Five-fold real-time fluorescence quantitative PCR detection kit and detection method for simultaneously detecting five parasites

Abstract

The present invention discloses a five-fold real-time fluorescence quantitative PCR detection kit and a detection method for simultaneously detecting five parasites, belonging to the field of biological detection technology. The method and the kit provided by the present invention can be used to simultaneously detect Toxoplasma gondii, Neospora, Eimeria stuartii, Giardia lamblia and Trypanosoma evansi in the same system, and have the characteristics of qualitative and quantitative detection, high sensitivity, strong specificity, good repeatability and good stability.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and specifically relates to a five-fold real-time fluorescence quantitative PCR detection kit and a detection method for simultaneously detecting five parasites, and more particularly to a five-fold probe method real-time fluorescence quantitative PCR detection kit, a detection method and a special detection primer and probe combination for simultaneously detecting Toxoplasma gondii, Neospora, Eimeria skrjabini, Giardia lamblia and Trypanosoma evansi in the same system. Background Art

[0002] Toxoplasma gondii, Neospora caninum, Eimeria stiedai, Giardia lamblia, and Trypanosoma evansi are ubiquitous parasitic pathogens worldwide, with sheep, cattle, pigs, and rabbits considered intermediate hosts. Toxoplasma gondii can cause disease in humans, with clinical outcomes ranging from asymptomatic presentation to eye disease, reproductive failure, and neurological symptoms. Neospora infection is an important cause of miscarriage. Eimeria caninum infection can cause hepatic coccidiosis. Giardia lamblia enteritis is a gastroenteritis caused by the pathogenic protozoan Giardia lamblia. Trypanosoma evansi is a pathogenic protozoan present in animal plasma and hematopoietic organs that causes Surra, one of the most important animal diseases in Asia and South America. Parasitic infections are an important factor affecting the sheep, cattle, pig, and rabbit farming industries, causing huge economic losses. Effective management and control of parasitic infestations on farms depends on early detection.

[0003] Despite its low sensitivity, microscopy remains the main diagnostic method for parasites in resource-limited settings. Serological diagnostic tests for parasitic infections are characterized by low specificity. A common nucleic acid-based detection method is the polymerase chain reaction (PCR), which has become the gold standard for monitoring parasites due to its high sensitivity and the availability of commercial kits. However, traditional agarose gel electrophoresis and screening of PCR amplification products are time-consuming, labor-intensive, cumbersome, and labor-intensive. In addition, traditional PCR methods are prone to contamination due to opening tubes and are easily affected by inhibitors that may be present in sheep, cattle, pigs, and rabbit samples.

[0004] With the development of molecular biology technology, real-time fluorescence PCR has become the preferred tool for laboratory diagnosis of parasitic infections. In particular, real-time fluorescence quantitative PCR technology based on TaqMan probes is an accurate, sensitive and rapid method for detecting and quantifying target genomes. This method is based on the continuous determination of fluorescent signals during the amplification reaction and has been used to detect many parasites, including Toxoplasma gondii, Neospora, Giardia lamblia and Trypanosoma evansi. For example, methods or kits for detecting Toxoplasma gondii, Neospora, Giardia lamblia and Trypanosoma evansi by single-plex real-time fluorescent quantitative PCR based on TaqMan probes have been reported (Mousavi P, et al. (2018). Detection of Toxoplasma gondii in acute and chronic phases of infection in immunocompromised patients and pregnant women with real-time PCR assay using TaqMan fluorescent probe. Iran J Parasitol. 13(3): 373-381. Bandelj P, et al. (2023). First molecular detection of Neospora caninumin feces of Grey Wolf (Canis lupus) and Golden Jackal (Canisaureus) populations in Slovenia. Animals (Basel). 13(19): 3089. doi: 10.3390 / ani13193089). However, the traditional single-plex real-time fluorescence quantitative PCR method based on TaqMan probe is time-consuming and expensive to detect multiple parasites in the same sample. With the development of this technology, multiplex real-time fluorescence quantitative PCR based on TaqMan probe is based on the use of target gene-specific TaqMan probes to simultaneously detect multiple target genes through a single reaction. The multiplex real-time fluorescence quantitative PCR technology based on TaqMan probe can detect multiple parasites in a closed tube at the same time, and has the advantages of high throughput, fast detection speed, simple operation, low contamination risk, and low detection cost. For example, the prior art has reported a method for detecting Toxoplasma gondii and Neospora by dual fluorescence quantitative PCR based on TaqMan probes (Truong M, J. (2023). Analytical sensitivity of a multiplex quantitative PCR for Toxoplasmagundii and Neospora caninum. Parasitol Res. 122(4):1043-1047.doi:10.1007 / s00436-023-07796-5).

[0005] However, there are currently no five-plex TaqMan probe-based real-time fluorescence quantitative PCR detection methods and related detection products that can simultaneously detect Toxoplasma gondii, Neospora, Eimeria skrjabini, Giardia lamblia and Trypanosoma evansi in the same detection system. Summary of the invention

[0006] In view of one or more of the problems existing in the prior art, the present invention analyzes the gene structure sequences of the published reference strains of Toxoplasma gondii, Neospora, Eimeria stuartii, Giardia lamblia and Trypanosoma evansi, respectively designs specific primers and probes, and performs system optimization and verification, and finally establishes a novel TaqMan probe five-fold real-time fluorescence quantitative PCR detection method that can simultaneously detect the above five parasites in a closed test tube (i.e., in the same reaction system). The method has high sensitivity and specificity, and has no cross-reaction with other parasite genomes. In addition, the method can also accurately identify Toxoplasma gondii, Neospora, Eimeria stuartii, Giardia lamblia and Trypanosoma evansi in different matrices. Therefore, this method can be applied to diagnosis, monitoring and epidemiology, and thus also provides a novel TaqMan probe five-fold real-time fluorescence quantitative PCR detection kit for the above five parasites and its special primers and probe sets. The present invention is mainly implemented by the following technical solutions.

[0007] In a first aspect, the present invention provides a five-fold real-time fluorescence quantitative PCR primer and TaqMan probe combination, which is used to simultaneously detect Toxoplasma gondii, Neospora, Eimeria stuartii, Giardia lamblia and Trypanosoma evansi in the same system, wherein the five-fold real-time fluorescence quantitative PCR primer and TaqMan probe combination comprises:

[0008] Real-time fluorescent quantitative PCR primers and TaqMan probes for detecting Toxoplasma gondii, comprising: a forward primer GZQTgG3PDH-F having a nucleotide sequence as shown in SEQ ID NO: 1, a reverse primer GZQTgG3PDH-R having a nucleotide sequence as shown in SEQ ID NO: 2, and a TaqMan probe GZQTgG3PDH-P having a nucleotide sequence as shown in SEQ ID NO: 3;

[0009] Real-time fluorescent quantitative PCR primers and TaqMan probes for detecting neospora, comprising: a forward primer GZQNcNC5-F having a nucleotide sequence as shown in SEQ ID NO:4, a reverse primer GZQNcNC5-R having a nucleotide sequence as shown in SEQ ID NO:5, and a TaqMan probe GZQNcNC5-P having a nucleotide sequence as shown in SEQ ID NO:6;

[0010] Real-time fluorescent quantitative PCR primers and TaqMan probes for detecting Eimeria skrjabini, comprising: a forward primer GZQEsADF-F having a nucleotide sequence as shown in SEQ ID NO:7, a reverse primer GZQEsADF-R having a nucleotide sequence as shown in SEQ ID NO:8, and a TaqMan probe GZQEsADF-P having a nucleotide sequence as shown in SEQ ID NO:9;

[0011] Real-time fluorescent quantitative PCR primers and TaqMan probes for detecting Giardia lamblia, comprising: a forward primer GZQG1GDH-F having a nucleotide sequence as shown in SEQ ID NO: 10, a reverse primer GZQG1GDH-R having a nucleotide sequence as shown in SEQ ID NO: 11, and a TaqMan probe GZQG1GDH-P having a nucleotide sequence as shown in SEQ ID NO: 12;

[0012] Real-time fluorescent quantitative PCR primers and TaqMan probes for detecting Trypanosoma evansi, comprising: a forward primer GZQTeCOX1-F having a nucleotide sequence as shown in SEQ ID NO: 13, a reverse primer GZQTeCOX1-R having a nucleotide sequence as shown in SEQ ID NO: 14, and a TaqMan probe GZQTeCOX1-P having a nucleotide sequence as shown in SEQ ID NO: 15;

[0013] The TaqMan probe is fluorescently labeled, with a fluorescent emission group labeled at its 5' end and a fluorescent quenching group labeled at its 3' end.

[0014] In some embodiments, the 5′ end of the TaqMan probe GZQTgG3PDH-P is labeled with a FAM fluorescent emission group, and the 3′ end is labeled with a QSY fluorescent quenching group; the 5′ end of the TaqMan probe GZQNcNC5-P is labeled with a VIC fluorescent emission group, and the 3′ end is labeled with a QSY fluorescent quenching group; the 5′ end of the TaqMan probe GZQEsADF-P is labeled with an ABY fluorescent emission group, and the 3′ end is labeled with a QSY fluorescent quenching group; the 5′ end of the TaqMan probe GZQGlGDH-P is labeled with a JUN fluorescent emission group, and the 3′ end is labeled with a QSY fluorescent quenching group; the 5′ end of the TaqMan probe GZQTeCOX1-P is labeled with a CY5 fluorescent emission group, and the 3′ end is labeled with an MGB-NFQ fluorescent quenching group.

[0015] In a second aspect, the present invention provides a five-fold real-time fluorescence quantitative PCR detection kit for simultaneously detecting Toxoplasma gondii, Neospora, Eimeria swirlingii, Giardia lamblia and Trypanosoma evansi, which comprises the five-fold real-time fluorescence quantitative PCR primer and TaqMan probe combination provided in the first aspect of the present invention.

[0016] In some embodiments, the kit also includes a positive control, wherein the positive control includes a recombinant plasmid containing the G3PDH gene of Toxoplasma gondii (pG3PDH), a recombinant plasmid containing the NC5 gene of Neospora (pNcNC5), a recombinant plasmid containing the ADF gene of Eimeria stewardii (pEsADF), a recombinant plasmid containing the GDH gene of Giardia lamblia (pGlGDH), and a recombinant plasmid containing the COX1 gene of Trypanosoma evansi (pTeCOX1).

[0017] In some embodiments, the kit also includes a negative control, wherein the negative control includes a system that does not contain the Toxoplasma gondii G3PDH gene, the Neospora NC5 gene, the Eimeria skrjabini ADF gene, the Giardia lamblia GDH gene and the Trypanosoma evansi COX1 gene, and can further be selected as nuclease-free water.

[0018] In the third aspect, the present invention provides the use of the quintuple real-time fluorescence quantitative PCR primer and TaqMan probe combination provided in the first aspect of the present invention or the quintuple real-time fluorescence quantitative PCR detection kit provided in the second aspect of the present invention for simultaneously detecting Toxoplasma gondii, Neospora, Eimeria stewardii, Giardia lamblia and Trypanosoma evansi in the same system.

[0019] In a fourth aspect, the present invention provides a five-fold real-time fluorescence quantitative PCR detection method for simultaneously detecting Toxoplasma gondii, Neospora, Eimeria skrjavinii, Giardia lamblia and Trypanosoma evansi, which comprises using the five-fold real-time fluorescence quantitative PCR primer and TaqMan probe combination provided by the first aspect of the present invention or the five-fold real-time fluorescence quantitative PCR detection kit provided by the second aspect of the present invention to perform five-fold real-time fluorescence quantitative PCR amplification on genomic DNA extracted from the sample to be tested, and collecting fluorescence signals to perform qualitative detection of Toxoplasma gondii, Neospora, Eimeria skrjavinii, Giardia lamblia and Trypanosoma evansi, and / or perform quantitative detection of parasite nucleic acids determined to be contained.

[0020] In some embodiments, the method comprises the following steps:

[0021] 1) Establishing a standard curve: using positive controls of Toxoplasma gondii, Neospora, Eimeria skrjavinii, Giardia lamblia and Trypanosoma evansi to prepare plasmid standards of gradient concentrations (each plasmid standard contains positive controls of Toxoplasma gondii, Neospora, Eimeria skrjavinii, Giardia lamblia and Trypanosoma evansi at equal concentrations); using plasmid standards of different concentrations as templates, using the five-fold real-time fluorescence quantitative PCR primer and TaqMan probe combination provided by the first aspect of the present invention to perform five-fold real-time fluorescence quantitative PCR detection, after the detection, plotting the concentration Log10 value (X axis) of each plasmid standard against its corresponding Ct value (Y axis) to obtain a standard curve;

[0022] 2) extracting genomic nucleic acid from the sample to be tested, using the extracted genomic nucleic acid as a template, and performing quintuple real-time fluorescent quantitative PCR detection using the quintuple real-time fluorescent quantitative PCR primer and TaqMan probe combination provided by the first aspect of the present invention;

[0023] 3) using the specific amplification curve and the obtained Ct value to qualitatively detect Toxoplasma gondii, Neospora, Eimeria stuartii, Giardia lamblia and Trypanosoma evansi, and / or quantitatively detecting the parasite nucleic acid determined to be contained according to the standard curve obtained in step 1).

[0024] In some embodiments, the reaction system for five-plex real-time fluorescence quantitative PCR detection in step 1) and step 2) includes: GZQTgG3PDH-F, GZQTgG3PDH-R, GZQNcNC5-F, GZQNcNC5-R, GZQEsADF-F, GZQEsADF-R, GZQGlGDH-F and GZQGlGDH-R with a final concentration of 200-300 nM, GZQTeCOX1-F and GZQTeCOX1-R with a final concentration of 400-500 nM, GZQTgG3PDH-P, GZQTgG3PDH-P, GZQEsADF-P and GZQGlGDH-P with a final concentration of 50-100 nM, and GZQTeCOX1-P with a final concentration of 100-200 nM.

[0025] In some embodiments, the reaction procedure for quintuple real-time fluorescence quantitative PCR detection in step 1) and step 2) includes: 50°C for 2 min, 1 cycle; 95°C for 10 min, 1 cycle; 95°C for 15 s, 60°C for 1 min, 40 cycles.

[0026] In some embodiments, the judgment criteria of the qualitative detection are:

[0027] In the channel corresponding to the fluorescent emission group (e.g., FAM) labeled at the 5′ end of GZQTgG3PDH-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is judged as positive for Toxoplasma gondii nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, the result is judged as negative for Toxoplasma gondii nucleic acid; if 35<Ct value<38 and a specific fluorescence amplification curve appears, the result is judged as suspicious for Toxoplasma gondii nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-inspection. If the re-inspection Ct value is <38, it is judged as positive, otherwise it is judged as negative;

[0028] In the channel corresponding to the fluorescent emission group (such as VIC) labeled at the 5′ end of GZQNcNC5-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is judged as positive for Neospora nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, the result is judged as negative for Neospora nucleic acid; if 35<Ct value<38, and a specific fluorescence amplification curve appears, the result is judged as suspicious for Neospora nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-inspection. If the re-inspection Ct value is <38, it is judged as positive, otherwise it is judged as negative;

[0029] In the channel corresponding to the fluorescent emission group (e.g., ABY) labeled at the 5′ end of GZQEsADF-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is determined to be positive for Eimeria skrjabini nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, the result is determined to be negative for Eimeria skrjabini nucleic acid; if 35<Ct value<38 and a specific fluorescence amplification curve appears, the result is determined to be suspicious for Eimeria skrjabini nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-inspection. If the re-inspection Ct value is <38, it is determined to be positive, otherwise it is determined to be negative;

[0030] In the channel corresponding to the fluorescent emission group (e.g., JUN) labeled at the 5′ end of GZQGlGDH-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is judged as positive for Giardia lamblia nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, the result is judged as negative for Giardia lamblia nucleic acid; if 35<Ct value<38, and a specific fluorescence amplification curve appears, the result is judged as suspicious for Giardia lamblia nucleic acid, and the suspicious sample needs to be resampled to extract DNA for retesting. If the retest Ct value is <38, it is judged as positive, otherwise it is judged as negative;

[0031] In the channel corresponding to the fluorescent emission group (e.g., CY5) labeled at the 5′ end of GZQTeCOX1-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is judged to be positive for Trypanosoma evansi nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, the result is judged to be negative for Trypanosoma evansi nucleic acid; if 35<Ct value<38, and a specific fluorescence amplification curve appears, the result is judged to be suspicious for Trypanosoma evansi nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-examination. If the re-examination Ct value is <38, it is judged to be positive, otherwise it is judged to be negative.

[0032] In some embodiments, the detection limits of the method for Toxoplasma gondii, Neospora, Eimeria stetzneri, Giardia lamblia, and Trypanosoma evansi are 2.0 copies / μL, 1.5 copies / μL, 1.5 copies / μL, 1.8 copies / μL, and 1.1 copies / μL, respectively.

[0033] Compared with the prior art, the present invention has the following characteristics:

[0034] 1. The present invention targets the current domestic and foreign epidemic strains of Toxoplasma gondii, Neospora, Eimeria stuartii, Giardia lamblia and Trypanosoma evansi, respectively, and selects G3PDH gene, NC5 gene, ADF gene, GDH gene and COX1 gene as target detection genes. After multiple gene sequences are compared, the segments with very low gene homology and more mutation sites are eliminated, and finally the highly conserved regions in the sequences of G3PDH gene, NC5 gene, ADF gene, GDH gene and COX1 gene are selected to design primers and probes. However, since the purpose of the present invention is to simultaneously detect the above five parasite target detection genes in the same detection system (i.e., using five fluorescence channels), if the detection system for each target detection gene is not compatible, the Ct value gap of the detection is too large, and / or interference occurs between each primer and probe, it will lead to fluorescence inhibition, thereby affecting the detection rate during the detection process. In view of this, the inventors, through creative efforts, further designed and determined primer and probe sets with similar amplification efficiencies for detecting the above-mentioned five parasite nucleic acids in the shorter highly conserved sequences of the above-mentioned five target detection genes, and at the same time, by adjusting the ratio of primers to fluorescent probes in the detection system during the PCR amplification process, the amplification efficiency for different parasite nucleic acids was further kept consistent.

[0035] 2. When Toxoplasma gondii, Neospora, Eimeria skrjavinii, Giardia lamblia and Trypanosoma evansi are co-infected, it is time-consuming, labor-intensive and costly to determine whether there is a co-infection of multiple parasites by single-plex fluorescence PCR alone. The present invention provides a method and a kit for simultaneously detecting Toxoplasma gondii, Neospora, Eimeria skrjavinii, Giardia lamblia and Trypanosoma evansi in the same detection system. The method uses specific probes respectively targeting the G3PDH gene of Toxoplasma gondii, the NC5 gene of Neospora, the ADF gene of Eimeria skrjavinii, the GDH gene of Giardia lamblia and the COX1 gene of Trypanosoma evansi, and respectively labeled with fluorescent emission groups, so as to determine whether there is a co-infection of multiple parasites at one time, which saves time and labor, and can significantly reduce the detection cost.

[0036] 3. The method and kit provided by the present invention have strong specificity. There is no non-specific amplification curve for related parasites such as Strongyloides stercoralis, Tetrapterygium stygii, Tubuloideae occulta, Tubuloideae muris and Balantidium coli, which can ensure the accuracy of detection.

[0037] 4. The present invention provides a method and kit for rapidly detecting Toxoplasma gondii, Neospora, Eimeria swirlingensis, Giardia lamblia and Trypanosoma evansi, which are qualitative, quantitative, highly sensitive (the detection limits for Toxoplasma gondii, Neospora, Eimeria swirlingensis, Giardia lamblia and Trypanosoma evansi are 2.0 copies / μL, 1.5 copies / μL, 1.5 copies / μL, 1.8 copies / μL and 1.1 copies / μL, respectively), highly specific, repeatable and stable (the coefficient of variation (CV value) of intra-batch and inter-batch repeatability tests are both less than 3%). BRIEF DESCRIPTION OF THE DRAWINGS

[0038] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0039] Figure 1 The five-fold real-time fluorescence quantitative PCR detection method provided by the present invention is used to detect the fluorescence amplification curve of Toxoplasma gondii.

[0040] Figure 2 The present invention provides a standard curve for detecting Toxoplasma gondii using the quintuple real-time fluorescence quantitative PCR detection method.

[0041] Figure 3 The present invention provides a five-fold real-time fluorescence quantitative PCR detection method for detecting the fluorescence amplification curve of Neospora.

[0042] Figure 4 The present invention provides a standard curve for detecting Neospora using the five-fold real-time fluorescence quantitative PCR detection method.

[0043] Figure 5 The invention provides a five-fold real-time fluorescence quantitative PCR detection method for detecting the fluorescence amplification curve of Eimeria skrjabini.

[0044] Figure 6 The invention provides a standard curve for detecting Eimeria skrjabini using the five-fold real-time fluorescence quantitative PCR detection method.

[0045] Figure 7 The present invention provides a five-fold real-time fluorescence quantitative PCR detection method for detecting the fluorescence amplification curve of Giardia lamblia.

[0046] Figure 8 The invention provides a standard curve for detecting Giardia lamblia using the five-fold real-time fluorescence quantitative PCR detection method.

[0047] Fig. 9 The invention provides a five-fold real-time fluorescence quantitative PCR detection method for detecting the fluorescence amplification curve of Trypanosoma evansi.

[0048] Fig.10 The invention provides a standard curve for detecting Trypanosoma evansi using the quintuple real-time fluorescence quantitative PCR detection method.

[0049] Fig.11 This is a fluorescence amplification curve of a specificity test of the five-plex real-time fluorescence quantitative PCR detection method provided by the present invention. DETAILED DESCRIPTION

[0050] The present invention designs and synthesizes specific primers and probes for the five target detection genes of Toxoplasma gondii G3PDH gene, Neospora NC5 gene, Eimeria skrjavinii ADF gene, Giardia lamblia GDH gene and Trypanosoma evansi COX1 gene sequence, establishes a five-probe method real-time fluorescence quantitative PCR method that can simultaneously detect five parasites in the same system, and thus provides a convenient detection kit. The kit and the detection method can simultaneously detect the target detection genes of Toxoplasma gondii, Neospora, Eimeria skrjavinii, Giardia lamblia and Trypanosoma evansi, the primers and probes for different target detection genes do not interfere with each other, and have the characteristics of qualitative and quantitative detection, high sensitivity, strong specificity, good repeatability and good stability.

[0051] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. It should be noted that the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0052] The methods for obtaining various biological materials described in the examples are only provided as an experimental method to achieve the specific disclosed purpose, and should not be construed as limiting the sources of the biological materials of the present invention. In fact, the sources of the biological materials used are extensive, and any biological material that can be obtained without violating laws and moral ethics can be replaced and used according to the instructions in the examples.

[0053] All primers and probes used can be synthesized using existing techniques.

[0054] Example 1. Design and determination of primers and TaqMan probes for quintuple real-time fluorescence quantitative PCR for simultaneous detection of Toxoplasma gondii, Neospora, Eimeria skrjabini, Giardia lamblia and Trypanosoma evansi

[0055] The present invention targets the main epidemic strains of Toxoplasma gondii, Neospora, Eimeria skrjavinii, Giardia lamblia and Trypanosoma evansi at home and abroad, selects Toxoplasma gondii G3PDH gene, Neospora nc5 gene, Eimeria skrjavinii ADF gene, Giardia lamblia GDH gene and Trypanosoma evansi COX1 gene as target detection genes respectively, removes segments with very low gene homology and more mutation sites after multi-gene sequence comparison, finally selects highly conserved regions in the G3PDH gene, NC5 gene, ADF gene, GDH gene and COX1 gene sequences, designs primers and probes, and further makes the amplification efficiency of nucleic acids for different parasites close, and does not interfere with each primer and probe and thus does not cause fluorescence inhibition, etc., and finally determines to obtain primer and probe combinations for detecting Toxoplasma gondii, Neospora, Eimeria skrjavinii, Giardia lamblia and Trypanosoma evansi, as shown below.

[0056] The primer probe combination for detecting the G3PDH gene of Toxoplasma gondii includes:

[0057] Forward primer GZQTgG3PDH-F: 5′-TTGCATAGGTTGCAGTCACTGA-3′ (SEQ ID NO: 1);

[0058] Reverse primer GZQTgG3PDH-R: 5′-ACCAAAGTTGCACAGATACTCATGA-3′ (SEQ ID NO: 2);

[0059] TaqMan probe GZQTgG3PDH-P: 5'-(FAM)-CCCCTCTGCTGGCGAAAAGTGAAA-(QSY)-3' (SEQ ID NO: 3).

[0060] The detection segment for the G3PDH gene of Toxoplasma gondii is:

[0061] TTGCATAGGTTGCAGTCACTGACGAGCTCCCCTCTGCTGGCGAAAAGTGAAATTCATGAGTATCTGTGCAACTTTGGT (SEQ ID NO: 16).

[0062] The primer probe combination used to detect the NC5 gene of Neospora includes:

[0063] Forward primer GZQNcNC5-F: 5′-GCGGACGGGTCGTTGTT-3′ (SEQ ID NO: 4);

[0064] Reverse primer GZQNcNC5-R: 5′-CCGTTCACACACTATAGCCACAAA-3′ (SEQ ID NO: 5);

[0065] TaqMan probe GZQNcNC5-P: 5'-(VIC)-CCTGCGGCAGCAAGGCTCCTT-(QSY)-3' (SEQ ID NO: 6).

[0066] The detection segment for the NC5 gene of Neospora is:

[0067] GCGGACGGGTCGTTGTTGGGCGCAGCCTGCGGCAGCAAGGCTCCTTTTTTGTTTGTGGCTATAGTGTGTGAACGG (SEQ ID NO: 17).

[0068] The primer probe combination for detecting the ADF gene of Eimeria skrjabini includes:

[0069] Forward primer GZQEsADF-F: 5′-TCATCCTCAAGATTGACCACGAT-3′ (SEQ ID NO: 7);

[0070] Reverse primer GZQEsADF-R: 5′-TCACTAGCTGGAAGTTCCTTTGTG-3′ (SEQ ID NO: 8);

[0071] TaqMan probe GZQEsADF-P: 5′-(ABY)-AAGGGCACTGGTGACGCCTCAACTC-(QSY)-3′ (SEQ ID NO: 9).

[0072] The detection segment for the ADF gene of Eimeria skrjabini is:

[0073] TCATCCTCAAGATTGACCACGATGAGATTGTGGTTGAGAAGAAGGGCACTGGTGAC GCCTCAACTCTCACAAAGGAACTTCCAGCTAGTGA (SEQ ID NO: 18).

[0074] The primer probe combination for detecting the GDH gene of Giardia lamblia includes:

[0075] Forward primer GZQG1GDH-F: 5′-GGGCGGCTCCGACTTT-3′ (SEQ ID NO: 10);

[0076] Reverse primer GZQG1GDH-R: 5′-ACTGGCAGAAGCGCATGAC-3′ (SEQ ID NO: 11);

[0077] TaqMan probe GZQGlGDH-P: 5'-(JUN)-ACCCAAAGGGCAAGTCCGACAACG-(QSY)-3' (SEQ ID NO: 12).

[0078] The detection segment for the GDH gene of Giardia lamblia is:

[0079] GGGCGGCTCCGACTTTGACCCAAAGGGCAAGTCCGACAACGAGGTCATGCGCTTC TGCCAGT (SEQ ID NO: 19).

[0080] The primer probe combination for detecting the COX1 gene of Trypanosoma evansi includes:

[0081] Forward primer GZQTeCOX1-F: 5′-GGGTGACTTAGCCCATGCA-3′ (SEQ ID NO: 13);

[0082] Reverse primer GZQTeCOX1-R: 5′-CCCACACAATTGAAGAGAGAAAATAG-3′ (SEQ ID NO: 14);

[0083] TaqMan probe GZQTeCOX1-P: 5′-(CY5)-AGCCTCGGGTGATC-MGB-NFQ-3′ (SEQ ID NO: 15).

[0084] The detection segment for the COX1 gene of Trypanosoma evansi is:

[0085] GGGTGACTTAGCCCATGCAGGAGCCTCGGGTGATCTAACTATTTTTCTCTCTTCAATT GTGTGGG (SEQ ID NO: 20).

[0086] Example 2: Five-plex real-time fluorescence quantitative PCR detection method

[0087] The method for simultaneously performing five-fold real-time fluorescence quantitative PCR detection of five parasites in a sample to be tested using the primer and probe combination designed in Example 1 in the same detection system specifically comprises the following steps:

[0088] 1. Extract the total DNA of the sample to be tested for later use;

[0089] 2. Prepare the reaction system: For example, a 20 μL reaction system may include: 10 μL TaqMan Mix (purchased from ThermoFisher Scientific), 3 μL primers and TaqMan probe Mix (GZQTgG3PDH-F concentration is 220 nM (final concentration, the same below), GZQTgG3PDH-R concentration is 220 nM, GZQTgG3PDH-P concentration is 60 nM, GZQNcNC5-F concentration is 220 nM, GZQNcNC5-R concentration is 220 nM, GZQNcNC5-P concentration is 60 nM, GZQEsADF-F concentration is 220 nM, and GZQTgG3PDH-R concentration is 220 nM. M, GZQEsADF-R concentration was 220 nM, GZQEsADF-P concentration was 60 nM, GZQGlGDH-F concentration was 220 nM, GZQGlGDH-R concentration was 220 nM, GZQGlGDH-P concentration was 60 nM, GZQTeCOX1-F concentration was 440 nM, GZQTeCOX1-R concentration was 440 nM, GZQTeCOX1-P concentration was 120 nM), 5 μL template DNA and 2 μL nuclease-free water.

[0090] 3. Amplification program: 50℃2min, 1 cycle; 95℃10min, 1 cycle; 95℃15s, 60℃1min, 40 cycles. Five fluorescence channels were used, namely: FAM fluorescence channel: the fluorescence emission group is "FAM" and the quenching group is "QSY"; VIC fluorescence channel: the fluorescence emission group is "VIC" and the quenching group is "QSY"; ABY fluorescence channel: the fluorescence emission group is "ABY" and the quenching group is "QSY"; JUN fluorescence channel: the fluorescence emission group is "JUN" and the quenching group is "QSY"; CY5 fluorescence channel: the fluorescence emission group is "CY5" and the quenching group is "MGB-NFQ".

[0091] 4. Result determination

[0092] The positive control has five channels with Ct values ​​less than 30 and a specific S-shaped fluorescence amplification curve, and the negative control has no Ct value and no specific fluorescence amplification curve. If both are true, the experimental results can be determined to be true. The test result judgment criteria are shown in Table 1.

[0093] Table 1: Test result judgment criteria

[0094]

[0095] In the FAM fluorescence channel, if the Ct value of the sample to be tested is ≤35 and a specific S-shaped fluorescence amplification curve appears, it is judged as positive for Toxoplasma gondii nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, it is judged as negative for Toxoplasma gondii nucleic acid; if 35<Ct value<38 and a specific fluorescence amplification curve appears, it is judged as suspicious for Toxoplasma gondii nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-examination. If the Ct value is <38, it is judged as positive, otherwise it is judged as negative;

[0096] In the VIC fluorescence channel, if the Ct value of the sample to be tested is ≤35 and a specific S-shaped fluorescence amplification curve appears, it is judged as positive for Neospora nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, it is judged as negative for Neospora nucleic acid; if 35<Ct value<38 and a specific fluorescence amplification curve appears, it is judged as suspicious for Neospora nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-examination. If the Ct value is <38, it is judged as positive, otherwise it is judged as negative;

[0097] In the ABY fluorescence channel, if the Ct value of the sample to be tested is ≤35 and a specific S-shaped fluorescence amplification curve appears, it is judged as positive for Eimeria skrjabini nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, it is judged as negative for Eimeria skrjabini nucleic acid; if 35<Ct value<38 and a specific fluorescence amplification curve appears, it is judged as suspicious for Eimeria skrjabini nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-inspection. If the Ct value is <38, it is judged as positive, otherwise it is judged as negative;

[0098] In the JUN fluorescence channel, if the Ct value of the sample to be tested is ≤35 and a specific S-shaped fluorescence amplification curve appears, it is judged as positive for Giardia lamblia nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, it is judged as negative for Giardia lamblia nucleic acid; 35<Ct value<38 and a specific fluorescence amplification curve appears, it is judged as suspicious for Giardia lamblia nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-testing. If the Ct value is less than 38, it is judged as positive, otherwise it is judged as negative;

[0099] In the CY5 fluorescence channel, if the Ct value of the sample to be tested is ≤35 and a specific S-shaped fluorescence amplification curve appears, it is judged as positive for Trypanosoma evansi nucleic acid; if there is no Ct value and no specific amplification curve, it is judged as negative for Trypanosoma evansi nucleic acid; if 35<Ct value<38 and a specific fluorescence amplification curve appears, it is judged as suspicious for Trypanosoma evansi nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-examination. If the Ct value is <38, it is judged as positive, otherwise it is judged as negative.

[0100] Example 3: Quintuple real-time fluorescence quantitative PCR detection kit

[0101] The present invention also provides a five-fold real-time fluorescence quantitative PCR detection kit for simultaneously identifying and detecting Toxoplasma gondii, Neospora, Eimeria stuartii, Giardia lamblia and Trypanosoma evansi in the same detection system, which may include:

[0102] Example 1 The five-plex real-time fluorescence quantitative PCR primers and TaqMan probes designed and determined for simultaneous detection of Toxoplasma gondii, Neospora, Eimeria stuartii, Giardia lamblia and Trypanosoma evansi are specifically:

[0103] The real-time fluorescent quantitative PCR primers and TaqMan probe for detecting Toxoplasma gondii include: a forward primer GZQTgG3PDH-F having a nucleotide sequence as shown in SEQ ID NO: 1, a reverse primer GZQTgG3PDH-R having a nucleotide sequence as shown in SEQ ID NO: 2, and a TaqMan probe GZQTgG3PDH-P having a nucleotide sequence as shown in SEQ ID NO: 3;

[0104] The real-time fluorescent quantitative PCR primers and TaqMan probe for detecting Neospora include: a forward primer GZQNcNC5-F having a nucleotide sequence as shown in SEQ ID NO:4, a reverse primer GZQNcNC5-R having a nucleotide sequence as shown in SEQ ID NO:5, and a TaqMan probe GZQNcNC5-P having a nucleotide sequence as shown in SEQ ID NO:6;

[0105] The real-time fluorescence quantitative PCR primers and TaqMan probe for detecting Eimeria skrjabini include: a forward primer GZQEsADF-F whose nucleotide sequence is shown in SEQ ID NO:7, a reverse primer GZQEsADF-R whose nucleotide sequence is shown in SEQ ID NO:8, and a TaqMan probe GZQEsADF-P whose nucleotide sequence is shown in SEQ ID NO:9;

[0106] The real-time fluorescence quantitative PCR primers and TaqMan probe for detecting Giardia lamblia include: a forward primer GZQG1GDH-F having a nucleotide sequence as shown in SEQ ID NO: 10, a reverse primer GZQG1GDH-R having a nucleotide sequence as shown in SEQ ID NO: 11, and a TaqMan probe GZQG1GDH-P having a nucleotide sequence as shown in SEQ ID NO: 12;

[0107] The real-time fluorescent quantitative PCR primers and TaqMan probe for detecting Trypanosoma evansi include: a forward primer GZQTeCOX1-F having a nucleotide sequence as shown in SEQ ID NO:13, a reverse primer GZQTeCOX1-R having a nucleotide sequence as shown in SEQ ID NO:14, and a TaqMan probe GZQTeCOX1-P having a nucleotide sequence as shown in SEQ ID NO:15.

[0108] The TaqMan probe is fluorescently labeled, with a fluorescent emission group labeled at the 5' end and a fluorescent quenching group labeled at the 3' end. For example, the fluorescent emission group can be selected from the group consisting of FAM, VIC, ABY, JUN, and CY5, and the fluorescent quenching group can be selected from the group consisting of QSY and MGB-NFQ, and the fluorescent emission groups labeled at the 5' end of the TaqMan probe for different parasites are different.

[0109] Specifically, in the kit provided by the present invention, the 5′ end and 3′ end of each TaqMan probe can be labeled as follows: the 5′ end of the TaqMan probe GZQTgG3PDH-P is labeled with FAM, and the 3′ end is labeled with QSY; the 5′ end of the TaqMan probe GZQNcNC5-P is labeled with VIC, and the 3′ end is labeled with QSY; the 5′ end of the TaqMan probe GZQEsADF-P is labeled with ABY, and the 3′ end is labeled with QSY; the 5′ end of the TaqMan probe GZQGlGDH-P is labeled with JUN, and the 3′ end is labeled with QSY; the 5′ end of the TaqMan probe GZQTeCOX1-P is labeled with CY5, and the 3′ end is labeled with MGB-NFQ. The reason why the present invention selects the five fluorescent emission groups of FAM, VIC, ABY, JUN, and CY5 is that experiments have shown that the relative emission spectra of the five fluorescent emission groups have a high degree of matching with the filters of different channels of the instrument, the overlapping spectra are small, and the intensities of the five fluorescent signals are comparable, so better performance can be obtained in a multiple experimental system.

[0110] For the convenience of detection, the kit also includes a positive control (as described in detail in Example 4 below), wherein the positive control includes a recombinant plasmid containing the G3PDH gene of Toxoplasma gondii (pTgG3PDH), a recombinant plasmid containing the NC5 gene of Neospora (pTgNcNC5), a recombinant plasmid containing the ADF gene of Eimeria stewardii (pEsADF), a recombinant plasmid containing the GDH gene of Giardia lamblia (pGlGDH) and a recombinant plasmid containing the COX1 gene of Trypanosoma evansi (pTeCOX1).

[0111] For the convenience of detection, the kit also includes a negative control, wherein the negative control includes a system without the Toxoplasma gondii G3PDH gene, the Neospora NC5 gene, the Eimeria stuartii ADF gene, the Giardia lamblia GDH gene and the Trypanosoma evansi COX1 gene, and can further be selected as nuclease-free water.

[0112] To facilitate detection, the kit may also include instructions for the five-plex real-time fluorescence quantitative PCR detection method provided in Example 2.

[0113] Example 4: Characteristics of the Quintuple Real-Time Fluorescence Quantitative PCR Detection Method and Kit

[0114] 4.1. Preparation of positive control

[0115] TaKaRa was used to synthesize the Toxoplasma gondii G3PDH gene, Neospora NC5 gene, Eimeria skrjavinj ADF gene, Giardia lamblia GDH and Trypanosoma evansi COX1 gene. The above synthesized gene fragments were respectively connected to the pMD19-T vector and transformed into the JM109 strain. The positive recombinants obtained were used as respective positive controls and named pTgG3PDH (Toxoplasma gondii), pNcNC5 (Neospora), pEsADF (Eimeria skrjavinj), pGlGDH (Giardia lamblia) and pTeCOX1 (Trypanosoma evansi).

[0116] 4.2. Optimization of conditions for quintuple real-time fluorescence quantitative PCR detection method

[0117] Plasmid DNA (i.e., each positive control) was extracted using the QIAGEN Plasmid Maxi Kit from Qiagen, Germany. The concentration of plasmid DNA was determined using an ultraviolet spectrophotometer. The five positive controls were serially diluted 10-fold and the concentration was 10 5The dilution of 1:1:1:1:1 copies / μL was mixed as a template, and the total system was 20 μL. The forward and reverse primers were mixed with the corresponding probes at different primer final concentrations and probe final concentrations. The forward primer, reverse primer and corresponding probe were added with 0.44 μL, 0.44 μL, 0.12 μL (final concentrations 440 nM, 440 nM, 120 nM), 0.22 μL, 0.22 μL, 0.06 μL (final concentrations 220 nM, 220 nM) and 0.12 μL (final concentrations 220 nM, 220 nM) respectively. , 60nM), 0.11μL, 0.11μL, 0.03μL (final concentration 110nM, 110nM, 30nM), according to the amplification program provided by the present invention: 50℃2min, 1 cycle; 95℃10min, 1 cycle; 95℃15s, 60℃1min, 40 cycles, five-fold real-time fluorescence quantitative PCR reaction was performed, and the ratio of primer and probe concentration when the lowest Ct value and higher fluorescence intensity increase value (ΔRn) were obtained was the best. The results are shown in Table 2.

[0118] Table 2: Results of primer and probe concentration grouping experiments

[0119]

[0120] The results in Table 2 show that the experimental conditions for the optimal reaction system were explored using different combinations of probes and primer concentrations. It was found that when the concentration of GZQTeCOX1-F was 440nM, the concentration of GZQTeCOX1-R was 440nM, the concentration of GZQTeCOX1-P was 120nM, the concentration of GZQTgG3PDH-F was 220nM, the concentration of GZQTgG3PDH-R was 220nM, the concentration of GZQTgG3PDH-P was 60nM, the concentration of GZQNcNC5-F was 220nM, the concentration of GZQNcNC5-R was 220nM, the concentration of GZQNcNC5-P was 60nM, and the concentration of GZQTgG3PDH-F was 220nM. When the concentration of ZQEsADF-F was 220nM, the concentration of GZQEsADF-R was 220nM, the concentration of GZQEsADF-P was 60nM, the concentration of GZQGlGDH-F was 220nM, the concentration of GZQGlGDH-R was 220nM, and the concentration of GZQGlGDH-P was 60nM, the fluorescence intensities of CY5 and VIC in the quintuple real-time fluorescence quantitative PCR reaction were the highest, and the Ct value was also the lowest (because the fluorescence of CY5 and VIC in the quintuple real-time fluorescence quantitative PCR detection method is relatively weak, so the primer-probe combination with the highest CY5 and VIC fluorescence intensities is selected as the best combination).

[0121] 4.3. Preparation of standard curve

[0122] After 10-fold serial dilutions of the five positive controls, 10 8 , 10 7 , 106 , 10 5 , 10 4 , 10 3 The plasmid standard with gradient concentration of 1000 copies / μL was used as a template to draw the standard curve. A five-fold real-time fluorescence quantitative PCR reaction system was used: TaqMan Mix 10μL, nuclease-free water 2μL, primer and TaqMan probe Mix 3μL, DNA template 5μL. Amplification program: 50℃2min, 1 cycle; 95℃10min, 1 cycle; 95℃15s, 60℃1min, 40 cycles, collect fluorescence signals, and analyze their standard curve.

[0123] The results are as follows Figures 1 to 10 As shown in FIG. 1 , the amplification curves and standard curves of the target detection genes of five parasites were respectively obtained by using the five-fold real-time fluorescence quantitative PCR detection method of the present invention, wherein Figure 1 , Figure 3 , Figure 5 , Figure 7 and Fig. 9 In the amplification curve shown, the six curves from left to right represent 10 8 , 10 7 , 10 6 , 10 5 , 10 4 , 10 3 The results showed that the method of the present invention has a high amplification efficiency (E) for the target detection genes of 5 parasites (Toxoplasma gondii, Neospora, Eimeria stehrenbergi, Giardia lamblia and Trypanosoma evansi), and the E were 95.534%, 96.203%, 107.818%, 100.851% and 104.487%, respectively. The correlation coefficient R 2 The correlation coefficient and amplification efficiency showed that the template amount and the corresponding Ct value had a good linear relationship within the current concentration range of dilution.

[0124] Specificity analysis

[0125] Using DNA from Strongyloides stercoralis, Aspiculuristetraptera, Syphacia obvelata, Syphacia muris, and Balantidium coli as templates and nuclease-free water as a negative control, fluorescent quantitative PCR amplification was performed using the method and kit of the present invention. The results are shown in FIG. Fig.11 As shown, the detection results of the method for the above parasites were all negative, while the detection results for Toxoplasma gondii, Neospora, Eimeria stuartii, Giardia lamblia and Trypanosoma evansi were positive, indicating that the method has strong specificity and has no cross-reaction with other parasites.

[0126] Sensitivity analysis

[0127] Plasmid standards of Toxoplasma gondii, Neospora, Eimeria stuartii, Giardia lamblia, and Trypanosoma evansi at different dilutions were used to evaluate the analytical sensitivity of the method. Plasmid standards of each dilution concentration were used as templates, and the reaction was carried out according to the reaction system and amplification procedure of the five-fold real-time fluorescence quantitative PCR detection method provided. In the case of higher concentration plasmid standards, 8 replicates were made for each dilution; in the case of lower concentration plasmid standards, 20 replicates were made for each dilution. The results are shown in Table 3.

[0128] Table 3: Detection limit determination of the five-plex real-time fluorescence quantitative PCR detection method

[0129]

[0130] The results in Table 3 show that the detection limits of Toxoplasma gondii, Neospora, Eimeria stetzneri, Giardia lamblia and Trypanosoma evansi are 2.0 copies / μL, 1.5 copies / μL, 1.5 copies / μL, 1.8 copies / μL and 1.1 copies / μL, respectively, indicating that the method of the present invention has high sensitivity.

[0131] Stability analysis

[0132] Five concentrations of 10-fold serial dilutions of plasmid standard were used as templates, followed by 10 7 , 10 6 , 10 5 , 10 4 , 10 3 The reaction was carried out according to the reaction system and amplification procedure of the five-fold real-time fluorescence quantitative PCR detection method provided. In the same experiment, three replicates were made for each dilution of the plasmid standard to analyze the intra-batch differences of the method; then, the same plasmid standard was used as a template, and an independent repeated experiment was carried out for 3 consecutive days within a week. In the same experiment, three replicates were made for each dilution of the plasmid standard to analyze the inter-batch differences of the method. The coefficient of variation (CV) of the Ct value was statistically calculated to verify the repeatability and stability of the method. The results are shown in Table 4.

[0133] Table 4: Results of repeatability and stability test of quintuple real-time fluorescence quantitative PCR detection method

[0134]

[0135] The results in Table 4 show that the intra-batch coefficients of variation of the five-fold real-time fluorescence quantitative PCR detection method for detecting Toxoplasma gondii, Neospora, Eimeria stuartii, Giardia lamblia and Trypanosoma evansi are 0.07% to 0.59%, 0.07% to 0.75%, 0.19% to 2.10%, 0.28% to 1.43% and 0.33% to 0.95% respectively. The inter-batch coefficients of variation of the five-fold real-time fluorescence quantitative PCR detection method for detecting Toxoplasma gondii, Neospora, Eimeria stuartii, Giardia lamblia and Trypanosoma evansi are 0.40% to 0.75%, 0.22% to 0.80%, 0.46% to 1.49%, 0.50% to 2.13% and 0.26% to 0.89% respectively. It can be seen that the coefficients of variation (CV values) of the intra-batch and inter-batch repeatability tests are both less than 3%, indicating that the repeatability and stability of the method of the present invention are good.

[0136] Example 5: Clinical diagnostic performance of the five-plex real-time fluorescence quantitative PCR detection method

[0137] DNA extracted from 600 Huyang clinical specimens (including blood, serum and rectal swabs) collected in Yanji area, Yanbian Prefecture, Jilin Province in September 2023 was used to detect Toxoplasma gondii, Neospora, Eimeria stuartii, Giardia lamblia and Trypanosoma evansi in these clinical samples using the five-fold real-time fluorescence quantitative PCR detection method and kit established by the present invention, and the epidemiological survey data were analyzed. When testing clinical samples, positive controls (Toxoplasma gondii, Neospora, Eimeria stuartii, Giardia lamblia and Trypanosoma evansi DNA) and nuclease-free water (as a negative control) were set to exclude false negative and false positive reactions.

[0138] The test results show that among 600 clinical samples, 5 positive samples of Toxoplasma gondii, 5 positive samples of Neospora, 11 positive samples of Eimeria skrjavinii, 66 positive samples of Giardia lamblia, and 0 positive samples of Trypanosoma evansi were detected. Among them, in a closed test tube, 7 double positive samples of Eimeria skrjavinii / Giardia lamblia were detected by the five-fold real-time fluorescence quantitative PCR detection method, that is, these 7 clinical samples contained both Eimeria skrjavinii and Giardia lamblia. The above results show that the five-fold real-time fluorescence quantitative PCR detection method and kit provided by the present invention can be used to detect whether Toxoplasma gondii, Neospora, Eimeria skrjavinii, Giardia lamblia and Trypanosoma evansi are present in clinical samples, and can identify whether the clinical samples are infected with multiple parasites.

[0139] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A five-fold real-time fluorescence quantitative PCR primer and TaqMan probe combination for simultaneously detecting Toxoplasma gondii, Neospora, Eimeria stuartii, Giardia lamblia and Trypanosoma evansi in the same system, characterized in that: The five-plex real-time fluorescence quantitative PCR primer and TaqMan probe combination includes: Real-time fluorescent quantitative PCR primers and TaqMan probes for detecting Toxoplasma gondii, comprising: a forward primer GZQTgG3PDH-F having a nucleotide sequence as shown in SEQ ID NO: 1, a reverse primer GZQTgG3PDH-R having a nucleotide sequence as shown in SEQ ID NO: 2, and a TaqMan probe GZQTgG3PDH-P having a nucleotide sequence as shown in SEQ ID NO: 3; Real-time fluorescent quantitative PCR primers and TaqMan probes for detecting neospora, comprising: a forward primer GZQNcNC5-F having a nucleotide sequence as shown in SEQ ID NO:4, a reverse primer GZQNcNC5-R having a nucleotide sequence as shown in SEQ ID NO:5, and a TaqMan probe GZQNcNC5-P having a nucleotide sequence as shown in SEQ ID NO:6; Real-time fluorescent quantitative PCR primers and TaqMan probes for detecting Eimeria skrjabini, comprising: a forward primer GZQEsADF-F having a nucleotide sequence as shown in SEQ ID NO:7, a reverse primer GZQEsADF-R having a nucleotide sequence as shown in SEQ ID NO:8, and a TaqMan probe GZQEsADF-P having a nucleotide sequence as shown in SEQ ID NO:9; Real-time fluorescent quantitative PCR primers and TaqMan probes for detecting Giardia lamblia, comprising: a forward primer GZQG1GDH-F having a nucleotide sequence as shown in SEQ ID NO: 10, a reverse primer GZQG1GDH-R having a nucleotide sequence as shown in SEQ ID NO: 11, and a TaqMan probe GZQG1GDH-P having a nucleotide sequence as shown in SEQ ID NO: 12; Real-time fluorescence quantitative PCR primers and TaqMan probes for detecting Trypanosoma evansi, comprising: a forward primer GZQTeCOX1-F having a nucleotide sequence as shown in SEQ ID NO: 13, a reverse primer GZQTeCOX1-R having a nucleotide sequence as shown in SEQ ID NO: 14, and a TaqMan probe GZQTeCOX1-P having a nucleotide sequence as shown in SEQ ID NO: 15; The TaqMan probe is fluorescently labeled, with a fluorescent emission group labeled at its 5' end and a fluorescent quenching group labeled at its 3' end.

2. The five-plex real-time fluorescence quantitative PCR primer and TaqMan probe combination according to claim 1, characterized in that: The 5′ end of the TaqMan probe GZQTgG3PDH-P is labeled with a FAM fluorescence emission group, and the 3′ end is labeled with a QSY fluorescence quenching group; The 5′ end of the TaqMan probe GZQNcNC5-P is labeled with a VIC fluorescent emission group, and the 3′ end is labeled with a QSY fluorescent quenching group; The 5′ end of the TaqMan probe GZQEsADF-P is labeled with an ABY fluorescent emission group, and the 3′ end is labeled with a QSY fluorescent quenching group; The 5′ end of the TaqMan probe GZQGlGDH-P is labeled with a JUN fluorescent emission group, and the 3′ end is labeled with a QSY fluorescent quenching group; The 5′ end of the TaqMan probe GZQTeCOX1-P is labeled with a CY5 fluorescent emission group, and the 3′ end is labeled with a MGB-NFQ fluorescent quenching group.

3. A five-fold real-time fluorescence quantitative PCR detection kit for simultaneously detecting Toxoplasma gondii, Neospora, Eimeria skrjabini, Giardia lamblia and Trypanosoma evansi, characterized in that: The kit comprises the five-plex real-time fluorescent quantitative PCR primer and TaqMan probe combination according to claim 1 or 2.

4. The five-fold real-time fluorescence quantitative PCR detection kit according to claim 3, characterized in that: The kit also includes positive controls, wherein the positive controls include a recombinant plasmid containing the G3PDH gene of Toxoplasma gondii, a recombinant plasmid containing the NC5 gene of Neospora, a recombinant plasmid containing the ADF gene of Eimeria skrjabini, a recombinant plasmid containing the GDH gene of Giardia lamblia, and a recombinant plasmid containing the COX1 gene of Trypanosoma evansi.

5. The five-fold real-time fluorescence quantitative PCR detection kit according to claim 4, characterized in that: The kit also includes a negative control, wherein the negative control includes a system without the Toxoplasma gondii G3PDH gene, the Neospora NC5 gene, the Eimeria skrjabini ADF gene, the Giardia lamblia GDH gene and the Trypanosoma evansi COX1 gene.

6. The five-fold real-time fluorescence quantitative PCR detection kit according to claim 5, characterized in that: The negative control was nuclease-free water.

7. Use of the quintuple real-time fluorescence quantitative PCR primer and TaqMan probe combination according to claim 1 or 2 or the quintuple real-time fluorescence quantitative PCR detection kit according to any one of claims 3 to 6 for simultaneously detecting Toxoplasma gondii, Neospora, Eimeria swirlingii, Giardia lamblia and Trypanosoma evansi in the same system for non-disease diagnosis and treatment purposes.

8. A five-fold real-time fluorescence quantitative PCR detection method for simultaneously detecting Toxoplasma gondii, Neospora, Eimeria stuartii, Giardia lamblia and Trypanosoma evansi for non-disease diagnosis and treatment purposes, characterized in that: The method comprises using the five-plex real-time fluorescence quantitative PCR primer and TaqMan probe combination of claim 1 or 2 or the five-plex real-time fluorescence quantitative PCR detection kit of any one of claims 3-6 to perform five-plex real-time fluorescence quantitative PCR amplification on genomic DNA extracted from the sample to be tested, and collecting fluorescence signals to perform qualitative detection of Toxoplasma gondii, Neospora, Eimeria swirlingensis, Giardia lamblia and Trypanosoma evansi, and / or perform quantitative detection of parasite nucleic acids determined to be contained; The method comprises the following steps: 1) Establishing a standard curve: using positive controls of Toxoplasma gondii, Neospora, Eimeria stuartii, Giardia lamblia and Trypanosoma evansi to prepare plasmid standards with gradient concentrations; using plasmid standards of different concentrations as templates, using the five-fold real-time fluorescence quantitative PCR primer and TaqMan probe combination of claim 1 or 2 to perform five-fold real-time fluorescence quantitative PCR detection, after the detection, plotting the concentration Log10 value of each plasmid standard as the X-axis and the corresponding Ct value as the Y-axis to obtain a standard curve; 2) extracting genomic nucleic acid of the sample to be tested, using the extracted genomic nucleic acid as a template, and performing quintuple real-time fluorescent quantitative PCR detection using the quintuple real-time fluorescent quantitative PCR primer and TaqMan probe combination of claim 1 or 2; 3) using the specific amplification curve and the obtained Ct value to qualitatively detect Toxoplasma gondii, Neospora, Eimeria stuartii, Giardia lamblia and Trypanosoma evansi, and / or quantitatively detecting the parasite nucleic acid determined to be contained according to the standard curve obtained in step 1); The judgment criteria for the qualitative test are: In the channel corresponding to the fluorescent emission group labeled at the 5′ end of GZQTgG3PDH-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is judged as positive for Toxoplasma gondii nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, the result is judged as negative for Toxoplasma gondii nucleic acid; if 35<Ct value<38, and a specific fluorescence amplification curve appears, the result is judged as suspicious for Toxoplasma gondii nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-testing. If the re-test Ct value is <38, it is judged as positive, otherwise it is judged as negative; In the channel corresponding to the fluorescent emission group labeled at the 5′ end of GZQNcNC5-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is judged as positive for Neospora nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, the result is judged as negative for Neospora nucleic acid; if 35<Ct value<38, and a specific fluorescence amplification curve appears, the result is judged as suspicious for Neospora nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-testing. If the re-test Ct value is <38, it is judged as positive, otherwise it is judged as negative; In the channel corresponding to the fluorescent emission group labeled at the 5′ end of GZQEsADF-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is judged to be positive for Eimeria skrjabini nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, the result is judged to be negative for Eimeria skrjabini nucleic acid; if 35<Ct value<38, and a specific fluorescence amplification curve appears, the result is judged to be suspicious for Eimeria skrjabini nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-testing. If the re-test Ct value is <38, it is judged to be positive, otherwise it is judged to be negative; In the channel corresponding to the fluorescent emission group labeled at the 5′ end of GZQGlGDH-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is judged as positive for Giardia lamblia nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, the result is judged as negative for Giardia lamblia nucleic acid; if 35<Ct value<38, and a specific fluorescence amplification curve appears, the result is judged as suspicious for Giardia lamblia nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-testing. If the re-test Ct value is <38, it is judged as positive, otherwise it is judged as negative; In the channel corresponding to the fluorescent emission group labeled at the 5′ end of GZQTeCOX1-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is judged to be positive for Trypanosoma evansi nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, the result is judged to be negative for Trypanosoma evansi nucleic acid; if 35<Ct value<38, and a specific fluorescence amplification curve appears, the result is judged to be suspicious for Trypanosoma evansi nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-examination. If the re-examination Ct value is <38, it is judged to be positive, otherwise it is judged to be negative.

9. The five-fold real-time fluorescence quantitative PCR detection method according to claim 8, characterized in that: The reaction system for five-fold real-time fluorescence quantitative PCR detection in step 1) and step 2) includes: GZQTgG3PDH-F, GZQTgG3PDH-R, GZQNcNC5-F, GZQNcNC5-R, GZQEsADF-F, GZQEsADF-R, GZQGlGDH-F and GZQGlGDH-R with a final concentration of 200-300 nM, GZQTeCOX1-F and GZQTeCOX1-R with a final concentration of 400-500 nM, GZQTgG3PDH-P, GZQNcNC5-P, GZQEsADF-P and GZQGlGDH-P with a final concentration of 50-100 nM, and GZQTeCOX1-P with a final concentration of 100-200 nM.

10. The five-fold real-time fluorescence quantitative PCR detection method according to claim 8 or 9, characterized in that: The reaction procedure for the five-plex real-time fluorescence quantitative PCR detection in step 1) and step 2) includes: 50°C for 2 min, 1 cycle; 95°C for 10 min, 1 cycle; 95°C for 15 s, 60°C for 1 min, 40 cycles.

11. The five-fold real-time fluorescence quantitative PCR detection method according to claim 8 or 9, characterized in that: The detection limits of the method for Toxoplasma gondii, Neospora, Eimeria stetzneri, Giardia lamblia and Trypanosoma evansi were 2.0 copies / μL, 1.5 copies / μL, 1.5 copies / μL, 1.8 copies / μL and 1.1 copies / μL, respectively.

Images