Application of Blautia in nervous system diseases / anxiety diseases

Abstract

The invention relates to an application of Blautia in nervous system diseases / anxiety diseases. According to the application, 16S rRNA sequencing is carried out on the intestinal flora of healthy people and anxiety people, it is found that certain difference exists between the intestinal flora of the anxiety people and the intestinal flora of the healthy people, and the abundance and diversity of microbial species in the intestinal tract of the anxiety patient are remarkably lower than those of the healthy people. Further performing PCoA and NMDS analysis on a sequencing result to find that community compositions of fecal florae of anxiety patients and healthy people have differences, and species composition analysis finds that intestinal florae of anxiety people are different from those of healthy people in phylum, outline, eye, family, genus and species, and the intestinal florae are mainly represented by low Blauria, low Blauria, low Blauria, low Blauria, low Blauria, low Blauria, low Blauria, low Blauria, low Blauria, low Blauria, low Blauria, low By combining a community Heatmap and species difference analysis, it is clear that Blautia is a characteristic species and can serve as an intestinal flora target for treating anxiety, up-regulation of the Blautia level is beneficial to improvement of anxiety, and a new thought is provided for treatment of anxiety.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to the application of Blautia in nervous system diseases / anxiety diseases and new drug development. Background Art

[0002] Anxiety is a disease with both psychological and physiological symptoms. It is the most common psychological disease in life. It affects the quality of life of individuals and also places a huge economic burden on the patient's family. At present, the main treatments for anxiety diseases include psychotherapy and drug therapy. Psychotherapy mainly includes cognitive behavioral therapy and supportive psychotherapy, and drug therapy includes benzodiazepines. Non-benzodiazepines There are many types of antianxiety drugs and antidepressants. However, psychotherapy has a long treatment cycle, poor patient adaptability, and high requirements for treatment. Drug treatment also has disadvantages such as easy patient dependence, strong side effects, and unstable efficacy. Therefore, it is of great research significance to explore the pathogenesis of anxiety diseases and develop new therapeutic targets and drugs for different pathogenesis. It is reported that anxiety can cause changes in the intestinal flora of patients, and intestinal microorganisms play an important role in the pathogenesis of anxiety. More and more studies at home and abroad have shown that some probiotics have anti-anxiety medicinal value and can improve the host's anxiety symptoms by secreting functional metabolites. However, due to the inherent complexity and functional diversity of the intestinal flora, the current elucidation of the behavioral regulation effect and mechanism at the strain level is still very limited, and the role of specific strains in the neural and behavioral regulation of individual organisms is still unclear.

[0003] Our study found that the biodiversity of the intestinal flora of anxious patients was significantly lower than that of healthy people. Compared with healthy subjects, the intestinal flora of anxious patients had a lower abundance of Blautia. After drug treatment, the Blautia level increased significantly. Further analysis results showed that the intestinal microecology of anxious patients may be affected by the gut-brain-microbiome axis, and the Blautia flora may be the key flora for the treatment of anxiety patients. Therefore, we propose that by upregulating the level of Blautia in patients with anxiety, it can bring certain benefits to improve the anxiety symptoms of such patients.

[0004] Blautia is a genus of Gram-positive obligate anaerobic bacteria belonging to the Lachnospiraceae family, one of the main taxa of the human gut microbiota. They degrade complex polysaccharides into short-chain fatty acids, including acetate, butyrate, and propionate, which can be used as energy by the host. Blautia has attracted widespread attention as a new functional genus with potential probiotic properties. Blautia has shown positive effects in some diseases, such as type 2 diabetes, hypercholesterolemia, Alzheimer's disease, schizophrenia, breast cancer, etc.

[0005] In recent years, the role of intestinal flora in alleviating emotional abnormalities has been increasingly valued. At present, there is a lack of probiotic preparations for anxiety diseases in China. Based on this, it is of great significance to develop intestinal microbial preparations for the treatment of anxiety with good efficacy, low side effects and good tolerability by studying the potential use of intestinal flora Blautia in anti-anxiety effects. Summary of the invention

[0006] The purpose of the present invention is to provide the use of Blautia in treating nervous system diseases / anxiety diseases and preparing intestinal microbial preparations, so as to overcome the problem that there is still a lack of a proprietary intestinal microecological preparation for the treatment of anxiety disorders. Technical solution: The purpose of the present invention is achieved through the following technical solution:

[0007] The present invention uses anxiety patients who meet the inclusion and exclusion criteria as research subjects (n≥6), and collects their fecal specimens for intestinal flora analysis, including total DNA extraction, PCR amplification and 16S rRNA sequencing. It is found that there are certain differences between the intestinal flora of anxious people and healthy people. The types of intestinal flora in anxious patients are significantly lower than those in normal people, and the abundance and diversity of microbial species in the intestines of anxious patients are significantly lower than those in healthy people. Further PCoA and NMDS analysis of the sequencing results found that there are differences in the community composition of fecal flora in anxious patients and healthy people. Species composition analysis found that the intestinal flora of anxious people is different from that of healthy people in terms of phylum, class, order, family, genus and species, which is mainly manifested in low Blautia at the genus level. Combining the community Heatmap diagram and species difference analysis, Blautia is clearly a characteristic species. Blautia bacteria can be used as a target for intestinal flora treatment of anxiety, by reducing the scores in the Hamilton Depression Rating Scale (HAMD) and the Hospital Anxiety and Depression Scale (HAD), and increasing the level of Blautia is conducive to improving anxiety behavior, and can be used to prevent and treat anxiety.

[0008] The present invention provides a method for extracting and analyzing intestinal flora Blautia in patients with anxiety diseases, which is as follows: Total DNA extraction: using a kit Spin Kit for Soil was used to extract intestinal flora DNA, NanoDrop2000 was used to detect DNA purity and concentration, and 1% agarose gel electrophoresis was used to detect DNA integrity, with the voltage set at 5 V / cm and the time set at 20 min.

[0009] Quantitative PCR method: Primers (upstream primer 338F: ACTCCTACGGGAGGCAGCAG; downstream primer 806R: GGACTACHVGGGTWTCTAAT) were used to amplify the V3-V4 region fragment of bacterial 16SrRNA. The PCR reaction system was: PCR amplification system: 5×FastPfu Buffer 4μL, 2.5mM dNTPs 2μL, upstream primer (5μM) 0.8μL, downstream primer (5μM) 0.8μL, FastPfu DNA Polymerase 0.4μL, BSA 0.2μL, genomic DNA 10ng, supplemented with ddH2O to 20μL. PCR amplification conditions: pre-denaturation 95℃ 3min, denaturation 95℃ 30s, annealing **℃ 30s, extension 72℃ 45s, cycle number 30, stable extension 72℃ 10min, 10℃ storage until the end of the reaction. The PCR products were detected by 2% agarose gel electrophoresis. The PCR products were quantitatively analyzed by Quantus TM Fluorometer is used for detection and quantification. According to the sequencing amount requirements of each sample, the corresponding proportions are mixed.

[0008] The present invention found that at the class level, the intestinal flora of anxious patients is mainly characterized by high Bacilli and low Clostridia and Bacteroidia, and the three orders are significantly different from healthy people. Clostridia and Bacteroidia may be the main orders that cause anxiety, and high abundance is harmful. At the order level, the abundance of Bacteroidales and Oscillospirales in the intestinal flora of anxious patients is significantly reduced, and the abundance of Lactobacillales is significantly increased. These three orders are significantly different from healthy people and may be the key flora that cause anxiety. At the family level, the level of Lachnospiraceae in the intestines of anxious patients is suppressed, and high levels of Lachnospiraceae may bring benefits to anxious patients.

[0009] By implementing the specific inventive content of the present invention, the following effects can be achieved:

[0010] The present invention uses anxiety patients who meet the tolerance criteria as research subjects, collects their stool specimens for 16SrRNA sequencing analysis, and identifies Blautia as a target of intestinal flora for treating anxiety. The application of intestinal flora Blautia in the preparation of intestinal microbial products has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0012] Figure 1 Evaluate the treatment effect of patients

[0013] Figure 2 Effects of flupentixol and melitracen on intestinal microbial diversity index in patients with anxiety

[0014] Figure 3 Venn diagram for OUT classification level and PCoA and NMDS analysis

[0015] Figure 4 Effects of flupentixol-melitracen tablets on the intestinal flora structure of anxious patients after intervention (A. phylum B. class C. order D. family E. genus F. species)

[0016] Figure 5 Analysis of species differences among experimental groups (A. Phylum B. Class C. Family D. Order E. Genus F. Species)

[0017] Figure 6 Species analysis of intestinal flora of anxious patients at different taxonomic levels ('+' indicates positive regulation)

[0018] Figure 7 LEfSe multi-level species difference discriminant analysis (A. Heatmap, B. LDA) DETAILED DESCRIPTION

[0019] The technical solution of the present invention is described in detail below through specific embodiments, but the protection scope of the present invention is not limited to the embodiments.

[0020] Instruments and equipment: centrifuge (Eppendorf, Germany), ultra-micro spectrophotometer (Thermo Fisher Scientific, USA), electrophoresis instrument (Beijing Liuyi Instrument Factory, China), PCR instrument (ABI, USA), sequencer (Illumina, USA), microplate reader (Biotek, USA), microfluorimeter (Promega, USA).

[0021] Experimental drug: Flupentixol-melitracen tablets (batch number: 2725451, manufacturer: H.Lundbeck A / S). DNA extraction kit ( Spin Kit for Soil, MP Biomedicals, USA), agarose (biowest agarosebiowest, Spain), FastPfu Polymerase (TransGen, China), AxyPrep DNA Gel ExtractionKit (Axygen Biosciences Axygen, USA), Rapid DNA-Seq Kit (Bioo Scientific, USA).

[0022] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0023] Example 1

[0024] 1. Collection of Fecal Samples

[0025] 1.1 Case source. Anxiety patients who visited our hospital from January 2022 to June 2023 were selected. After communication, they signed informed consent and performed anxiety scoring. Patients who met the diagnosis of anxiety disorder were enrolled.

[0026] 1.2 Grouping and administration. Six patients with HAMA score ≥14 and HAD score ≥11 were enrolled as the observation group. Six healthy adults were enrolled as the normal control group. All enrolled cases must meet the inclusion and exclusion criteria. Observation group: Flupentixol-melitracen tablets 10 mg (po bid), the course of treatment is 4 weeks. Control group: no drug treatment.

[0027] 1.3 Stool collection. Stool specimens were collected from the observation group before the first administration of flupentixol-melitracen tablets, numbered CK1-6; stool specimens were collected again within 12-24 hours after the last administration, numbered FPMLT1-6. Healthy subjects were educated and stool specimens were collected once in the fourth week, numbered CON1-6. Stool specimens were stored in liquid nitrogen tanks for inspection.

[0028] 2. Extraction and Detection of Blautia from Intestinal Flora

[0029] 2.1 Analysis of intestinal flora

[0030] 2.2.1 Total DNA extraction. Follow the DNA extraction kit The intestinal flora DNA was extracted according to the instructions of Spin Kit for Soil to obtain total DNA. The purity and concentration of DNA were tested by NanoDrop2000, and the integrity of DNA was tested by 1% agarose gel electrophoresis, with the voltage set at 5 V / cm and the time set at 20 min.

[0031] 2.2.2 PCR amplification and Illumina sequencing. Primers (upstream primer 338F: ACTCCTACGGGAGGCAGCAG; downstream primer 806R: GGACTACHVGGGTWTCTAAT) were used to amplify the V3-V4 region fragment of bacterial 16s rRNA. The PCR reaction system was: PCR amplification system: 5×FastPfu Buffer 4μL, 2.5mM dNTPs 2μL, upstream primer (5μM) 0.8μL, downstream primer (5μM) 0.8μL, FastPfu DNA Polymerase 0.4μL, BSA 0.2μL, genomic DNA 10ng, supplemented with ddH2O to 20μL. PCR amplification conditions: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, 27 cycles, stable extension at 72°C for 10 min, and storage at 10°C until the end of the reaction. PCR products were detected by 2% agarose gel electrophoresis. The PCR products were quantitatively analyzed by Quantus TM Fluorometer is used for detection and quantification. According to the sequencing amount requirements of each sample, the corresponding proportions are mixed.

[0032] 2.2.3 Use The library was constructed using Rapid DNA-Seq Kit, and sequencing was performed using Illumina's Miseq PE300 platform.

[0033] 3. Results and Analysis

[0034] 3.1 Comparison of clinical data and efficacy after treatment. The Hamilton Depression Rating Scale (HAMD) and the Hospital Anxiety and Depression Scale (HAD) were used to score the patient's condition. The 6 patients enrolled had HAMD scale scores between 32-42 points, HAD scale scores between 25-32 points, and showed obvious anxiety. After 4 weeks of treatment with flupentixol-melitracen, the 6 patients had HAMD scale scores between 8-16 points, and HAD scale scores between 10-17 points. The HAMD scale score result changed from "obvious depression or anxiety" to "may have depression or anxiety", but it has not yet reached the normal score range; the HAD scale score result is still "may have obvious depression or anxiety", but the score is significantly lower than before. Results are shown in. Figure 1 .

[0035] 3.3 Effects of flupentixol-melitracen on the abundance and alpha diversity of intestinal flora in anxious patients. Using the IIIumina Miseq sequencing platform, the diversity data analysis of 18 samples was completed, and a total of 1333788 optimized sequences, 557742075 bases, and an average sequence length of 418 bp were obtained. Species annotation results statistics: 13 bacterial phyla, 21 bacterial classes, 58 bacterial orders, 112 bacterial families, 305 bacterial genera, 624 bacterial species, and 1553 OTUs. Alpha diversity refers to the diversity of species in a specific area or ecosystem. The Shannon and Simpson indices can be used to evaluate the diversity of OTUs in the community. The sob, ace, chao, and Shannon indices of the CON group were significantly higher than those of the CK group (P<0.05), and the Simpson index of the CK group was significantly higher than that of the CON group (P<0.05). There was an improvement trend after FPMLT intervention. The larger the Shannon index, the higher the biodiversity; while the larger the Simpson index, the lower the diversity. The results showed that the abundance and diversity of intestinal microorganisms in anxious patients were significantly lower than those in healthy people, and the intervention of flupentixol and melitracen could increase the abundance and diversity of intestinal microbial species in anxious patients to a certain extent. Figure 2 .

[0036] 3.3.1 Species Venn analysis. The Venn diagram was subsequently analyzed, and the number of bacterial species OTUs in common among the CON group, CK group, and FPMLT group was 217. The number of intestinal bacterial species OTUs in the CON group was 875, the number of OTUs in the CK group was 95, and the number of OTUs in the FPMLT group was 81. The results showed that the number of intestinal bacterial species in anxious patients was significantly lower than that in normal people, indicating that the intestinal microecology of anxious patients may be affected by the gut-brain-microbiota axis. The number of bacterial species OTUs in common between the CON group and the CK group was 38, and the number of bacterial species OTUs in common between the FPMLT group and the CON group increased to 142, indicating that flupentixol and melitracen can adjust the intestinal flora species of anxious patients to a certain extent, making them tend to be normal, see Figure 3 A.

[0037] 3.3.2 PCoA and NMDS analysis. There is no obvious distinction between the experimental groups on the PCA graph. We further analyzed with PCoA and NMDS. From a one-dimensional and multi-dimensional perspective, we can see that the CON group is clearly separated from the CK group, indicating that there are differences in the community composition of fecal flora between anxious patients and healthy people. This is consistent with the previous results. This difference can provide a certain reference for the treatment of clinical anxiety. There are slight differences between the FPMLT group and the CK group, and there are signs of improvement. Results are shown in Figure 3 Medium B and C.

[0038] 3.3.3 Species composition analysis. In order to further explore the specific effects of penthiothixol-melitracen tablets on the intestinal flora of anxious patients, we further studied the composition characteristics of the top 10 bacterial communities in relative abundance at different classification levels, such as Figure 4 As shown in Figure 2, at different taxonomic levels, the intestinal flora of anxious patients was significantly different from that of healthy subjects. After intervention with flupentixol-melitracen tablets, the structure of the intestinal flora of anxious patients was changed. At the phylum level, the CK group was significantly different from the CON group with low abundance of Bacteroidota as the main feature. Flupentixol-melitracen tablets had a certain degree of improvement after treatment, see Figure 5 A. At the class level, compared with the CON group, the abundance of Bacilli in the CK group was significantly higher (P < 0.05), and Clostridia and Bacteroidia were significantly lower (P < 0.05). The abundance of Bacilli in the FPMLT group decreased, and the abundance of Clostridia increased. Figure 5 B; At the order level, compared with the CON group, the abundance of Bacteroidales and Oscillospirales in the CK group was significantly reduced (P < 0.01), and the abundance of Lactobacillales was higher (P < 0.05). Figure 5 D. At the family level, compared with the CON group, the abundance of Lachnospiraceae, Prevotellaceae, and Ruminococcaceae in the CK group decreased (P < 0.05), and the abundance of Enterococcaceae increased (P < 0.05). The abundance of Lachnospiraceae in the FPMLT group showed an increasing trend, as shown in Figure 2. Figure 5 C. At the genus level, the abundances of Prevotella, Blautia, and Faecalibacterium in the CK group decreased (P < 0.05), the abundance of Enterococcus increased, and the abundance of Blautia in the FPMLT group increased significantly (P < 0.05). Figure 5 E. At the species level, compared with the CON group, the abundances of s_metagenome_g_Prevotella, s_Faecalibacterium_prausnitzii, and s_unclassified_g_Blautia in the CK group were all decreased (P < 0.05), the abundance of s_Enterococcus_faecium_g_Enterococcus increased, and the abundance of s_unclassified_g_Blautia in the FPMLT group was significantly increased (P < 0.05), see Figure 5 F.

[0039] In summary, the intestinal flora of anxious people are different from those of healthy people in terms of phylum, class, order, family, genus, and species. Changes in these flora may be the key factors causing anxiety in the intestine. After taking flupentixol-melitracen tablets for 4 weeks, the intestinal flora of anxious people changed, mainly manifested in low Bacilli at the class level, high Lachnospiraceae at the family level, high Blautia at the genus level, and high s_unclassified_g_Blautia at the species level. These four flora may be the key flora for treating anxious patients, see Figure 6 .

[0040] 3.3.4 Community Heatmap. In order to further identify the changes in fecal microbial communities in anxious patients before and after medication, the experiment drew a Heatmap of the top 50 species in total abundance. Heatmap uses color changes to reflect the data information in a two-dimensional matrix or table. It can intuitively represent the size of the data value with a defined color depth. By clustering high-abundance and low-abundance species in blocks, the color gradient and degree of similarity are used to reflect the similarities and differences in the community composition of multiple samples at each classification level. From the Heatmap, it can be seen that the correlation ranges from -0.60 to 0.70. There are differences between the CK group and the CON group, and the FPMLT group and CON are more similar in composition. See Figure 7 A.

[0041] 3.3.5 Species difference analysis. Linear discriminant analysis (LDA), combined with effect size measurement, identified characteristic taxa with significant differences in abundance. Blue represents the CON group, red represents the CK group, and green represents the FPMLT group. The evolutionary branch diagram shows that the fecal microbial communities among the groups are relatively different at all taxonomic levels. LEfSe analysis showed that there were 15 biomarker classifications in the CK group and 23 biomarker classifications in the FPMLT group. Among them, Bacilli and Enterococcaceae were the characteristic species of the CK group. Clostridia and Bacteroidota were the characteristic species of the CON group. Lactobacillaceae, Streptococcaceae and Blautia were the characteristic species of FPMLT, see Figure 7 B. The classification of these biomarkers can be investigated as gut microbiota targets for flupentixol-melitracen treatment of anxiety.

Claims

1. Application of Blautia in neurological diseases / anxiety disorders: It is characterized by Blautia can be used as a key target for the treatment of anxiety and can be made into probiotic products to improve anxiety, depression or regulate mood. The dosage form is an oral preparation, including tablets, capsules, granules, powders, suspensions and pills.

2. A drug for treating nervous system diseases / anxiety disorders, characterized in that Its active ingredient is Blautia.

3. A drug for treating nervous system diseases / anxiety disorders, characterized in that Its active ingredient contains Blautia.

Images