A protein FH related to plant nodulation ability and its encoding gene and application

Abstract

The present invention discloses a protein FH associated with plant nodulation ability, its encoding gene, and its application. By reducing the expression level of the target gene FH or silencing the target gene FH in soybeans, soybean plants with high nodulation ability are cultivated. The cDNA sequence of the gene FH is shown in SEQ ID NO: 1. By reducing the expression level of the target gene FH or silencing the target gene FH in soybeans, the present invention cultivates soybean plants with high nodulation ability, and has broad practical application prospects in increasing the yield of legumes and reducing the use of chemical fertilizers.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, in particular to a protein FH related to plant nodulation ability, a coding gene thereof and an application thereof. Background Art

[0002] Soybean (Glycine max) is an important food and oil crop and a major source of high-quality protein. my country is a major soybean consumer, but its soybean supply relies primarily on imports. Therefore, increasing soybean yields is particularly important (Zhang et al., 2022). Nitrogen, phosphorus, and potassium are three essential nutrients for crop growth, with nitrogen being the primary and most demanded nutrient for crops (Ma and Chen, 2021).

[0003] Legumes and rhizobia have established a symbiotic relationship over a long period of evolution. Legumes form unique root nodules that symbiotically fix nitrogen. In agricultural production, this highly efficient symbiotic nitrogen fixation system can provide soybeans with 50%-60% of the total nitrogen required for growth and development.

[0004] The rhizobium-legume symbiotic nitrogen fixation system is a highly efficient nitrogen utilization system in nature. Understanding its operation has long been a hot topic and a challenge in scientific research. Identifying the functional genes involved in soybean nodulation and symbiotic nitrogen fixation is crucial for enhancing the symbiotic nitrogen fixation capacity of legumes, particularly soybean, a key grain and oil crop. This also opens up the possibility of reducing nitrogen fertilizer application and increasing soybean yields.

[0005] Formin genes are important actin nucleation factors. Studies have shown that Formin 8 (FH8) has multiple important physiological functions in non-legumes. However, there are currently no studies or reports on the involvement of the soybean FH gene in regulating soybean nodule number. Studying the molecular mechanisms by which the FH gene regulates soybean nodule formation and symbiotic nitrogen fixation will provide new genetic resources for improving soybean nitrogen fixation capacity, which is of great significance for ensuring national food security and promoting sustainable agricultural development. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a protein FH related to plant nodulation ability and its encoding gene and application.

[0007] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0008] Applications of FH protein in the following 1)-3):

[0009] 1) Regulate plant nodulation ability;

[0010] 2) Cultivate transgenic plants with high nodulation ability;

[0011] 3) Cultivate transgenic plants with low nodulation ability;

[0012] The FH protein is a1) or a2) or a3) or a4):

[0013] a1) the amino acid sequence is the protein shown in SEQ ID NO: 2;

[0014] a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein represented by SEQ ID NO: 2;

[0015] a3) a protein related to plant nodulation ability obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 2;

[0016] a4) a protein having 90% identity with the amino acid sequence shown in SEQ ID NO: 2, which is derived from soybean and is associated with plant nodulation ability.

[0017] Applications of FH protein-related biomaterials in the following 1)-3):

[0018] 1) Regulate plant nodulation ability;

[0019] 2) Cultivate transgenic plants with low nodulation ability;

[0020] 3) Cultivate transgenic plants with high nodulation ability;

[0021] The biological material is any one of the following A1) to A8):

[0022] A1) a nucleic acid molecule encoding the FH protein;

[0023] A2) an expression cassette containing the nucleic acid molecule described in A1);

[0024] A3) a recombinant vector containing the nucleic acid molecule described in A1);

[0025] A4) a recombinant vector containing the expression cassette described in A2);

[0026] A5) a recombinant microorganism containing the nucleic acid molecule described in A1);

[0027] A6) a recombinant microorganism containing the expression cassette described in A2);

[0028] A7) a recombinant microorganism containing the recombinant vector described in A3);

[0029] A8) A recombinant microorganism containing the recombinant vector described in A4).

[0030] Further preferably, the nucleic acid molecule in A1) is the gene shown in B1) or B2) or B3) or B4) below:

[0031] B1) cDNA molecule shown in SEQ ID NO: 1;

[0032] B2) a genomic DNA molecule corresponding to the cDNA molecule shown in SEQ ID NO: 1;

[0033] B3) a cDNA molecule or genomic DNA molecule that has 75% or more identity with the nucleotide sequence defined in B1) or B2) and encodes the FH protein of claim 1;

[0034] B4) A cDNA molecule or genomic DNA molecule that hybridizes under stringent conditions with the nucleotide sequence defined in B1) or B2) or B3) and encodes the FH protein according to claim 1.

[0035] m1. Substances that inhibit or reduce the activity or content of FH proteins in plants;

[0036] m2. A substance that inhibits or silences the expression of a nucleic acid encoding a FH protein in a plant, or a substance that knocks out a nucleic acid encoding a FH protein in a plant;

[0037] The FH protein is a1) or a2) or a3) or a4):

[0038] a1) the amino acid sequence is the protein shown in SEQ ID NO: 2;

[0039] a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein represented by SEQ ID NO: 2;

[0040] a3) a protein related to plant nodulation ability obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 2;

[0041] a4) A protein having 90% identity with the amino acid sequence shown in the sequence, derived from soybean and associated with plant nodulation ability.

[0042] A method for cultivating transgenic plants with high nodulation ability comprises the following steps: reducing the content and / or activity of the FH protein in a recipient plant to obtain a transgenic plant; the transgenic plant has a higher nodulation ability than the recipient plant.

[0043] Further preferably, the method for reducing the content and / or activity of the FH protein of claim 1 in the recipient plant is achieved by knocking out, inhibiting or silencing the gene encoding the FH protein of claim 1 in the recipient plant using RNAi technology.

[0044] Further preferably, the substance that silences the gene encoding the FH protein in the recipient plant is a nucleic acid molecule that interferes with the expression of the gene encoding the FH protein in the recipient plant;

[0045] Further preferably, the nucleic acid molecule that interferes with the expression of the gene encoding the FH protein in the recipient plant is SEQ ID NO: 10.

[0046] A nucleic acid molecule that interferes with the expression of the gene encoding the FH protein in a recipient plant, or an expression cassette, vector, or cell line containing the nucleic acid molecule, wherein the nucleic acid molecule is SEQ ID NO: 10.

[0047] A method for cultivating transgenic plants with low nodulation ability comprises the following steps: increasing the content and / or activity of the FH protein in a recipient plant to obtain a transgenic plant; the nodulation ability of the transgenic plant is lower than that of the recipient plant.

[0048] Further preferably, the method for increasing the content and / or activity of the above-mentioned FH protein in the recipient plant is to overexpress the FH protein in the recipient plant;

[0049] And / or, the overexpression method is to introduce the gene encoding the FH protein into the recipient plant.

[0050] More preferably, the plant is soybean.

[0051] The beneficial effect of adopting the above technical solution is that the theoretical research and experimental research of the research group of the present invention have confirmed that by reducing the expression level of the target gene FH in soybeans or silencing the target gene FH, soybean plants with high nodulation ability can be cultivated, which has broad practical application prospects in increasing the yield of legumes and reducing the application of chemical fertilizers. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1Schematic diagram of the analysis of the expression pattern of gene FH of the present invention, wherein: A is a schematic diagram of the histochemical localization of gene FH in the tip meristem of the root before rhizobium infection; B is a schematic diagram of the histochemical localization of gene FH at the outgrowth point of the lateral root before rhizobium infection; C is a schematic diagram of the histochemical localization of gene FH in the tip meristem of the root after rhizobium infection; D is a schematic diagram of the histochemical localization of gene FH in the nodule primordium after rhizobium infection; E is a schematic diagram of the histochemical localization of gene FH in the nodule after rhizobium infection; F is an enlarged schematic diagram of the black frame portion in Figure E; wherein the scale bars of Figures A, B, and C are 200 μm; the scale bars of Figures D and E are 500 μm; and the scale bar of Figure F is 200 μm;

[0053] Figure 2 The figure is a schematic diagram showing that down-regulating the expression of gene FH increases the number of nodules in hairy roots, wherein: A is a schematic diagram showing the expression of FH gene in hairy roots transformed with pK7GWⅡRR empty vector and pK7GWⅡRR-FH RNAi vector (FH-RNAi); B is a schematic diagram showing the display of hairy roots transformed with empty vector and FH-RNAi, with a scale of 1 cm; C is a statistical schematic diagram showing the number of nodules in hairy roots transformed with empty vector and FH-RNAi. DETAILED DESCRIPTION

[0054] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are conventional commercial products and can be directly obtained through commercial purchase. The experimental methods used in the following examples are all conventional methods unless otherwise specified.

[0055] It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of described features, integers, steps, operations, elements and / or components, but does not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components and / or collections thereof.

[0056] It will also be understood that the term "and / or" used in this specification and the appended claims refers to and includes any and all possible combinations of one or more of the associated listed items.

[0057] References to "one embodiment" or "some embodiments" in this specification mean that a particular feature, structure, or characteristic described in conjunction with that embodiment is included in one or more embodiments of the present application. Thus, phrases such as "in one embodiment," "in some embodiments," "in other embodiments," and "in other embodiments" appearing in various places in this specification do not necessarily refer to the same embodiment, but rather mean "one or more but not all embodiments," unless otherwise specifically emphasized. The terms "including," "comprising," "having," and variations thereof all mean "including but not limited to," unless otherwise specifically emphasized.

[0058] In addition, in the description of the present application specification and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the descriptions and cannot be understood as indicating or implying relative importance.

[0059] The following will be combined with specific embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0060] Example 1 Analysis of the expression pattern of soybean gene FH

[0061] (1) Construction of GUS expression vector

[0062] To study the expression pattern of the soybean gene FH, an expression vector containing a promoter sequence approximately 2235 bp upstream of the FH coding region fused to the reporter gene GUS was constructed. The vector construction process was as follows: genomic DNA of wild-type soybean Williams 82 was extracted, and primer pairs F2 and R2 were designed to amplify the promoter sequence. PCR amplification was performed using a DNA high-fidelity enzyme.

[0063] F2: TATATTATACAAAAATATTATT (SEQ ID NO.5);

[0064] R2: GAATGCTGAGGAACAAAGA (SEQ ID NO. 6);

[0065] The PCR reaction system was as follows: DNA template: 1 μL; F2: 2 μL; R2: 2 μL; buffer: 25 μL; ddH2O: 18 μL; dNTP: 1 μL; Polymerase: 1 μL; total reaction volume: 50 μL. Reaction conditions: 94°C: 2 min, 98°C: 20 s, 56°C: 30 s, 68°C: 2 min, 68°C: 10 min, 16°C: ∞; 39 cycles of 98°C: 20 s, 56°C: 30 s, and 68°C: 2 min were performed. Fifty μL of the PCR amplified product was analyzed by 1% agarose gel electrophoresis. The product was recovered and purified using a Tiangen Gum recovery kit. The resulting FH gene promoter sequence is 2235 bp, as shown in SEQ ID NO. 7. This sequence was inserted into the expression vector pBI121 fused with the reporter gene GUS to construct the pBI121-proFH-GUS plasmid.

[0066] (2) Hairy root transformation

[0067] Transient hairy root transformation of soybean seedlings (approximately one-week old) was performed using the pBI121-proFH-GUS plasmid. The following procedure was used: Agrobacterium rhizogenes K599 was transformed with the pBI121-proFH-GUS plasmid. Positive clones were cultured overnight to an OD value of approximately 0.6 and harvested by centrifugation. The cells were then resuspended in 2 mL of ddH2O, 20 μL of 1 M MgCl2, and 20 μL of 1 M MES in a shaker at 28°C / 200 rpm. The bacterial suspension was injected into the lower cotyledons of approximately one-week-old soybean seedlings using a syringe. Hairy roots should develop after approximately two weeks. Seedlings that had developed hairy roots were cut cleanly and soaked in water for 3-5 days before being transferred to a clean vermiculite-filled pot. After 3-5 days of incubation, the seedlings were inoculated with a bacterial solution of rhizobium USDA110 at an OD value of 0.05. Seedlings not inoculated with rhizobium served as controls. On the 21st day after inoculation, hairy roots were harvested for GUS staining.

[0068] (3) Expression pattern analysis

[0069] The results of tissue staining showed that the gene FH was expressed in the tip meristem and outgrowth points of lateral roots before inoculation with rhizobia as the control (e.g. Figure 1 A and B); after inoculation with rhizobia, gene FH was not only expressed in the tip meristem and nodule primordium of soybean roots, but also highly expressed in nodules (e.g. Figure 1 (in CF).

[0070] Example 2 Cloning of FH gene cDNA sequence

[0071] RNA was extracted from wild-type soybean Williams 82 and reverse transcribed into single-stranded DNA. The cDNA sequence of gene FH was amplified using forward primer F3 and reverse primer R3 using the sequence as a template, and then PCR amplified using DNA high-fidelity enzyme.

[0072] F3: gagaaaattgaatacacctg (SEQ ID NO.8);

[0073] R3: aatgcaaaagcacacactg (SEQ ID NO.9);

[0074] The PCR reaction system was as follows: cDNA template: 3 μL; F3: 2 μL; R3: 2 μL; buffer: 25 μL; ddH2O: 16 μL; dNTPs: 1 μL; Polymerase: 1 μL; total reaction volume: 50 μL. Reaction conditions: 94°C: 2 min, 98°C: 20 s, 56°C: 30 s, 68°C: 2 min, 68°C: 10 min, 16°C: ∞; 39 cycles of 98°C: 20 s, 56°C: 30 s, and 68°C: 2 min were performed. Fifty μL of the PCR product was analyzed by 1% agarose gel electrophoresis. The product was purified using a Tiangen Gum recovery kit. The resulting FH gene cDNA sequence is 2898 bp, as shown in SEQ ID NO. 1. The FH protein consists of 804 amino acids, and its sequence is shown in SEQ ID NO. 2.

[0075] Example 3: Reducing FH gene expression significantly increases nodule number

[0076] (1) Construction of RNAi vector

[0077] Using the FH cDNA obtained in Example 2 as a template, PCR amplification was performed using a primer pair consisting of F1 and R1 to obtain a PCR amplification product, the sequence of which is shown in SEQ ID NO.10.

[0078] F1: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGCACAACCAAAGCCACAAGC (SEQ IDNO.3);

[0079] R1: GGGGACCACTTTGTACAAGAAAGCTGGGTTTCCCTTCCATTCTCTTGAACACGT (SEQ IDNO.4);

[0080] The recovered product of SEQ ID NO. 10 was ligated with the intermediate vector pDonor221 via BP reaction (Invitrogen 11789-020) to obtain the recombinant plasmid pDonor221-FH. The plasmid pDonor221-FH was ligated with the final vector pK7GWIIRR via LR reaction (Invitrogen 11791-020) to obtain the recombinant plasmid pK7GWIIRR-FH.

[0081] (2) Obtaining transgenic hairy roots

[0082] Agrobacterium rhizogenes K599 was transformed with the pK7GWⅡRR-FH plasmid. Positive clones were selected and cultured overnight to an OD of approximately 0.6, then harvested by centrifugation. The cells were then resuspended in 2 mL of ddH2O, 20 μL of 1 M MgCl2, and 20 μL of 1 M MES, shaken at 28°C / 200 rpm. The bacterial solution was injected into the cotyledons of approximately one-week-old soybean seedlings using a syringe. Hairy roots should develop after approximately two weeks. Soybean seedlings with hairy roots were cut cleanly and soaked in water for 3-5 days before being transferred to a clean culture pot filled with vermiculite. After 3-5 days of incubation, the seedlings were inoculated with a culture solution of the rhizobium USDA110 strain at an OD of 0.05. Seedlings left uninoculated served as controls. Twenty-one days after inoculation, hairy roots were harvested for FH expression analysis and nodule number counting.

[0083] (3) Phenotypic analysis

[0084] RNA was extracted from hairy roots using TriZol reagent (Thermo), reverse transcribed into single-stranded DNA, and qRT-PCR was performed using the following primers.

[0085] F4:GGTTCTTTCAGGGTTGATGATG (SEQ ID NO.11);

[0086] R4: CCAGAGACTTCAAAACAATA (SEQ ID NO.12);

[0087] The relative expression levels of genes in hairy roots transformed with pK7GWⅡRR empty vector and pK7GWⅡRR-FH RNAi vector were statistically analyzed, and it was found that the expression level of gene FH was significantly decreased (e.g. Figure 2 The number of nodules on each hairy root was counted and it was found that the number of nodules in the FH RNAi material was significantly more than that in the control group ( Figure 2 B, C), indicating that down-regulating the expression of FH gene can enhance the nodulation ability of soybean, showing great application prospects.

[0088] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to these examples without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

[0089] In the above embodiments, the description of each embodiment has its own focus. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant description of other embodiments.

[0090] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. These modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention, and should all be included in the scope of protection of the present invention.

Claims

1. Application of FH protein in increasing the number of soybean nodules, achieved by inhibiting or silencing the expression of FH protein encoding nucleic acid in soybean or knocking out FH protein encoding nucleic acid in soybean, wherein the FH protein is a1) or a2): a1) the amino acid sequence is the protein shown in SEQ ID NO: 2; a2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein represented by SEQ ID NO:

2.

2. Application of FH protein-related biomaterials in reducing soybean FH gene expression and increasing soybean nodule number: The biological material is any one of the following A1) to A8): A1) a nucleic acid molecule such as a cDNA molecule shown in SEQ ID NO: 1; A2) an expression cassette containing the nucleic acid molecule described in A1); A3) a recombinant vector containing the nucleic acid molecule described in A1); A4) a recombinant vector containing the expression cassette described in A2); A5) a recombinant microorganism containing the nucleic acid molecule described in A1); A6) a recombinant microorganism containing the expression cassette described in A2); A7) a recombinant microorganism containing the recombinant vector described in A3); A8) A recombinant microorganism containing the recombinant vector described in A4).

3. A method for cultivating a transgenic plant with high nodulation ability, comprising the following steps: reducing the content of the FH protein of claim 1 in a recipient plant to obtain a transgenic plant; the transgenic plant has a higher nodulation ability than the recipient plant; and the plant is soybean.

4. The method according to claim 3, wherein: The method for reducing the content of the FH protein of claim 1 in the recipient plant is achieved by knocking out, inhibiting or silencing the gene encoding the FH protein of claim 1 in the recipient plant using RNAi technology; The substance for silencing the gene encoding the FH protein in the recipient plant is a nucleic acid molecule that interferes with the expression of the gene encoding the FH protein in the recipient plant; The nucleic acid molecule that interferes with the expression of the gene encoding the FH protein in the recipient plant is SEQ ID NO: 10.

Images