adeno-associated virus variant capsid protein has a sequence that is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% identical to the native AAV5 capsid protein.

[0081] Optionally, the adeno-associated virus variant capsid protein has a sequence that is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% identical to the native AAV2.5T capsid protein.

[0082] Optionally, the unique region of the VP1 capsid and / or VP2 capsid is derived from one of the following AAVs: AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, bovine AAV, AAV2.5T and AAV-LK03.

[0083] The unique regions of VP1 and VP2 capsids can be derived from the same AAV. If the unique regions of VP1 and VP2 capsids are derived from different AAVs, the length of the adeno-associated virus variant relative to the capsid protein sequence of natural AAV5 is different, and the corresponding position of VP3 will be different.

[0084] Optionally, the mutation of fragment NTENP is selected from one of NEENP, NTKNP, NTEHP, NEKNP, NEEHP, NTKHP and NEKHP.

[0085] Optionally, the mutation of fragment QGSNT includes QGKNT.

[0086] Optionally, the mutation of fragment APATG includes APTTG.

[0087] Optionally, the mutation of fragment YNDPQ is selected from one of YSDPQ, YNEPQ, YNDPE, YSEPQ, YSDPE, YNEPE, and YSEPE.

[0088] Optionally, the mutation of fragment DSTGE includes DSAGE.

[0089] The third aspect of the present application provides a nucleic acid comprising a nucleotide fragment encoding the adeno-associated virus variant capsid protein.

[0090] Optionally, the sequence of the nucleic acid fragment is shown in SEQ ID NO:3.

[0091] The fourth aspect of the present application provides a recombinant plasmid vector comprising the nucleic acid encoding the adeno-associated virus variant capsid protein;

[0092] Optionally, genes involved in viral replication are also included.

[0093] The fifth aspect of the present application provides a virus packaging system, comprising the recombinant plasmid vector and the pHelper plasmid.

[0094] Optionally, the mass ratio of the recombinant plasmid vector: the pHelper plasmid is 1:(118-120).

[0095] Furthermore, the mass ratio of the recombinant plasmid vector: the pHelper plasmid is 1:118, 1:119 and 1:120.

[0096] The sixth aspect of the present application provides a recombinant adeno-associated virus vector, which has the adeno-associated virus variant capsid protein, or the recombinant adeno-associated virus vector is packaged by the viral packaging system in a host cell.

[0097] The seventh aspect of the present application provides a method for preparing a recombinant adeno-associated virus vector, comprising the following steps:

[0098] The virus packaging system is used to transfect host cells to prepare a recombinant adeno-associated virus vector.

[0099] Optionally, the host cell is selected from one of 293 cells, Hela cells and SF9 cells.

[0100] Preferably, the host cell is a 293 cell.

[0101] The eighth aspect of the present application provides a pharmaceutical composition comprising the recombinant adeno-associated virus vector.

[0102] The ninth aspect of the present application provides the use of the recombinant adeno-associated virus vector in the preparation of a drug for treating a retinal disease; optionally, the retinal disease is maculopathy.

[0103] The partial sequences of the above amino acid fragments are summarized in Table 1 below:

[0104] Table 1

[0105] Serial Number Amino acid sequence SEQ ID NO::8 NTENP SEQ ID NO:9 NEENP SEQ ID NO:10 NTKNP SEQ ID NO:11 NTEHP SEQ ID NO:12 NEKNP SEQ ID NO:13 NEEHP SEQ ID NO:14 NTKHP SEQ ID NO:15 NEKHP SEQ ID NO:16 QUR SEQ ID NO:17 QUR SEQ ID NO:18 APATG SEQ ID NO:19 APTTG SEQ ID NO:20 YDQ SEQ ID NO:21 YQ SEQ ID NO:22 YNEPQ SEQ ID NO:23 YNDPE SEQ ID NO:24 YSEPQ SEQ ID NO:25 YSDPE SEQ ID NO:26 YNEPE SEQ ID NO:27 YSEPE SEQ ID NO:28 DSTGE SEQ ID NO:29 DSAGE

[0106] The following is further described in conjunction with specific embodiments. The raw materials involved in the following specific embodiments, unless otherwise specified, can all be commercially available. The instruments used, unless otherwise specified, can all be commercially available. The processes involved, unless otherwise specified, are all routinely selected by those skilled in the art.

[0107] Example 1

[0108] This example constructs a recombinant adeno-associated virus vector, and the specific construction method is as follows:

[0109] The first step is the preparation of recombinant plasmid

[0110] Through the analysis of the protein three-dimensional structure of the AAV capsid library and its function-related genes, base mutations are introduced into different regions of the capsid protein gene. The base mutations are based on the changes in amino acids.

[0111] 1. Gene mutations were introduced by oligonucleotide synthesis, using the plasmid of the parent AAV2.5T as a template, and the amino acid sequence of its capsid protein was SEQ ID NO: 1. The mutations in each region were PCR amplified separately using a high-fidelity enzyme to the full length of the capsid protein Cap gene, about 2.4 kb, and the PCR products were purified and recovered by a DNA purification and recovery kit. Different PCR products contain different mutation regions and library complexities. The capsid protein gene Cap of AAV2.5T is composed of the head of AAV2 and the tail of AAV5.

[0112] 2. The plasmid pIR2NoC containing ITR at both ends, AAV2-Rep gene and ori and resistance element is used as a vector plasmid, and the vector plasmid is digested with NheI enzyme. The sequences on both sides of the digestion port are homologous to the 5' and 3' sequences of the PCR product. The purified PCR product is added to the product after NheI digestion, and a recombinant plasmid is constructed by homologous recombination. The recombinant plasmid is purified using a DNA purification kit and eluted with pure water to remove ions.

[0113] 3. Use an electroporator to electroporate competent cells DH10B, transfect the purified recombinant plasmid into competent cells DH10B, and culture the transfected DH10B with LB medium at 37°C for 30 minutes. Then take 1 μL of culture solution from the LB medium, dilute it 1000 times, and then spread it on the plate. On the second day, observe the number of plaques on the plate and calculate the titer to determine the complexity of the recombinant plasmid library.

[0114] 4. Use the plasmid large-scale extraction kit TIANGEN (model: DP120) to extract the culture in LB medium, extract the recombinant plasmid, and finally measure the concentration using a UV spectrophotometer.

[0115] Step 2: Recombinant AAV vector packaging

[0116] 1. Cultivate 293 cells: Use complete medium containing 10% fetal bovine serum and 2% double antibody to culture 293 cells. When the confluence of the adherent cells reaches about 80%, the cells are passaged. First, remove the supernatant, rinse the cells with 1x PBS, and then add trypsin to digest the cells. When the cells flow down in a sandy state, add complete medium to terminate digestion, centrifuge at 300g for 5 minutes, remove the supernatant, add a small amount of medium to resuspend, and then passage.

[0117] 2. Construct the virus packaging system: configure according to the ratio of recombinant plasmid: pHelper plasmid = 1:119, plasmid DNA: PEI-MAX = 1:3. Plasmid DNA contains recombinant plasmid and pHelper plasmid. According to the ratio of plasmid DNA and host 293 cells, ensure that a total of 30μg of plasmid DNA is input into each 15cm cell culture dish.

[0118] Plasmid DNA was mixed with DMEM culture medium to obtain mixture 1, and transfection reagent PEI-MAX was mixed with another portion of DMEM culture medium to obtain mixture 2. After standing at room temperature for 5 minutes, mixture 1 was poured into mixture 2, gently mixed and then stood for 20 minutes to obtain mixture 3. Mixture 3 was poured into DMEM transfection culture medium, and then gently added from the side to the 293 cells from which the culture medium was removed (at this time, the confluence of 293 cells reached about 80%). After the operation, the 293 cells were placed in an incubator at 37°C and 5% CO2 for culture. Both DMEM culture medium and DMEM transfection culture medium contain 2% fetal bovine serum and 2% double antibody.

[0119] Step 3: Purification of recombinant adeno-associated virus vector

[0120] 1. Take 293 cells after 4 days of culture, harvest the recombinant adeno-associated virus vector, blow and aspirate the 293 cells to change them from an adherent state to a suspended state, and then centrifuge. Take the cell pellet after centrifugation and place it in test tube A, add cell lysis buffer to lyse the cells, and store in a -80℃ refrigerator. Take the supernatant after centrifugation in test tube B, add 5M NaCl and PEG8000 to bind the recombinant adeno-associated virus vector, shake test tube B repeatedly to clarify the solution, centrifuge after clarification, remove the supernatant, lyse the precipitate with cell lysis buffer, and then mix it with test tube A stored at -80℃ to obtain mixed solution A.

[0121] 2. Freeze the mixed solution A at -80°C, thaw at 37°C, repeat freezing and thawing 3 times, add 1 / 10000 universal nuclease and incubate at 37°C for 30 minutes to remove free DNA, then add Triton 100 to make the final volume concentration of the recombinant adeno-associated virus vector in the mixed sample tube reach 0.25%, incubate at 37°C for 30 minutes, centrifuge at 3000g for 30 minutes, and take the supernatant after centrifugation for ultracentrifugation. (Triton 100 is a surfactant that can be used to destroy cell membranes to lyse cells and release intracellular substances.)

[0122] 3. Prepare density gradient iodixanol solution: Prepare iodixanol solutions with concentrations of 15%, 25%, 40%, and 60% by mixing different volumes of Opti-prep, 10x Buffer, PBS-MK, 5M NaCl, and H2O. Transfer the supernatant containing the recombinant adeno-associated virus vector after centrifugation in 2 to an ultracentrifuge tube, and distribute the above iodixanol solutions of different concentrations into the tube by a peristaltic pump, and set the centrifugation program to 700,000 rpm, 4°C, and 1h10min for centrifugation.

[0123] 4. After centrifugation, the recombinant adeno-associated virus vector was drawn out from the 40% and 60% layers through a syringe, diluted with a 1x PBS solution containing 1 / 10000 poloxamer, and then purified by buffer replacement using a 100KD ultrafiltration tube. After centrifugation at 5000g, the filtered liquid was removed. As the centrifugation proceeded, the filtered liquid became less and the dilution was continued. Finally, the recombinant adeno-associated virus vector was drawn out and aseptically filtered through a 0.22μm filter.

[0124] Step 4: Determination of recombinant adeno-associated virus vector titer

[0125] 1. Take 2 μL of the purified recombinant adeno-associated virus vector and treat it with a DNA enzyme treatment kit. The reaction was carried out at 37°C for 10 min. After the reaction was completed, 1 μL of 0.1 M EDTA was added and the DNA enzyme was heat-inactivated at 75°C for 10 min. Then 20 μL of AAVLysis Buffer was added and the reaction was carried out at 70°C for 10 min to obtain mixed solution B. Take 2 μL of mixed solution B and add 98 μL of water, dilute 50 times, and perform qPCR reaction.

[0126] 2. The qPCR reaction was conducted using the probe method. Both the primers and probes were designed on the ITR element. The sequences of the primers and probes are as follows:

[0127] ITR-F: GGAACCCTAGTGATGGAGTT (SEQ ID NO: 5);

[0128] ITR-R: CGGCCTCAGTGAGCGA (SEQ ID NO: 6);

[0129] ITR-Probe: CACTCCCTCTCTGCGCGCTCG (SEQ ID NO:7).

[0130] 3. Use linearized plasmid pAAV-GFP as a standard at a concentration of 2×10 7 , 5 dilution levels, 2×10 7 , 2×10 6 , 2×10 5 , 2×10 4 , 2×10 3 Each reaction was repeated in triplicate and a negative control was additionally prepared.

[0131] 4. After configuring the system, perform the reaction on the machine to obtain the virus titer.

[0132] Step 5: Preparation of recombinant adeno-associated virus vector library

[0133] 1. Use the viral genome extraction kit TIANGEN (model: DP315) to extract the viral genome of the recombinant adeno-associated virus vector, use the recombinant adeno-associated virus vector genome and plasmid as templates for high-throughput sequencing (NGS) library construction, and perform NGS sequencing through an NGS sequencing company. Analyze the NGS sequencing data, observe the complexity of the library, mutation distribution, and the degree of bias between the plasmid library and the viral library, and confirm that the library construction strategy is feasible and the operation process is correct.

[0134] 2. Using the viral genome of the recombinant adeno-associated virus vector as a template, PCR amplification is performed to integrate mutations in different regions of the primary library of the recombinant adeno-associated virus vector gene into the secondary library to obtain a Cap gene with more mutation regions. After recombining the plasmid, a sufficient amount of recombinant adeno-associated virus is obtained according to the preparation method of the primary library.

[0135] Step 6: Animal Experiment

[0136] 1. The recombinant adeno-associated virus vector library obtained in step 5 was sent to an animal experiment company for animal experiments. The animals used in the experiment were cynomolgus monkeys. The recombinant adeno-associated virus vector was injected into the vitreous body (left eye) of the cynomolgus monkeys. The cynomolgus monkeys were killed 14 days later and the retinas were taken. The animal experiments were commissioned to Shanghai Pengli Biotechnology Co., Ltd.

[0137] 2. After the retina is minced and ground, nucleic acid is extracted. During the process, RNAse is added to remove RNA, and the nucleic acid is harvested using a silica-based column. The sample is then treated with NEB's exonuclease 5 and purified using a DNA purification kit after overnight incubation.

[0138] 3. Use the episomal DNA as a template for PCR reaction. After the full-length of the Cap gene is successfully amplified, it is sequenced using the Pacbio platform. By analyzing the sequencing results, a new library is designed based on the original one.

[0139] Step 7: Cycle screening experiments and characterization of candidate variants

[0140] 1. Repeat the above-mentioned process of step 1 to step 6 for several rounds, and finally obtain several candidate recombinant adeno-associated viruses, and perform gene synthesis on the candidate adeno-associated viruses according to their gene sequences to obtain candidate variant plasmids.

[0141] 2. Barcode biodistribution analysis: Based on the marker plasmid (GFP plasmid), add Barcode information and construct Barcode plasmid by recombination to obtain multiple plasmids that are completely identical except for the Barcode region. Use pHelper plasmid, candidate variant plasmid and different Barcode plasmids to package the virus again.

[0142] A barcode refers to a short DNA sequence. By designing different barcode sequences at the 5' end of the PCR primer, different samples carry different barcodes after PCR amplification. After mixing, a high-throughput sequencing library is constructed. After sequencing, the biological distribution of the virus can be analyzed based on the barcode.

[0143] 3. Animal experiment: The packaged virus particles were injected into the mouse retina and the mice were killed after a period of time. The DNA and RNA of the retinal tissue and the DNA and RNA of the RPE tissue were extracted respectively. The RNA was reverse transcribed into cDNA, and the housekeeping genes were selected at the DNA and mRNA levels for qPCR verification. The mouse experiment was commissioned to the Suzhou Institute of Materia Medica, Chinese Academy of Sciences.

[0144] 4. The PCR product was sent to a sequencing company for library construction and sequencing, and the sequencing results were analyzed to obtain the best variant, i.e., the recombinant adeno-associated virus vector of the present application. Relative to the amino acid sequence of its parent AAV2.5T capsid protein (SEQ ID NO: 1), the amino acid sequence of the VP3 region of the adeno-associated virus variant capsid protein of the adeno-associated virus vector has the following mutation sites: T377E, E378K, N379H, S519K, N695S, D696E, Q698T and T707A. The amino acid sequence of the adeno-associated virus variant capsid protein is SEQ ID NO: 2, and the nucleic acid sequence encoding the adeno-associated virus variant capsid protein is SEQ ID NO: 3.

[0145] The specific sequence of SEQ ID NO: 1 is as follows:

[0146] MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPFGLVEEGAKTAPTGKRIDDHFPKRKKARTEEDSKPSTSSDAEAGPSGSQQLQIPAQPASSLGADTMSAGGGGPLGDNNQGADGVGNASGDWHCDSTWMGDRVVTKSTRTWVLPSYNNHQYREIKSGSVDGSNANAYFGYSTPWGYFDFNRFHSHWSPRDWQRLINNYWGFRPRSLRVKIFNIQVKEVTVQDSTTTIANNLTSTVQVFTDDDYQLPYVVGNGTEGCLPAFPPQVFTLPQYGYATLNRDNTENPTERSSFFCLEYFPSKMLRTGNNFEFTYNFEEVPFHSSFAPSQNLFKLANPLVDQYLYRFVSTNNTGGVQFNKNLAGRYANTYKNWFPGPMGRTQGWNLGSGVNRASVSAFATTNRMELEGASYQVPPQPNGMTNNLQGSNTYALENTMIFNSQPANPGTTATYLEGNMLITSESETQPVNRVAYNVGGQMATNNQSSTTAPTTGTYNLQEIVPGSVWMERDVYLQGPIWAKIPETGAHFHPSPAMGGFGLKHPPPMMLIKNTPVPGNITSFSDVPVSSFITQYSTGQVTVEMEWELKKENSKRWNPEIQYTNNYNDPQFVDFAPDSTGEYRTTRPIGTRYLTRPL

[0147] The specific sequence of SEQ ID NO: 2 is as follows:

[0148] MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPFGLVEEGAKTAPTGKRIDDHFPKRKKARTEEDSKPSTSSDAEAGPSGSQQLQIPAQPASSLGADTMSAGGGGPLGDNNQGADGVGNASGDWHCDSTWMGDRVVTKSTRTWVLPSYNNHQYREIKSGSVDGSNANAYFGYSTPWGYFDFNRFHSHWSPRDWQRLINNYWGFRPRSLRVKIFNIQVKEVTVQDSTTTIANNLTSTVQVFTDDDYQLPYVVGNGTEGCLPAFPPQVFTLPQYGYATLNRDNEKHPTERSSFFCLEYFPSKMLRTGNNFEFTYNFEEVPFHSSFAPSQNLFKLANPLVDQYLYRFVSTNNTGGVQFNKNLAGRYANTYKNWFPGPMGRTQGWNLGSGVNRASVSAFATTNRMELEGASYQVPPQPNGMTNNLQGKNTYALENTMIFNSQPANPGTTATYLEGNMLITSESETQPVNRVAYNVGGQMATNNQSSTTAPTTGTYNLQEIVPGSVWMERDVYLQGPIWAKIPETGAHFHPSPAMGGFGLKHPPPMMLIKNTPVPGNITSFSDVPVSSFITQYSTGQVTVEMEWELKKENSKRWNPEIQYTNNYSEPTFVDFAPDSAGEYRTTRPIGTRYLTRPL

[0149] The specific sequence of SEQ ID NO: 3 is as follows:

[0150]

[0151] Comparative Example 1

[0152] AAV2 is a wild-type virus, and AAV2-7m8 is an excellent capsid variant virus vector designed by a foreign company. It is currently a benchmark product in the field of AAV ophthalmology. Wild-type AAV2 and AAV2-7m8 were packaged according to the method of Example 1 of this application, and the corresponding sufficient amount of virus was obtained after purification. Animal experiments were then carried out, namely, intravitreal injection experiments in mice, and DNA and RNA of wild-type AAV2 and AAV2-7m8 mouse retinal tissue and RPE tissue were extracted, respectively, and PCR amplification was performed after reverse transcription to construct NGS library for sequencing.

[0153] Biodistribution results

[0154] The biological distribution diagram after sequencing of the recombinant adeno-associated virus vector, AAV2, and AAV2-7m8 virus bodies in Example 1 of the present application is as follows Figure 1 and Figure 2 shown.

[0155] Figure 1 The genome biodistribution diagrams of AAV2, AAV2-7m8 virions and the recombinant adeno-associated virus vector (CL5-RE2) in Example 1 of the present application represent the DNA expression level. Figure 1 The vertical axis is vg / cell, where vg is the abbreviation of vector genome and vg / cell is the number of viral particles distributed to each cell.

[0156] Figure 2 The expression biodistribution diagrams of AAV2, AAV2-7m8 virions and the recombinant adeno-associated virus vector (CL5-RE2) in Example 1 of the present application represent the mRNA expression level. Figure 2 The middle vertical axis is % control, which is compared with the expression level of housekeeping genes.

[0157] Figure 1 and Figure 2 The results show that the recombinant adeno-associated virus vector of the present application has stronger RPE transduction at the DNA (genomic biodistribution) and mRNA (expression biodistribution) levels.

[0158] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0159] The above-mentioned embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims.

Claims

1. An adeno-associated virus variant capsid protein, characterized in that Contains VP1, VP2, and VP3 capsids; Wherein, compared with the native AAV5 capsid protein, the adeno-associated virus variant capsid protein has a sequence with at least 80% identity, and the VP3 capsid region has at least one of the following mutations: T376, E377, N378, S518, A581, N694, D695, Q697 and T706; or / and, The adeno-associated virus variant capsid protein has a sequence with at least 80% identity to the AAV2.5T capsid protein, and the VP3 capsid region has at least one of the following mutations: T377, E378, N379, S519, N695, D696, Q698 and T707.

2. The adeno-associated virus variant capsid protein according to claim 1, characterized in that Compared to native AAV5 capsid protein, the VP3 capsid region has at least one of the following mutations: T376E, E377K, N378H, S518K, A581T, N694S, D695E, Q697E, and T706A.

3. The adeno-associated virus variant capsid protein according to claim 2, characterized in that: Compared to native AAV5 capsid protein, the VP3 capsid region has the following mutations: T376E, E377K, N378H, S518K, A581T, N694S, D695E, Q697E, and T706A.

4. The adeno-associated virus variant capsid protein according to claim 1, characterized in that Compared to AAV2.5T, the VP3 capsid region has at least one of the following mutations: T377E, E378K, N379H, S519K, N695S, D696E, Q698T, and T707A.

5. The adeno-associated virus variant capsid protein according to claim 4, characterized in that Compared to the AAV2.5T capsid protein, the VP3 capsid region has the following mutations: T377E, E378K, N379H, S519K, N695S, D696E, Q698T, and T707A.

6. An adeno-associated virus variant capsid protein, characterized in that: Contains VP1, VP2, and VP3 capsids; Wherein, compared with the native AAV5 capsid protein, the adeno-associated virus variant capsid protein has a sequence with at least 80% identity, and at least one of the following fragments in the VP3 capsid region has a mutation: NTENP, QGSNT, APATG, YNDPQ and DSTGE; or / and, The adeno-associated virus variant capsid protein has a sequence with at least 80% identity to the AAV2.5T capsid protein, and at least one of the following fragments in the VP3 capsid region has a mutation: NTENP, QGSNT, YNDPQ and DSTGE.

7. An adeno-associated virus variant capsid protein according to claim 6, characterized in that: Compared to the native AAV5 capsid protein, at least one amino acid in each of the following fragments in the VP3 capsid region is mutated: NTENP, QGSNT, APATG, YNDPQ, and DSTGE.

8. The adeno-associated virus variant capsid protein according to claim 6, characterized in that: Compared to the AAV2.5T capsid protein, at least one amino acid in each of the following fragments in the VP3 capsid region is mutated: NTENP, QGSNT, YNDPQ and DSTGE.

9. The adeno-associated virus variant capsid protein according to any one of claims 1 to 8, characterized in that The unique region of the VP1 capsid and / or VP2 capsid is derived from one of the following AAVs: AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, bovine AAV, AAV2.5T and AAV-LK03.

10. A nucleic acid, characterized in that The invention comprises a nucleotide fragment encoding the adeno-associated virus variant capsid protein according to any one of claims 1 to 8.

11. The nucleic acid according to claim 10, characterized in that The sequence of the nucleic acid fragment is shown in SEQ ID NO:

3.

12. A recombinant plasmid vector, characterized in that: A nucleic acid encoding an adeno-associated virus variant capsid protein as claimed in claim 10 or 11; Optionally, genes involved in viral replication are also included.

13. A virus packaging system, characterized in that: It comprises the recombinant plasmid vector as claimed in claim 12 and a pHelper plasmid.

14. A recombinant adeno-associated virus vector, characterized in that: The recombinant adeno-associated virus vector has the adeno-associated virus variant capsid protein according to any one of claims 1 to 8, or the recombinant adeno-associated virus vector is packaged in a host cell by the virus packaging system according to claim 13.

15. A method for preparing a recombinant adeno-associated virus vector, characterized in that: The steps include: The virus packaging system according to claim 14 is used to transfect host cells to prepare a recombinant adeno-associated virus vector.

16. The preparation method according to claim 15, characterized in that: The host cell is selected from one of 293 cells, Hela cells and SF9 cells.

17. A pharmaceutical composition, characterized in that Comprising the recombinant adeno-associated virus vector as described in claim 14.

18. Use of the recombinant adeno-associated virus vector according to claim 17 in the preparation of a drug for treating retinal diseases; optionally, the retinal disease is maculopathy.

Images