Application of rice OsHAK22 gene in regulating drought tolerance of rice
By overexpressing or knocking out the OsHAK22 gene in rice and constructing a recombinant expression vector, the rice's tolerance to drought stress was enhanced or reduced, solving the problem of insufficient tolerance of rice to drought stress and achieving an improvement in potassium absorption capacity and an increase or decrease in yield under drought conditions.
Patent Information
- Application Number
- CN202411675498.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-21
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2044-11-21
AI Technical Summary
In the existing technology, rice has insufficient tolerance to drought stress, resulting in a decrease in yield, and the mechanism by which potassium ion transporters regulate rice's response to drought stress is still unclear.
By overexpressing or knocking out the rice high-affinity potassium ion transporter encoding gene OsHAK22, a recombinant expression vector was constructed, and gene editing was performed in rice using Agrobacterium-mediated transgenic technology to enhance or reduce its tolerance to drought stress.
OsHAK22 overexpression materials significantly improved the tolerance of rice to drought stress at the seedling and booting stages, enhanced the potassium absorption capacity under drought conditions, and increased relative yield; while knockout led to increased sensitivity to drought stress and reduced yield.
Smart Images

Figure CN119242703B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of genetic engineering and relates to the application of rice low-potassium response high-affinity potassium ion transporter encoding gene OsHAK22 in drought stress tolerance. Background Art
[0002] Drought is one of the most common environmental conditions that causes a dramatic decline in plant growth and crop yield (Zhu, 2002). Throughout evolution, plants have acquired a range of strategies to avoid water shortages by reducing water loss or increasing water uptake. However, additional strategies are necessary to prevent cellular damage when water is depleted and tissues become dehydrated (Verslues et al., 2006). Under environmental stresses such as drought, the accumulation of reactive oxygen species (ROS) is essential (Verslues et al., 2006). In plant cells, ROS such as hydrogen peroxide (H2O2), hydroxyl radicals, and superoxide are produced through aerobic metabolism. As harmful oxygen derivatives, they can damage lipids, nucleic acids, proteins, and carbohydrates, ultimately leading to cell death (Mittler et al., 2004). To mitigate oxidative stress, organisms have evolved effective antioxidant defense mechanisms, including the induction of stress-related genes (Gasch et al., 2000; Desikan et al., 2002). The maintenance of cellular homeostasis in plant cells is usually achieved through ROS scavenging systems, mainly with the assistance of enzyme systems such as catalase (CAT) and peroxidases (POXs) (Mittler et al., 2004).
[0003] Potassium (K + ) is a major cation in plants and affects various aspects of crop production, including yield, tolerance to pathogens and abiotic stresses, including salt and drought (Ahmad et al., 2016b). + Nutrition is closely related to water homeostasis and water use efficiency (Kuchenbuch et al., 1986; Tanguilig et al., 1987). An important mechanism for plants to respond to drought stress is to absorb K. + Solutes such as K (Andersen et al., 1992; Wang et al., 2004; Mahouachi et al., 2006). + The loss of β-catenin contributes to osmotic regulation, maintains cell expansion, ensures proper stomatal regulation, and helps maintain photosynthetic activity through photosynthetic transport ( and Kirkby, 2010; et al., 2014), therefore, under stimulation conditions, K+ Regulation of transport is critical.
[0004] KT / HAK / KUP transporters have been predicted to maintain K + play a key role in homeostasis et al., 2002; Gierth et al., 2005; Nieves-Cordones et al., 2007; Fulgenzi et al., 2008; Yang et al., 2014; Chen et al., 2015b; Li et al., 2017). In Arabidopsis, KUP6 subfamily transporters can balance K + homeostasis, playing a key role in osmoregulation (Osakabe et al., 2013). Perception of osmotic stress can trigger transient K + efflux (Brauer et al., 2016). Chen et al. found that OsHAK1 transporter regulates rice positive response to drought stress in rice (Chen et al., 2017). Therefore, it is worth further exploring the mechanism of how KT / HAK / KUP transporters regulate rice response to drought stress by affecting K + homeostasis. SUMMARY
[0005] The purpose of the present application is to provide the application of rice high-affinity potassium ion transporter encoding gene OsHAK22 in drought stress tolerance, mainly that overexpression material can increase the tolerance of rice to drought stress at seedling stage and booting stage, and knockout leads to the decrease of tolerance to drought stress at seedling stage and booting stage.
[0006] The purpose of the present application is achieved by the following technology:
[0007]
[0008] As a preferred embodiment of the present invention, overexpression of the rice high-affinity potassium ion transporter encoding gene OsHAK22 enhances rice tolerance to drought stress. Preferably, any one or more of the following are selected:
[0009] (1) Increase the tolerance of rice seedlings to drought stress;
[0010] (2) increasing the potassium content in the stem and leaf sheath of rice under drought stress during the booting stage;
[0011] (3) Improve the relative yield of rice under drought stress during the heading stage.
[0012] As a preferred embodiment of the present invention, knocking out the rice high-affinity potassium ion transporter encoding gene OsHAK22 will reduce rice tolerance to drought stress.
[0013] A recombinant expression vector containing the rice high-affinity potassium ion transporter encoding gene OsHAK22.
[0014] As a preferred embodiment of the present invention, the recombinant expression vector is obtained by inserting the rice high-affinity potassium ion transporter encoding gene OsHAK22 into the SacI and BamHI restriction sites of the starting vector pTCK303.
[0015] The recombinant expression vector is used to improve the tolerance of rice to drought stress.
[0016] As a preferred embodiment of the present invention, the recombinant expression vector is used to increase the relative yield of rice under drought stress, thereby improving the drought resistance of rice.
[0017] The invention relates to an application of knocking out the rice high-affinity potassium ion transporter encoding gene OsHAK22 in reducing rice tolerance to drought stress.
[0018] Knocking out the rice high-affinity potassium ion transporter encoding gene OsHAK22 is used to reduce the relative yield under drought stress, ultimately leading to high sensitivity of rice to drought stress.
[0019] As a preferred embodiment of the present application, the knockout vector for knocking out the rice high-affinity potassium ion transporter-encoding gene OsHAK22 is a pOs-sgRNA vector-based vector, primers are designed and synthesized for the target sequences T1 (SEQ ID No. 2: CCCACTCTACGTCTACTCCA) and T2 (SEQ ID No. 3: CTGTTCGCGGTGCAGAGGTT) of the rice high-affinity potassium ion transporter-encoding gene OsHAK22, and after annealing, the primers are inserted between the BsaI enzyme cutting sites of the basic vector to obtain a U3::Spacer expression vector. The U3::Spacer expression vector plasmid and the pH-Ubi-cas9-7 expression vector plasmid are subjected to a gateway reaction to obtain an expression vector containing U3::Spacer and Ubi::Cas9 double expression.
[0020] Advantages of the present application:
[0021] 1. In the present application, a recombinant expression vector constructed from the rice high-affinity potassium ion transporter-encoding gene OsHAK22 is first discovered in the world, which is transfected into wild-type rice Nipponbare (Oryza sativa.ssp.
[0022] cv. Japonica) by Agrobacterium-mediated rice transgenic technology, and it is found that the OsHAK22 overexpression material has significantly improved drought stress tolerance at the seedling stage compared with wild-type rice.
[0023] 2. The OsHAK22 gene in the present application is derived from rice, and the constructed rice high-affinity potassium ion transporter-encoding gene OsHAK22 plant expression vector can be directly used for Agrobacterium-mediated plant genetic transformation to obtain new germplasm that can enhance the drought stress tolerance of rice.
[0024] 3. The OsHAK22 gene in the present application can enhance the drought stress tolerance of rice at the seedling stage and booting stage after overexpression, and ultimately improve the relative yield of crops by improving the potassium holding of leaf sheath under drought stress. BRIEF DESCRIPTION OF DRAWINGS
[0025] Figure 1 , Expression of OsHAK22 in different tissues of rice at different growth stages
[0026] Figure 2 , Up-regulation of OsHAK22 expression induced by mannitol and ABA stress
[0027] Fig. A-B: OsHAK22 gene is up-regulated by 120.4 g / L mannitol and 100 μM ABA -1Figures CD: The expression levels of OsHAK22 gene in roots and aboveground parts at different time points after mannitol stress; Figures CD: The expression levels of OsHAK22 gene in roots and aboveground parts at different time points after 30 μM ABA stress.
[0028] Figure 3 The expression of OsHAK22 in different tissues of rice is upregulated by drought stress.
[0029] Figure 4 Differences in tolerance to drought stress in seedlings of OsHAK22 overexpression, knockout and corresponding wild-type materials
[0030] Figure 5 Leaf curling phenotypes of OsHAK22 overexpression, knockout and corresponding wild-type materials under drought stress
[0031] Figure 6 , OsHAK22 overexpression, knockout and corresponding wild-type materials under drought stress. Figure A: Single plant yield of WT and OsHAK22 overexpression and knockout materials under drought stress; Figure B: Relative yield of WT and OsHAK22 overexpression and knockout materials under drought stress.
[0032] Figure 7 Potassium content in different tissues of WT, OsHAK22 overexpression, knockout and corresponding wild-type materials under drought stress Figure A: Potassium content in roots of WT, OsHAK22 overexpression and knockout materials under drought stress; Figure B: Potassium content in stems and leaf sheaths of WT, OsHAK22 overexpression and knockout materials under drought stress; Figure C: Potassium content in leaves of WT, OsHAK22 overexpression and knockout materials under drought stress.
[0033] Figure 8 , map of the pTCK303 expression vector.
[0034] Figure 9 , pH-Ubi-cas9-7 and pOs-sgRNA vector maps. DETAILED DESCRIPTION
[0035] Example 1. Construction of OsHAK22 overexpression vector
[0036] According to the full-length ORF (open reading frame) sequence of OsHAK22 gene, specific primers (Table 1) were designed by Primer 5.0 software, and then SacI and BamHI were added at the 5' end and 3' end of the primers. The total RNA extracted from rice leaves was reverse transcribed into cDNA, and the cDNA was used as a template to amplify the OsHAK22 open reading frame sequence. The obtained PCR product was purified by gel recovery and then connected to the pEASY-Blunt simple cloning vector, and then transferred into E. coli for overnight culture. The next day, positive single clones were picked, shaken, and plasmid was extracted, and enzyme digestion verification was performed before sending to the company for sequencing verification. The correct cloning vector plasmid and pTCK303 vector plasmid were double-digested with restriction endonucleases SacI and BamHI, and the enzyme digestion products were recovered by gel, and then the target gene and the expression vector were subjected to T4 enzyme ligation reaction and transferred into E. coli for overnight culture. The next day, single clones were picked, shaken, and plasmid was extracted, and sequencing verification was performed.
[0037] Table 1 OsHAK22 overexpression primers
[0038]
[0039] Note: The underlined base sequence is the enzyme digestion site
[0040] 50 μl double enzyme digestion reaction system is as follows:
[0041]
[0042] Example 2. Construction of OsHAK22 knockout material
[0043] Using the OsHAK22 genomic sequence from Nipponbare rice as a template, and targeting sequences T1 (SEQ ID No. 2: CCCACTCTACGTCTACTCCA) and T2 (SEQ ID No. 3: CTGTTCGCGGTGCAGAGGTT) within the OsHAK22 gene, a CRISPR-Cas9 mutant expression vector was constructed. The specific construction process was as follows: First, primers specific for target sites T1 and T2 were designed (Table 2). The designed spacer was then sent to a company for synthesis. Annealing temperature gradients were set to generate a double-stranded product. The pOs-sgRNA vector was linearized with BsaI endonuclease, and the double-stranded product and the linearized vector were ligated using T4 ligase. The ligated product was transformed into Escherichia coli and cultured overnight. The next day, positive colonies were selected, the plasmids were extracted, and the vectors were sent to a company for sequencing. Once the sequencing was confirmed, the U3::Spacer expression vector was obtained. The U3::Spacer expression vector plasmid and the pH-Ubi-cas9-7 expression vector plasmid were then subjected to a gateway reaction to obtain an expression vector containing both U3::Spacer and Ubi::Cas9. The dual-expression expression vector was then transferred into Escherichia coli for overnight culture. The next day, a single clone was picked, shaken, and the plasmid was extracted and sequenced for verification.
[0044] Table 2 Primer sequences used for knockout of OsHAK22 using the CRISPR-Cas9 system
[0045]
[0046] Example 3. Acquisition and identification of OsHAK22 rice transgenic material
[0047] The expression vector obtained above is transformed into Agrobacterium competent cells by electroporation, and then preliminary screening is carried out with antibiotics to pick positive single clones, the plasmid is extracted and transformed into Escherichia coli for verification. After correct verification, the corresponding Agrobacterium bacterial solution is preserved with 30% glycerol and stored in a -80°C refrigerator for use. The OsHAK22 overexpression vector and the CRISPR-Cas9 mutant expression vector are transferred into fresh rice callus tissue through the Agrobacterium-mediated method. Preliminary screening is carried out by selecting one or two, and then the target transgenic rice material is successfully obtained through differentiation, rooting and other processes. The target transgenic positive rice seedlings obtained by successful screening are planted at the Pailou Experimental Base of Nanjing Agricultural University for breeding, and the individual plants are harvested after the seeds are fully mature.
[0048] To determine whether OsHAK22 expression was enhanced, we performed RT-PCR on T1 seeds. Seedlings were grown using 1 / 2 MS solid medium and cultured in the dark in a tissue culture chamber for approximately three days. After germination, they were placed in the light of the chamber. When the seedlings reached the lid of the differentiation jar, the lid was opened and the jar was watered with an appropriate amount of sterile deionized water for seven days. Positive seedlings were then identified by immersing a small root tip in GUS stain and incubating overnight at 37°C. The next day, positive lines with blue root tips were selected and transferred to normal rice nutrient solution for another two weeks. The nutrient solution was changed every two days, maintaining a pH between 5.0 and 5.5. Leaves from overexpressing and wild-type plants were sampled, immediately placed in liquid nitrogen, and stored at -80°C. RNA was then extracted and cDNA synthesized. The expression level of OsHAK22 in the overexpressing seedlings was determined using semi-quantitative RT-PCR. The semi-quantitative primers and internal reference primers of OsHAK22 are shown in Table 3.
[0049] Table 3 Primer sequences for OsActin and OsHAK22 used in RT-PCR
[0050]
[0051] Healthy wild-type and overexpressing rice seeds were selected and soaked in a 30% sodium hypochlorite solution for 30 minutes. After rinsing five times with clean water, the seeds were placed in a paper cup lined with a 20-mesh nylon mesh, half submerged in clean water, and then placed in a 37°C incubator for 24-36 hours, ensuring that the water in the paper cup remained half submerged. Finally, the seeds were cultured in an artificial climate chamber. Ten days after emergence, all overexpressing rice seedlings were initially identified by GUS staining. Positive lines were selected, and leaves were used for RNA extraction and cDNA synthesis. Semi-quantitative RT-PCR was used to further characterize the expression levels of OsHAK22 overexpressing rice seedlings. Two representative overexpression lines, designated OsHAK22-Ox1 and OsHAK22-Ox2, were further selected through physiological experiments for subsequent experiments.
[0052] To examine the mutational effects of the OsHAK22 CRISPR-Cas9 transgenic seedlings, we sequenced and identified T1-generation OsHAK22 seedlings. Seedlings were cultured in a 1 / 2MS solid medium for approximately three days in a dark-cultured artificial tissue culture chamber. After germination, they were cultured in the artificial tissue culture chamber under light conditions. When the rice seedlings reached the lid of the differentiation tank, the lid was opened and an appropriate amount of sterile deionized water was poured into the tank for seven days. The seedlings were then transferred to a full IRRI rice nutrient solution for two weeks. Leaves from the CRISPR-Cas9 transgenic seedlings and wild-type plants were sampled and quickly placed in liquid nitrogen and stored in a -80°C freezer. DNA from the leaves was extracted and amplified using two PCR amplifications using identification primers. First, gDNA samples of mutant material and corresponding wild-type strains were extracted. In the first round, Cas9 sequences were verified using universal Cas9 primers (Table 3). In the second round, OsHAK22-CRISPR-F / R primers (Table 3) were used to amplify the gDNA of the transgenic strains. The products were sent to the company for sequencing, and homozygous knockout material was selected. Sequencing and verification of the mutant material yielded several homozygous OsHAK22 knockout strains. Further analysis of physiological and quantitative experimental data allowed us to identify two phenotypically similar strains, designated OsHAK22-1 and OsHAK22-2, for subsequent experiments.
[0053] Table 3 Primer sequences used for identification of the effect of knockout of OsHAK22 by CRISPR-Cas9 system
[0054]
[0055] Example 4. Identification of the response of rice OsHAK22 to environmental stresses such as drought using RT-qPCR technology
[0056] To investigate the expression of the OsHAK22 gene throughout the entire growth period of rice, we extracted total RNA from samples of Nipponbare wild-type rice at different growth periods and in different tissues for RT-qPCR analysis. The quantitative primers are shown in Table 2 of Example 3. The experimental results showed that the OsHAK22 gene was highly expressed in rice leaves, sheaths, stems, palea, and inner and outer leaves throughout the growth period, while the expression level was lower in other parts of the rice, such as roots ( Figure 1 ).
[0057] To determine whether the expression of OsHAK22 is affected by low K + or drought stress, we used Nipponbare wild type material to make a low K + (0.05mM K + ), mannitol (120.4 g L -1Mannitol) and ABA (30uM ABA) at different time points, and normal nutrition (1mM K + ) as a control. RT-qPCR results showed that at low K + After 6 h of treatment, the expression of OsHAK22 in rice roots was upregulated by about 3 times compared with WT, while there was no significant difference in the aboveground part. + After 24 hours of treatment, the expression level in rice roots and aboveground parts increased by about 2 times; low K + At 72h of treatment, the expression of OsHAK22 in both the root and the aerial part of rice was significantly upregulated, reaching about 10 times that of WT, and there was no significant change at other time points ( Figure 2 AB). When treated with mannitol for 24 h, the expression of OsHAK22 in the root was significantly upregulated, about 15 times that of WT; when treated with mannitol for 72 h, the expression of OsHAK22 in the root was upregulated by about 5 times, and that in the aboveground part was upregulated by about 40 times, while there was no significant change after mannitol treatment for 6 h ( Figure 2 CD). We also observed that when treated with 30uM ABA for 24h, the expression of OsHAK22 in rice roots increased by about 10-fold, while there was no significant difference in the aboveground parts; when treated with 30uM ABA for 72h, the expression of OsHAK22 in both rice roots and aboveground parts increased by about 15-20-fold ( Figure 2 EF). The results showed that the expression of OsHAK22 in the aboveground part of rice was affected by low K + , mannitol and ABA stress induced upregulation.
[0058] At the same time, we used barrel-cultured seedlings at the booting stage under drought stress for 7 days and detected that the expression level of OsHAK22 in various tissues reached about 100 times that of WT ( Figure 3 ). This indicates that the expression of OsHAK22 is induced by environmental stresses such as drought.
[0059] Example 5 Water loss test of wild type and transgenic rice seedlings
[0060] We found through RT-qPCR that the expression of OsHAK22 is upregulated in response to drought and abscisic acid stress. To further explore the role of OsHAK22 in controlling rice tolerance to drought stress, we first conducted a water loss test at the rice seedling stage. 10-day-old transgenic and wild-type rice seedlings were exposed to 1 mM K + After culturing in IRRI nutrient solution for 4 weeks and then dehydrating for 4 h, when the leaves of OsHAK22 knockout materials were observed to be completely curled, the transgenic and wild-type rice seedlings were placed back into the medium containing 1 mM K +IRRI nutrient solution for 12 h, and then the survival rate of OsHAK22 overexpression, knockout and corresponding wild type rice seedlings were counted. The results showed that the survival rate of OsHAK22 overexpression lines after the resumption of water supply was significantly higher than that of wild type ( Figure 4 ), while the survival rate of OsHAK22 knockout lines after the resumption of water supply was only about 50% of the wild type ( Figure 4 ), indicating that OsHAK22 overexpression can enhance the drought stress tolerance of rice seedlings. Knockout will lead to increased sensitivity of rice seedlings to drought stress.
[0061] Example 6 Difference in performance of wild type and transgenic rice to drought stress
[0062] To further examine whether the overexpression material is resistant to drought stress environment (rice growth period is prone to drought stress) when naturally self-pollinated. First, prepare 20L barrels, each containing 19kg of mixed soil and river sand, and apply 12.5g of base fertilizer (N, P2O5 and K2O each 2g) for standby. 10-day-old OsHAK22 overexpression, knockout and Nipponbare wild type rice seedlings were cultured in normal nutrient solution for 2-4 weeks and then transplanted into the barrels, 3 seedlings per barrel. Drought stress treatment was started at the initial booting stage, and after 24h of resumption of water supply after all leaf curling of drought stress plants (this usually occurs at noon, when the soil water content is about 72-75%), the second round of drought stress treatment was carried out. The leaf curling degree of OsHAK22 overexpression, knockout and Nipponbare wild type rice under drought stress was observed and counted. The results showed that when rice was subjected to drought stress, the leaves of OsHAK22 overexpression material were completely stretched when the leaves of wild type rice were completely curled, and the leaves of OsHAK22 knockout material were completely stretched when the leaves of wild type rice were completely curled ( Figure 5 ). This indicates that OsHAK22 overexpression enhances the tolerance of rice to drought stress at the booting stage, while knockout leads to high sensitivity of rice to drought stress at the booting stage.
[0063] After two rounds of drought stress treatment, normal cultivation was continued until the rice was completely mature, and agronomic statistics were performed on OsHAK22 overexpression, knockout and Nipponbare wild type rice. The results showed that after drought stress, the relative yield of OsHAK22 overexpression lines was about 24% higher than that of wild type ( Figure 6 A-B), while the phenotype of OsHAK22 knockout material was opposite to that of overexpression lines, and OsHAK22 knockout led to a significant decrease in the relative yield of rice compared with wild type ( Figure 6 A-B). By detecting the K +The results showed that the K + The content was significantly higher than that of the wild type, about 12%, and the K content in the stems and sheaths of the knockout materials was + The content is significantly lower than that of the wild type, about 15% ( Figure 7 The above results showed that OsHAK22 overexpression enhanced the resistance of rice stems and leaf sheaths to K + The absorption of nutrient elements enhances the tolerance of rice to drought stress, ultimately leading to an increase in the relative yield of crops under drought stress.
Claims
1. Overexpression of the rice high-affinity potassium transporter gene OsHAK22 Use in regulating the tolerance of rice to drought stress, characterized in that The rice high affinity potassium ion transporter encoding gene OsHAK22 The CDS sequence is shown in SEQ ID NO.
1.
2. A method comprising encoding a rice high affinity potassium ion transporter gene according to claim 1 OsHAK22 Application of recombinant expression vector in improving rice tolerance to drought stress 。